Тяжелый острый респираторный синдром: Литературный обзор Тяжёлый острый респираторный синдром (ТОРС), вызываемый коронавирусом.

Содержание

Литературный обзор Тяжёлый острый респираторный синдром (ТОРС), вызываемый коронавирусом.

Инструкция №8 от 19.05.2003

Литературный обзор.

С.В. Нетёсов, В.М. Блинов, Т.Ю. Иванькина, Г.М. Игнатьев, М.И. Кисурина,
Г.Г. Онищенко, Л.С. Сандахчиев.

Введение.

Заболевание атипичная пневмония или тяжёлый острый респираторный синдром (ТОРС) или Severe Acute Respiratory Syndrome (SARS) является вновь выявленным заболеванием, которое впервые возникло в китайской провинции Гуандун, в середине ноября 2002 года и было первоначально описано доктором Карло Урбани в Гонконге. К настоящему времени по данным ВОЗ больные атипичной пневмонией зарегистрированы в 28 странах мира. При этом общее число заболевших на 17 мая 2003 года составило 7761 человек, в том числе 623 смертельных исхода. Заболевание зарегистрировано в 32 странах, наибольшее количество в Китае, Сингапуре, Канаде.

Рис.1 Эпидемическая кривая возможных случаев SARS с 1 января по 22 апреля 2003 года по дате начала болезни [2]

17 марта 2003 года ВОЗ была объявлена глобальная тревога в связи с распространением атипичной пневмонии. Были привлечены 13 лабораторий из 9 стран для проведения объединённых исследований этого заболевания. В качестве приоритетных задач ставилось определение этиологического агента, и затем на основании этого – разработка диагностических тест систем. В результате тесного сотрудничества ученых из лабораторий разных стран первая часть поставленной задачи была выполнена поразительно быстро. 16 апреля 2003 года ВОЗ было объявлено, что этиологическим агентом атипичной пневмонии является новый патоген, вирус SARS относящийся к семейству коронавирусов, но не родственный ни одному из известных штаммов этого вируса [3]. Однако, начатые работы по диагностике возбудителя выявили несоответствия между результатами, полученными Канадской национальной микробиологической лабораторией и Гонконгской группой исследователей. Так по данным последних в 90 % вероятных случаев ТОРС (SARS) присутствовал SARS-связанный коронавирус, при отсутствии его следов у здоровых лиц контрольной группы. Ни одна из проб секрета дыхательных путей, взятых от пациентов с другими респираторными заболеваниями, не содержала РНК коронавируса, и ни один из 200 образцов сывороток, взятых от доноров крови, не содержал сывороточных антител к этому новому коронавирусу [4]. Напротив, по данным канадской группы SARS-связанный коронавирус выявлялся приблизительно у 20 % из 250 человек без подозрения на ТОРС (SARS), которые, были протестированы, так как они приехали в Канаду из зараженных областей Азии или имели незначительные симптомы, которые не считались симптомами ТОРС (SARS) (т.е. слегка смещенная контрольная группа) [5]. Необходимо срочно объяснить это несоответствие, так как оно ставит под вопрос чувствительность, специфичность и уместность применяемых диагностических тестов. Хотя, конечно же, вирусов, вызывающих острую пневмонию, известно не так уж мало: это и РСВ, и хантавирусы, и аденовирусы. Возбудителями пневмонии могут быть также грибы и бактерии, а, кроме того, в разных странах роль этих возбудителей в этиологии ТОРС может быть разной.

Классификация инфекционного агента.

В состав семейства Коронавирусов входят род Коронавирусы и род Торовирусы. Род Коронавирусы объединяет большие, оболочечные, позитивные одноцепочечные РНК-содержащие вирусы, которые вызывают широко распространенные заболевания человека и животных. Его представители могут быть выделены в три серологические подгруппы (Таблица 2). Внутри каждой серогруппы вирусы классифицированы согласно их естественным хозяевам, нуклеотидным последовательностям и серологическим взаимосвязям [6].

Серотипы и хозяева коронавирусов.

Антигенная группа Вирус Хозяин

1

Human coronavirus 229E (HcoV-229E)
Porcine Transmissible gastroenteritis virus (TGEV)
Porcine respiratory coronavirus (PRCoV)
Canine Coronavirus (CcoV) Feline enteric coronavirus (FECoV)
Feline infectious peritonitis virus (FIPV)
Rabbit coronavirus (RbCoV)
Человек
Свиньи
Свиньи
Собаки
Кошки
Кошки
Кролики

2

Human coronavirus OC43 (HcoV- OC43)
Murine hepatitis virus (MHV)
Sialodacryoadenitis virus (SDAV)
Porcine hemagglutinating encephalomyelitis (HEV)
Bovine coronavirus (BcoV)
Turkey coronavirus (TcoV)
Человек
Мыши
Крысы
Свиньи
Крупный рогатый скот
Индюки

3

Avian infectious bronchitis virus (IBV)
Turkey coronavirus (TcoV)
Курицы
Индюки

Коронавирусы имеют самый большой геном из всех РНК вирусов, и рекомбинация у них выявлялась нередко. В настоящее время расшифрованы полные последовательности геномов некоторых коронавирусов — HcoV-229E; MHV; BcoV; IBV Размер их РНК колеблется от 27000 до 32000 нуклеотидных пар [7].

Секвенирование генетического материала коронавируса, выделенного у больных ТОРС (SARS), было впервые проведено одновременно и независимо в лабораториях американских Центров по контролю и профилактике заболеваний (CDC) и канадского Vanderbild University Medical Center. По полученным данным размер генома возбудителя ТОРС (SARS) составляет 29727 п.о. и 29736 п.о. соответственно [8, 9].

Также получены данные по секвенированию нескольких изолятов вируса SARS китайскими исследователями (Institute of Microbiology and Epidemiology of the Academy of Military Medical Sciences and the Beijing Genomics Institute of Chinese Academy of Sciences) [10]. Сравнение последовательностей этих изолятов с данными, представленными американскими и канадскими учеными, позволяет предположить, что вирус может быстро мутировать [11].

По мнению исследователей из Bernard Nocht Institute of Tropical Medicine в Гамбурге, вирус ТОРС (SARS) по нуклеотидным последовательностям отличается на 50-60 % от трёх известных групп коронавирусов, но, несомненно, является типичной вариацией среди существующих групп 2 и 3 коронавирусов [12].

Филогенетический анализ, проведенный различными исследователями на основании сравнения нуклеотидных и аминокислотных последовательностей участков гена полимеразы, представлен на Рисунках 2, 3.

Рисунок 2. Филогенетическое дерево с максимально возможной достоверностью, построенное на основе выравненных последовательностей 405 нуклеотидов открытой рамки считывания 1b гена полимеразы коронавируса (номера нуклеотидов с 15173 по 15578 на основе полного генома коронавируса крупного рогатого скота инвентарный номер NC_003045), для сравнения коронавируса SARS с другими коронавирусами человека и животных.

На дереве видны три основные антигенные группы в Роду коронавирусов (I, II и III), представленные человеческим коронавирусом 229E (HcoV-229E), собачьим коронавирусом (CcoV), вирусом инфекционного кошачьего перитонита (FIPV), вирусом инфекционного гастроэнтерита свиней (TGEV), вирусом эпидемической диареи свиней (TGEV), человеческим коронавирусом OC43 (HcoV-OC43), коронавирусом крупного рогатого скота (BcoV), гемагглютинирующим вирусом энцефаломиелита свиней (HEV), вирусом крысиного сиалодакриоаденита (SDAV), вирусом гепатита мышей (MHV), коронавирусом индюков (TcoV) и вирусом инфекционного бронхита птиц (IBV). Значения бутстрепов для автоматической компенсации погрешностей (на основе 100 повторов), полученные из дерева консенсуса на основе 50 % принципа большинства, показаны на основных внутренних ветвях филограммы. Длины ветвей пропорциональны количеству нуклеотидных межштаммовых замен.[13]

Рисунок 3. Филогенетический анализ частичной белковой последовательности (215 аминокислот) коронавируса SARS [14].

Cравнение полных геномов коронавирусов не позволяет выявить наиболее близкий к вирусу SARS геном, хотя наибольшее число совпадающих линий наблюдается между SARS и бычьим коронавирусом 2-ого типа (рис. 4). Поэтому эволюционные сравнения необходимо проводить по кластерам генов (рис. 5-7). Хотя и здесь разбиение на кластеры также сопряжено с трудностями. В некоторых участках генома вируса SARS наблюдается наибольшее сходство с бычьим коронавирусом, в других участках генома вируса SARS, наоборот, сходство между птичьим коронавирусом и вирусом SARS выше. Правда, при этом степень гомологии очень низка со всеми известными коронавирусами. Блочный тип эволюции (и возможные точки рекомбинации) можно просчитать более точно, но для этого необходимо время и информация по структуре большего числа штаммов коронавирусов.

Ниже приводится сравнение аминокислотных последовательностей генов полимеразы (POL), матриксного (M) и оболочечного (VGL) белков; для других белков выравнивать последовательности практически невозможно, поскольку сходство между ними меньше 20 %. Для двух известных короновирусов человека (штамм 229E и OC43)- ситуация уникальная: наиболее близкий к вирусу SARS штамм OC43 (но для этого штамма нет полной структуры генома), а штамм 229E настолько не похож на вирус SARS, что говорить о каком-то сходстве вообще нельзя. С одной стороны имеется группа короновирусов (бычий/мышиный/человеческий OC43), с другой стороны группа (свиной/кошачий/собачий/человеческий 229E) и наконец группа (птичьи) и все эти три группы равноудалены от вируса SARS. Говорить о блочной рекомбинационной природе агента SARS пока можно только для мышиных коронавирусов, для которых известны структуры 6 полных геномов, для них существуют, по крайней мере, четыре точки рекомбинации в одном геноме. Для остальных коронавирусов такой информации пока нет.

Как видно из приведенных на Рис.4 матриц сравнения и филогенетических деревьев, возбудитель SARS (ТОРС) наиболее близок к бычьему коронавирусу. Известно, что так называемые бычьи вирусы, как правило, оказываются также и вирусами мелких грызунов и даже кошек, живущих вместе или рядов с коровами. Поэтому гипотеза о кошачьей природе возбудителя ТОРС (SARS) имеет законные права на существование.


число совпадающих линий

1.

bov-ent 52 Bovine coronavirus (isolate BCoV-ENT)

2.

mhv-2 46 Murine hepatitis virus (strain 2)

3.

mhv-ml1 46 Murine hepatitis virus (strain ML-11)

4.

mhv-ml0 46 Murine hepatitis virus (strain ML-10)

5.

mhv-a59 45 Murine coronavirus MHV (strain A59)

6.

mhv-pen 44 Murine hepatitis virus (strain Penn 97-1)

7.

por-pur 44 Porcine transmissible gastroenteritis (strain Purdue)

8.

por-cv 41 Porcine epidemic diarrhea virus (strain CV777)

9.

hum-229 40 Human coronavirus (strain 229E)

10.

avi-bea 33 Avian infectious bronchitis virus (strain Beaudette)

Рис. 4. Матрица сравнения полного генома вируса SARS c геномами других коронавирусов другими коронавирусами


Степень подобия (%):

POL

gene %

1.

sars 100.00

2.

bov-ent 60.87 Bovine coronavirus /isolate=BCoV-ENT

3.

mhv-a59 60.58 Murine coronavirus MHV (strain A59)

4.

mhv-2 60.47 Murine hepatitis virus (strain 2)

5.

mhv-ml1 60.47 Murine hepatitis virus (strain ML-11)

6.

mhv-ml0 60.40 Murine hepatitis virus (strain ML-10)

7.

mhv-pen 60.25 Murine hepatitis virus (strain Penn 97-1)

8.

mhv-jhm 59.85 Murine coronavirus MHV (strain JHM)

9.

por-cv 55.12 Porcine epidemic diarrhea virus /strain=CV777

10.

por-pur 54.51 Porcine transmissible gastroenteritis (Purdue)

11.

hum-229 54.47 Human coronavirus (strain 229E)

12.

avi-bea 53.75 Avian infectious bronchitis virus /Beaudette
Усредненная степень подобия : 67.95 %

Рис. 5. Матрица сравнения POL гена вируса SARS c геномами других коронавирусов


Степень подобия (%):

M

gene %

1.

bov-ent 39.57 Bovine coronavirus /isolate=BCoV-ENT

2.

VME1_CVBM 39.13 Bovine coronavirus (strain Mebus)

3.

VME1_CVTKE 38.70 Turkey enteric coronavirus (TCV)

4.

VME1_CVHOC 38.70 Human coronavirus (strain OC43)

5.

VME1_CVMA5 37.12 Murine coronavirus MHV (strain A59)

6.

mhv-2 37.12 Murine hepatitis virus (strain 2)

7.

VME1_CVMJH 36.68 Murine coronavirus MHV (strain JHM)

8.

por-cv 30.84 Porcine epidemic diarrhea virus /strain=CV777

9.

VME1_CVh32 27.31 Human coronavirus (strain 229E)

10.

VME1_IBVK 26.87 Avian infectious bronchitis virus (strain KB8523)

11.

VME1_IBV6 26.43 Avian infectious bronchitis virus (strain 6/82)

12.

VME1_IBVB 25.99 Avian infectious bronchitis virus (strain Beaudette)

13.

VME1_IBVB2 25.99 Avian infectious bronchitis virus (Beaudette M42)

14.

VME1_CVPRM 24.81 Porcine respiratory coronavirus (strain RM4)

15.

VGL1_CVPR8 24.43 Porcine respiratory coronavirus (strain 86/137004)

16.

VME1_CVPFS 24.43 Porcine transmissible gastroenteritis (FS772/70)

17.

VME1_CVPPU 24.43 Porcine transmissible gastroenteritis (strain Purdue)

18.

VME1_FIPV 24.05 Feline infectious peritonitis virus (strain 79-1146)

19.

VME1_CVCAI 23.28 Canine enteric coronavirus (strain Insavc-1)
Усредненная степень подобия : 42.76 %

Рис. 6. Матрица сравнения M гена вируса SARS c геномами других коронавирусов


Степень подобия (%):

VGL

gene %

1.

VGL2_CVMJH 23.82 Murine coronavirus MHV (strain JHM)

2.

VGL2_CVHOC 23.19 Human coronavirus (strain OC43)

3.

VGL2_CVBLY 23.13 Bovine coronavirus (strain LY-138)

4.

VGL2_CVBV 23.06 Bovine coronavirus (strain vaccine)

5.

VGL2_CVBL9 22.99 Bovine coronavirus (strain L9)

6.

VGL2_CVBM 22.92 Bovine coronavirus (strain Mebus)

7.

VGL2_CVBQ 22.84 Bovine coronavirus (strain Quebec)

8.

VGL2_CVM4 22.81 Murine coronavirus MHV (strain wild type 4)

9.

VGL2_CVMJC 22.81 Murine coronavirus MHV (strain JHMV/variant CL-2)

10.

VGL2_CVMA5 22.75 Murine coronavirus MHV (strain A59)

11.

VGL2_IBVK 17.40 Avian infectious bronchitis virus (strain KB8523)

12.

VGL2_IBVM 16.93 Avian infectious bronchitis virus (strain M41)

13.

VGL2_IBVB 16.77 Avian infectious bronchitis virus (strain Beaudette)

14.

VGL2_CVh32 16.26 Human coronavirus (strain 229E)

15.

VGL2_CVPRM 15.78 Porcine respiratory coronavirus (strain RM4)

16.

VGL2_CVPR8 15.70 Porcine respiratory coronavirus (strain 86/137004)

17.

VGL2_CVCAI 14.93 Canine enteric coronavirus (strain Insavc-1)

18.

VGL2_CVPMI 14.63 Porcine transmissible gastroenteritis (strain Miller)

19.

VGL2_FIPV 14.60 Feline infectious peritonitis virus (strain 79-1146)

20.

VGL2_CVPFS 14.56 Porcine transmissible gastroenteritis (strain FS772/70)

21.

VGL2_CVPPU 14.42 Porcine transmissible gastroenteritis (strain Purdue)

22.

VGL2_CVPPR 14.35 Porcine transmissible gastroenteritis (Pur46-MAD)

23.

VGL2_CVPRT 14.29 Porcine transmissible gastroenteritis (strain NEB72-rt)

Рис. 7. Матрица сравнения VGL гена вируса SARS c геномами других коронавирусов.

При доказательстве этиологической роли коронавируса SARS, как возбудителя атипичной пневмонии все исследования в 13 лабораториях проводились с учетом постулатов Коха: возбудитель должен обнаруживаться у всех больных с данным заболеванием; он должен быть выделен из хозяина и культивирован в чистой культуре; и культура выделенная таким образом должна воспроизводить болезнь у других организмов, с подъемом уровня специфических антител после заражения.

Как удалось в настоящее время выяснить, коронавирусы были обнаружены у более чем 50 % больных, значительная часть изолятов была культивирована в чистой культуре, у больных с выявленным агентом ТОРС был обнаружен подъем антител, и заражение обезьян этим возбудителем дало клиническую картину, характерную для ТОРС [5].

Клиника и лечение атипичной пневмонии.

С момента возникновения атипичной пневмонии уже собрано много материала, который позволяет представить клиническую картину этого заболевания. В совместной публикации ВОЗ, СDC и Health Canada были суммированы данные историй болезни пациентов с диагнозом ТОРС (SARS) начиная с середины февраля 2003 [15].

26 марта ВОЗ были опубликованы результаты проведения виртуального круглого стола, в котором участвовали 80 клиницистов из 13 стран занимающихся исследованием атипичной пневмонии [16].

По мнению специалистов, клиническая картина ТОРС(SARS) выглядит следующим образом.

Большинство зарегистрированных больных атипичной пневмонией — люди в возрасте 25-70 лет. Несколько случаев заболевания отмечено у детей до 15 лет.

Инкубационный период обычно 2-7 дней; однако в отдельных случаях может достигать 10 дней.

Клинические признаки в начале заболевания неспецифические. Начало болезни в подавляющем большинстве случаев характеризуется высокой температурой > 38° С, сопровождающейся ознобом, миалгией, головными болями и сухим кашлем. Сыпь, неврологические или желудочно-кишечные признаки обычно отсутствуют, однако в некоторых случаях отмечалась диарея в начальном периоде во время лихорадочного состояния.

Через 3-7 дней наступает стадия, связанная с поражением нижних дыхательных путей и появлением характерного сухого кашля, одышки, которая может сопровождаться прогрессирующей гипоксимией. На этой стадии больные разделяются на две группы. У большинства, 80-90 % заболевших, в течение последующих 6-7 дней наблюдается улучшение состояния и симптоматики. Во второй, меньшей группе проявляется более тяжелая форма атипичной пневмонии у многих пациентов развивается острый респираторный дистресс синдром и требуется искусственная вентиляция лёгких. Смертность во второй группе высока, и может быть связана с наличием у больных, кроме ТОРС, других заболеваний. Характерные изменения на рентгеновских снимках лёгких могут отмечаться уже через 3-4 дня после появления первых симптомов заболевания, но в некоторых случаях рентгеновские снимки могут оставаться нормальными в течение первой недели и даже всего заболевания.

При прогрессировании болезни рентгенологические исследования показывают у большинства больных двусторонние изменения в виде внутритканевых инфильтратов (жидкость накапливается между клетками в лёгких), которые развиваются в более генерализованные образования. Эти инфильтраты дают на рентгеновских снимках специфическую картину лёгких, испещренных пятнами.

Лабораторные тесты часто показывают лимфопению, среднюю тромбоцитопению и повышенный уровень печеночных ферментов.

В качестве индикатора прогноза развития заболевания выделяют возраст — у больных старше 40 лет большая вероятность развития тяжелой формы заболевания [17].

При отсутствии диагностических тест систем на ТОРС (SARS), и сложности дифференцированной диагностики атипичной пневмонии в начале заболевания, в CDC были разработаны критерии для выявления подозрительных и предполагаемых случаев.

К подозрительным случаям следует относить респираторные заболевания неизвестной этиологии и соответствующие следующим критериям:

· Повышение температуры выше 38° С

· Наличие одного или более клинических признаков респираторного заболевания (кашель, учащенное или затрудненное дыхание, гипоксия)

· Путешествие в течение 10 дней в пораженные SARS районы мира или общение с больными подозрительными по данной болезни.

При выявлении предполагаемых случаев следует учитывать такие критерии как:

· Подтверждение пневмонии на рентгеновских снимках или респираторный дистресс синдром

· Данные аутопсии, соответствующие респираторному дистресс синдрому без идентифицируемых причин [18].

В настоящее время пока нет эффективных методов борьбы с атипичной пневмонией. Этиологическая терапия не существует, как и для подавляющего большинства вирусных заболеваний. В материалах ВОЗ и СDC рекомендуется включение с первых дней заболевания в схемы лечения нескольких антибиотиков для предотвращения угрозы развития бактериальной инфекции. В практике предпочтение отдавалось антибиотикам широкого спектра действия — -лактамам, фторхинолонам, цефалоспоринам, тетрациклинам.

Кстати, очень неплохие результаты были получены нашими учеными при использовании тетрациклина для лечения вирусного клещевого энцефалита, что отчасти связано с его иммуномодулирующими свойствами. Это позволяет предположить, что препарат может рассматриваться и испытываться, как потенциальное средство в терапии ТОРС (SARS) [19].

В качестве основного противовирусного препарата для лечения ТОРС (SARS) наиболее широко врачами в очагах заболевания используется рибавирин, один или в сочетании со стероидными препаратами. Показано, что он обладает противовирусной активностью, в том числе и по отношению к коронавирусам. Однако, некоторые исследователи высказывают критическое отношение к применению этого препарата, отмечая случаи ухудшения состояния больных при его приёме, хотя давно известны негативные побочные эффекты этого препарата [17]. В отсутствие контролируемых испытаний препаратов, у CDC в настоящее время нет четких рекомендаций как о возможности использования рибавирина и путях его введения (внутрь, внутривенно и/или в виде аэрозоля), так и о необходимости терапии гликокортикоидами [20].

Видимо, применение интерферона и других препаратов этой группы в первые три дня должно снижать тяжесть заболевания, хотя это также требует доказательства.

Таким образом, на настоящий момент терапия ТАРС (SARS) является главным образом патогенетической и симптоматической.

В начале апреля в газетах появились сообщения об использовании гонконгскими врачами в качестве лекарственного препарата против вируса SARS плазмы крови пациентов, благополучно перенесших инфекцию. Врачи из Госпиталя Принца Уэльского (Гонконг) с помощью переливания плазмы крови переболевших людей больным смогли спасти жизни как минимум 20 больных, находившихся до переливания плазмы в критическом состоянии [21]. К сожалению пока не найдено других источников, более подробно описывающих этот опыт.

Диагностика SARS.

Сложная ситуация, обусловленная недавним появлением и быстрым распространением по всему миру ТОРС (SARS), побудила исследователей различных стран направить свои усилия на разработку быстрых и точных лабораторных методов диагностики этого возбудителя. Однако разработка диагностических тестов для этого заболевания продемонстрировала большую проблематичность, чем ожидалось.

В настоящее время ряд диагностикумов разработан, и они уже использовались в разных странах для идентификации возбудителя этого заболевания. Однако, по мнению ВОЗ, до тех пор, пока эти тесты не пройдут соответствующие полевые испытания, и их надежность не будет доказана, диагностика ТОРС (SARS) будет продолжать зависеть от клинических данных, подтверждающих, что атипическая пневмония не вызвана какой-либо другой причиной и контактом с пациентом, предположительно или вероятно больного SARS, или с выделениями из его респираторного тракта и других физиологических жидкостей. Это требование отражено в современном определении предполагаемого и вероятного случая ТОРС (SARS), данном ВОЗ [22] Тем не менее, в некоторых странах (Канада, Франция, Германия, Гонконг, Япония, Нидерланды, Сингапур, Великобритания и США) с помощью этих тестов в экспериментальных условиях исследуются образцы предполагаемых или вероятных больных SARS.

По мнению ВОЗ, при интерпретации результатов тестов следует учитывать ряд моментов. Позитивные результаты теста показывают, что ТОРС (SARS) пациенты являются, или недавно были инфицированы SARS вирусом. В данном случае необходимо установить специфичность различных тестов.

Негативные результаты теста на SARS вирус не должны быть утверждением, что пациент не имеет SARS вируса. Причинами для негативных результатов у пациентов с ТОРС (SARS) может быть следующее:

— Пациент не инфицирован SARS вирусом; заболевание вызывается другим инфекционным агентом (вирусом, бактерией, грибами) или неинфекционной причиной.

— Некорректные результаты теста (false-negative). Используемый тест необходимо дальше доработать для улучшения его чувствительности.

— Образцы не были собраны в то время, когда вирус или его генетический материал присутствовал (при использовании метода RT-PCR или культур клеток). Вирус и его генетический материал может присутствовать в человеке очень короткий промежуток времени, в зависимости от типа тестируемого образца.

— Образцы были собраны до развития заболевания и до того момента, как стали нарабатываться антитела (относится к ELISA и иммунофлюоресцентному анализам).

Для улучшения понимания процесса ТОРС (SARS) заболевания ВОЗ рекомендует клиницистам проводить последовательный сбор образцов от пациентов с ТОРС (SARS) и сохранять их для тестирования до того момента, когда станут доступными диагностические тесты. Это особенно важно для первичного случая, который выявляется в стране ранее не докладывавшей о ТОРС (SARS) заболевании. Рекомендации по сбору и транспортировке образцов можно найти на web-сайте CDC (США) [23].

Согласно рекомендациям ВОЗ, имеется ряд лабораторных тестов, с помощью которых можно выявить, какой вирус является причиной заболевания у человека, и в настоящее время они апробируются при диагностике ТОРС (SARS). Однако все эти тесты имеют определенные ограничения для использования в случае контролировании ситуации с ТОРС (SARS).

1. Тестирование антител.

Тестирование антител проводится методами ELISA или IFA. Метод ELISA достоверно выявляет антитела в сыворотке ТОРС (SARS) пациентов, начиная с 21-го дня после появления клинических симптомов заболевания. Следовательно, этот тест не может быть использован для выявления вирусов на ранней стадии инфекции, до того, как вирус может распространить инфекцию от одного человека к другому. Иммунофлюоресцентный метод выявляет антитела в сыворотке пациентов через десять дней после появления клинических симптомов и заболевания. Однако этот метод требует наработки в клеточной культуре SARS вируса, проведение работ в противочумной лаборатории или лаборатории BSL-3 уровня иммунофлюоресцентный микроскоп и опытного микроскописта, на что уйдет 2-4 дня.

2. Молекулярные тесты (PCR).

ОТ-ПЦР-тест позволяет выявлять генетический материал SARS-вируса из различных образцов пациента (крови, стуле, респираторных секретов или тканевых жидкостей) и на очень ранних стадиях инфекции. Более того, праймеры, которые являются ключевыми для PCR-теста, сейчас сделаны доступными сетью лабораторий ВОЗ на web сайте ВОЗ и уже используются лабораториями многих стран по всему миру. Существующие ПЦР-тесты являются весьма специфичными, но они пока что недостаточно чувствительны и дают много ложноотрицательных результатов, по которым нельзя исключить наличие SARS-вируса у пациента. Сеть лабораторий ВОЗ работает над своими протоколами и праймерами, чтобы улучшить их достоверность и надежность [23].

Разработаны и предложены 7 праймеров — нуклеотидных фрагментов, с помощью которых можно выявить геном коронавируса, предположительно ответственного за ТОРС (SARS), которые уже используются различными лабораториями ВОЗ для амплификации полимеразного гена коронавирусов. Они в настоящее время исследуются на сравнительную воспроизводимость и чувствительность в различных образцах с различным временем взятия пробы по ходу заболевания. Предполагается публикация результатов и рекомендаций по их использованию по мере их доступности. Позитивные контроли могут быть бесплатно получены на интернет-сайте Bernard Nocht Institute of Tropical Medicine в Гамбурге (Германия).

Результаты PCR, использующие эти праймеры, могут быть использованы в качестве дополнительной клинической оценки. Однако тесты не утверждены лицензионнно на подтверждение или исключение случаев заболевания.

В настоящее время для диагностики ТОРС (SARS) на сайте ВОЗ различными исследовательскими центрами представлены следующие данные по праймерам, которые могут быть использованы в PCR-диагностикумах.

1. Bernhard-Nocht Institute (Bernhard-Nocht Str. 74 D-20359 Hamburg, Germany).

BNIoutS/BNoutAs: sense ATGAAT TAC CAA GTC AAT GGT TAC
antisense CAT AAC CAG TCG GTA CAG CTA C
FraGment lenGth 195 bp

BNIinS/BNIAs: sense GAA GCT ATT CGT CAC GTT CG
antisense CTGTAGAAA ATC CTA GCT GGA G
Fragment length 110 bp

SAR1s/SAR1as: sense CCT CTC TTG TTC TTG CTC GCA
antisense TAT AGT GAG CCG CCA CAC ATG
Fragment length 150 bp

Amplicon sequence (BNI-1, Bernhard-Nocht Institute, Hamburg, Germany)
TACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCA
AGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTAT
TCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCAT
GCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGA
TTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATGTTGA
CACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCC
ACCAGGTGACCAGTTTAAACATCTTATACC

2. Centers for Disease Control & Prevention (National Centers for Infectious Diseases,
Atlanta GA 30333 1600 Clifton Road, NE, MS-C12 United States)

SARS-specific primers:
Cor-p-F2 (+) 5’CTAACATGCTTAGGATAATGG 3′,
Cor-p-F3 (+) 5’GCCTCTCTTGTTCTTGCTCGC 3′,
Cor-p-R1 (-) 5’CAGGTAAGCGTAAAACTCATC 3′,
Product size:
Cor-p-F2/Cor-p-R1 :368 bp
Cor-p-F3/Cor-p-R1 :348 bp

3. Government Virus Unit 9/F Public Health Laboratory Centre (382 NAm Cheong Street Shek Kip Mei Kowloon, Hong Kong SAR Hong Kong — SAR China)

COR-1,COR-2: sense 5′ CAC CGT TTC TAC AGG TTA GCT AAC GA 3′
antisense 5′ AAA TGT TTA CGC AGG TAA GCG TAA AA 3′
Product size: 310 bp

4. Queen Mary Hospital (The University of Hong Kong University Pathology Building Hong Kong — SAR China)

HKU: sense 5′ TACACACCTCAGCGTTG 3′
antisense 5′ CACGAACGTGACGAAT 3′
Product size 182 bps [23]

Лабораториям, занимающимся ТОРС (SARS) специфическими PCR-тестами, ВОЗ рекомендует принимать на вооружение качественные контрольные процедуры и объединить свои усилия, как внутри своей страны, так и с исследовательскими лабораториями ВОЗ, с целью перепроверки положительных результатов и использования положительного опыта.

3. Культура клеток.

Вирус в образцах ТОРС (SARS) пациентов (респираторные секреты, кровь и стул) может быть также выявлен при помощи инфицирования культур клеток и последующей наработки вируса. Выделенный вирус может быть идентифицирован как SARS вирус дополнительными тестами. Культура клеток является очень требовательным методом, однако в то же время и единственным способом показать наличие живого вируса [24,25].

По сообщениям газеты Reuters [26] немецкая биотехнологическая компания Artus GmbH начала распространение разработанного ее сотрудниками экспресс-теста для диагностики ТОРС (SARS). Согласно заявлению представителей компании, на разработку этого теста ушло всего две недели. Разработанная Artus GmbH совместно с Bernhard-Nocht Institute for Tropical Medicine тест-система представляет собой комплект реагентов для проведения полимеразной цепной реакции для выявления РНК коронавируса, предположительно вызывающего ТОРС (SARS). В качестве объекта для диагностики может использоваться любой биологический материал – кровь, мокрота, кал, моча, мазки со слизистой носоглотки. Собственно процедура анализа занимает не более четырех часов, причем положительные результаты могут быть получены не через две недели после инфицирования, как в случае обычных иммунологических тестов, а практически сразу же после попадания вируса в ткани.

В настоящее время компания Artus GmbH бесплатно поставляет тест-комплекты в страны Азии, наиболее пострадавшие от вспышки SARS, а также в Австралию, США, Скандинавские страны и Германию, где были зарегистрированы отдельные случаи заболевания [26]

В течение последней недели ученые из Канады, Гонконга, Сингапура и Атланты в США сообщили о полном секвенировании генома ТОРС (SARS) вируса [11]. Исследователи надеются, что эти знания могут стать основой для разработки более чувствительных диагностикумов и даже терапевтических средств. В геноме SARS-вируса содержится более чем 29000 нуклеотидов. Имеющиеся ОТ-ПЦР-диагностикумы пока что детектируют только 200-500 из этих нуклеотидов. Остается определить, какая область генома может быть оптимальной мишенью для диагностического реагента. Это является сейчас основной задачей для исследователей.

Для того чтобы тест стал хорошим, прежде всего, необходимо усиление его биохимической специфичности. Это способ, когда используемые реагенты должны реагировать только с мишенями вируса. В случае ДНК-диагностического теста для SARS вирусных генов, нет сомнений, что специфичность имеется. Во-вторых, необходимо, чтобы тест был высокочувствительным. Используя современные ДНК-диагностические подходы, мы можем выявлять вплоть до 500-1000 частиц в миллилитре. Биохимическая специфичность и чувствительность является реально высокой и в настоящий момент может быть обеспечена. Однако трудности заключаются в особенностях вируса. Количество выделяемого вируса, фактически, может варьировать до 10000 раз у одного пациента и до миллиона раз между пациентами. Пока неясно, где и как вирус депонируется, но известно, что имеется небольшой промежуток времени, когда вирус может быть выявлен в различных жидкостях тела, прежде всего, в слюне, затем в крови и, в заключение, в стуле [27].

Согласно официальному отчету института Beijing Genomics Китайской академии наук SARS вирус очень быстро мутирует, поэтому необходимо тщательно изучить много штаммов, чтобы создать точные диагностические тесты и эффективные способы лечения [28]. Однако, по мнению американских исследователей в настоящее время не имеется очевидных данных, которые бы показывали, что SARS вирус быстро мутирует. По их мнению, коронавирусы обладают потенциалом изменяться больше, чем другие РНК-вирусы, главным образом, потому, что их геном значительно больше и высокая частота рекомбинации является их особенностью. Они считают, что рекомбинация, вероятно, ограничивается лишь обменом фрагментами генома с близкородственными вирусами. В случае с SARS-вирусом необходимо провести тщательный филогенетический анализ для определения того, приобрел ли этот вирус какую-нибудь генетическую информацию путем рекомбинации с хорошо известными коронавирусами животных [29].

Таким образом, имеющаяся на сегодняшний день информация по последним диагностическим разработкам и по динамике развития эпидемии вселяет определенную надежду на то, что борьба c вирусной SARS-инфекцией будет успешной. Ключевыми моментами здесь, конечно, стали достаточно быстрая идентификация возбудителя вновь возникшего заболевания, секвенирование его генома и принятие жестких противоэпидемических мер в странах-очагах. Главными задачами теперь являются использование полученных знаний для лучшего понимания самой инфекции, вызывающей ТОРС (SARS), для совершенствования диагностических тестов и для скорейшей разработки методов специфического лечения и профилактики этого заболевания.

Авторы выражают благодарность сотрудникам ГНЦ ВБ Вектор А.В.Миронову, В.А.Терновому, Н.А.Маркович за полезные замечания, техническую помощь и участие в сборе информации для данного обзора.

Список использованной литературы

1. Cumulative Number of Reported Probable Cases of Severe Acute Respiratory Syndrome (SARS). 2003. Сайт ВОЗ. http://www.who.int/csr/sarscountry/2003_04_26/en/

2. Epidemic curves — Severe Acute Respiratory Syndrome (SARS). 2003.
Сайт ВОЗ. http://www.who.int/csr/sarsepicurve/epiindex/en/index1.html

3. Coronavirus never before seen in humans is the cause SARS. 2003
Сайт ВОЗ. http://www.who.int/mediacentre/releases/2003/pr31/en/print.html

4. PRO/EDR> SARS — worldwide (64): etiology 20030423.0996. Cайт ProMED-mail’s International Society for Infectious Diseases.http://www.promedmail.org/pls/askus/f?p=2400:1202:98395027374564076::N:F…

5. PRO/EDR> SARS — worldwide (67): cases 20030424.1007. Cайт ProMED-mail’s International Society for Infectious Diseases.http://www.promedmail.org/pls/askus/f?p=2400:1202:98395027374564076::N:F…

6. Lai M.M.C., Holmes K.V. Coronaviridae: The viruses and their replication. Fields’ virology. vol.1. [ed. D. M. Knipe, P.M. Howley, D.E. Griffin.- 4th ed,] 2001. Lip.Wil.&Wilkins. USA. p.1163.

7. Enterz. NC_002645; NC_001846; NC_003045; NC_001451.

8. Bellini W.J., Campagnoli R.P., Icenogle J.P., et al. SARS coronavirus (SARS-CoV), Urbani strain. Unpublished. 2003. http://www.cdc.gov/ncidod/sars/pdf/nucleoseq.pdf

9. SARS coronavirus, complete genome. Entrez . NC_004718

10. Qin,E., Zhu,Q., Yu,M., et al., 2003. GenBank. AY278487; AY278488 ; AY278489 ; AY278490; AY279354 . http://www.genomics.org.cn:8080/bgi/news/zhongxin/news030416-2_popmsg.htm

11. Two SARS-associated viral genomes were sequenced in Beijing. 2003. http://www.genomics.org.cn:8080/bgi/news/zhongxin/news030416-2.htm;

12. Drosten C., Gunther S., Preiser W., et al.. Identification of a Novel Coronavirus in Patients with Severe Acute Respiratory Syndrome. //N. Engl. J. Med. 2003. www.nejm.org http://content.nejm.org/cgi/reprint/NEJMoa030747v2.pdf

13. Ksiazek TG, Erdman D, Goldsmith CS et al. A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. // N. Engl. J. Med. 2003. www.nejm.org http://content.nejm.org/cgi/reprint/NEJMoa030781v3.pdf

14. Peiris J S M, Lai S T, Poon L L M, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. // THE LANCET • Published online. 2003. http://image.thelancet.com/extras/03art3477web.pdf

15. Preliminary Clinical Description of Severe Acute Respiratory Syndrome.// MMWR Weekly. 2003. V.52. N12. P. 255-256. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5212a5.htm

16. Clinical hold virtual conference on management of SARS patients. Сайт ВОЗ. 2003. www.who.int/csr/clinicansconference/en.print.html

17. Hsu L-Y, Lee C-C, Green JA, et al. Severe acute respiratory syndrome (SARS) in Singapore: clinical features of index patient and initial contacts. // Emerg. Infect. Dis. [serial online] 2003. http://www.cdc.gov/ncidod/EID/vol9no6/03-0264.htm)

18. Updated Interim U.S. Case Definition of Severe Acute Respiratory Syndrome (SARS). 2003. http://www.cdc.gov/ncidod/sars/casedefinition.htm

19. Atrasheuskaya A.V., Fredeking T.M., Ignatyev G.M. Changes in immune parameters and their correction in human cases of tick-borne encephalitis. // Clin. Exp. Immunol. 2003. V.131.
P. 148-154.

20. Outbreak of Severe Acute Respiratory Syndrome —Worldwide, 2003. MMWR Weekly// 2003. V.52. N11. P. 226-228. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5211a5.htm

21. HK Doctors Use Antibodies to Treat Pneumonia Victims. 2003. http://www.reuters.com/newsArticle.jhtml?type=scienceNews&storyID=2477221

22. Case Definitions for Surveillance of Severe Acute Respiratory Syndrome (SARS). Сайт ВОЗ. 2003. http://www.who.int/csr/sars/casedefinition/en/

23. PCR primers for SARS developed by WHO Network Laboratories. 2003. Сайт ВОЗ. http://www.who.int/csr/sars/primers/en/

24. Heymann D. L. Status of the global SARS outbreak and lessons for the immediate future. 2003. Сайт ВОЗ. http://www.who.int/csr/sarsarchive/2003_04_11/en/tests

25. SARS: Availability and use of laboratory testing. 2003. Сайт ВОЗ. http://www.who.int/csr/sars/testing2003_04_18/en/

26. Blenkinsop P. German Firm Distributes First Sars Test Worldwide. 2003. http://www.nlm.nih.gov/medlineplus/news/fullstory_12350.html

27. Testing for the SARS virus: hopes and realities //Strait Times Interactive. 2003.
http://straitstimes.asis1.com.sg

28. Progress in genome sequencing of Chinese isolates of SARS virus. 2003.
http:// www.gpbjournal.org/sars.jsp

29. Shared mutations in the genomes of SARS coronaviruses. 2003.
http://www.biomedcentral.com/news/20030416/04

Тяжелый острый респираторный синдром | Info-Farm.RU

Тяжелый острый респираторный синдром (ТОРС) (англ. Severe Acute Respiratory Syndrome (SARS)) — вирусное инфекционное заболевание, способное к опасному эпидемического распространения, в том числе и внутригоспитальных, с преобладанием воздушно-капельной передачи инфекции с поражением дыхательной системы и, в тяжелых случаях, с появлением атипичной пневмонии с выразительной острой дыхательной недостаточностью.

Легкость заражения, скорость распространения, тяжелое течение, высокая летальность — особенности, которые позволяют отнести ТОРС до тех инфекционных заболеваний, которые обнаружили способность оказывать серьезное влияние на здоровье населения и могут быстро распространяться в международных масштабах и вошли в перечень событий, которые могут представлять чрезвычайную ситуацию в области здравоохранения и попали под регуляцию современными Международными медико-санитарными правилами (ММСП) 2005 года.

История

Эпидемия ТОРС берет свое начало из сельской местности Фошань, расположенной в китайской провинции Гуандун. В ноябре 2002 года первый пациент, фермер, был госпитализирован в первую Народную больницу Фошань, где вскоре и умер. Причина его смерти не была определена точно, однако стало ясно, что больной умер от очень серьезного заболевания, представляющего угрозу для жизни. Несмотря на принятие некоторых мер по борьбе с этим заболеванием, китайские чиновники решили не информировать Всемирную организацию здравоохранения (ВОЗ) о начале распространения данного заболевания до февраля 2003 года, ограничивая освещение средствами массовой информации для выявления данного заболевания в целях сохранения доверия. Отсутствие открытости приводила к задержкам в борьбе с эпидемией, из-за чего правительство Китайской Народной Республики был подвергнут резкой критике со стороны международного сообщества. КНР с тех пор неоднократно официально извинилась за медлительность и непринятие мер по борьбе с эпидемией ТОРС.

Первый этап признания начала эпидемии — 27 ноября 2002 года, когда канадская глобальная разведывательная сеть по здравоохранению (GPHIN), которая является частью ВОЗ, запустила электронную систему предупреждения населения Земли о начале серьезной эпидемии в Китае. Впоследствии Всемирная организация здравоохранения запросила информацию у китайских властей, после того, как все результаты расследования о начале вспышки поступили в ее сеть. Информация у китайских властей была приглашена 5 и 11 декабря 2002.

Эпидемия привлекла глобальную общественное внимание в феврале 2003 года, когда американский бизнесмен после путешествия Китаем заболел пневмонией, симптомы которой он почувствовал во время рейса в Сингапур. Самолет остановили в Ханое, столице Вьетнама, где потерпевший скончался от атипичной пневмонии в больнице вскоре после госпитализации, вызвав вспышку среди медицинских работников. Наблюдатель ВОЗ, итальянский врач Карло Урбани оценил риски такой угрозы и сообщил ВОЗ и вьетнамское правительство о данном заболевании, которое он считал птичьим гриппом с образованием крайне опасной аэрогенной передачи среди людей. Заразившись, Карло Урбани, умер от ТОРС. Тяжесть симптомов и возможность инфицирования врачебного персонала вызвали серьезное беспокойство и тревогу в мировом сообществе. Власти Вьетнама начала опасаться возможности развития эпидемии пневмонии и в этой стране. 12 марта 2003 ВОЗ выпустила глобальное оповещение о необходимости остановить распространение данного заболевания с предупреждением о необходимости воздержаться от поездок в Южный Китай. Болезнь была зафиксирована с того момента во Вьетнаме, Гонконге, Канаде, США и еще 32 странах мира.

Гонконгский вирусолог М. Пейрис 21 марта 2003 заявил, что выделил коронавирус, который является причиной ТОРС, от больных этой болезнью. 16 апреля 2003 было объявлено о подтверждении роли ТОРС-ассоциированного коронавируса (ТОРС-АКВ), как возбудителя ТОРС. Доказательствами этого были положительные постулаты Коха:

  • возбудитель был выделен от всех больных ТОРС;
  • штамм вируса выделено от хозяина или культивированного в чистой культуре;
  • культура вируса, которая была получена, способна была воспроизвести заболевания в других макроорганизмов с последующим ростом уровня специфических антител.

Однако некоторые ученые считают, что в развитии ТОРС могли участвовать и другие неидентифицированные патогены в коинфекции с выявленным ТОРС-АКВ.

Всего в 35 странах мира было выявлено 8 461 случай ТОРС, из которых 916 закончились смертью больных, летальность составила 10,83%). Благодаря проведению комплекса противоэпидемических мероприятий мировому сообществу удалось добиться ликвидации эпидемии ТОРС уже до 19 мая 2004 года (в начале мая 2004 года был зарегистрирован последние к настоящему 3 случая, связанные с внутрилабораторный заражением). Однако есть основательные предположения, что болезнь затаилась в природе, где до конца не выявлены его возможные источники и резервуары инфекции.

В России был обнаружен только один случай заболевания ТОРС, больной Денис Сойников был госпитализирован в больницу Благовещенска 8 мая и выписан 11 июня 2003. В Украине не было зарегистрировано ни одного случая ТОРС.

Этиология

Коронавирусы — это вирусы, содержащие РНК и поверхность которых покрыта булавчастимы отростками, придают им при электронно-микроскопическом исследовании форму короны.

К эпидемии ТОРС вирусов семейства Coronaviridae считали одними из самых частых возбудителей нетяжелых поражений верхних дыхательных путей, а тяжелые заболевания регистрировали при иммунодефицитных состояниях. Напротив, у животных эти возбудители вызывают тяжелые заболевания — перитонит, гепатит, гастроэнтерит и др. Коронавирусы объединены в 3 группы: первая и вторая группы представлены вирусами, которые вызывают заболевания у животных, третья группа — у птиц. Коронавирусы, обусловливающие заболевания у людей, включенные в первую и вторую группы. Известно 4 штаммы ТОРС-АКВ.

Возбудитель ТОРС является мутантом со 2-й группы коронавирусов. По данным секвенирования генома, вирус ТОРС является вирусом новой группы, происходит от коронавирусов крупного рогатого скота и вируса инфекционного бронхита птиц. Вирус найден во многих органах и секретах людей, погибших от ТОРС: легких, почках, мокроте, мазках из верхних дыхательных путей.

Эпидемиология

Источник и резервуар инфекции

Источник инфекции — больной ТОРС. Роль животные как источника инфекции для человека не доказана, однако хищных млекопитающих циветы из семьи виверових и некоторые летучих мышей считают резервуарами инфекции. Не доказана пока мнение, что именно летучие мыши являются естественными источниками ТОРС. На сегодняшнее время не уточняется вопрос о возможном носительство вируса у людей, которые выздоровели от этого заболевания.

Механизм и пути передачи

Механизм передачи — воздушно-капельный (пути — аэрозольный и пылевой). Заражение вероятнее в условиях тесного бытового семейного и госпитального пребывания. Отмечено много случаев заражения медицинских работников, а также лиц, как посещали больных. В этих случаях передачи происходило из-за попадания выделений больных в ротовую полость, на конъюнктивы. Определенную роль в передаче вируса внутри помещений играют вентиляционные системы. Предполагается, что в эпидемиологическом плане больной становится безопасным через 10 суток с момента клинического выздоровления. Распространению ТОРС среди стран и континентов способствует передвижения больных авиационными путями. Вопрос о восприимчивости к ТОРС определенных групп людей, иммунитет после перенесенной болезни не решены.

Патогенез

Изучен недостаточно. Вероятно, развивается недостаточность сурфактанта, вызывает острый респираторный дистресс-синдром взрослых (ГРДСД). Уже через 5-7 дней от начала заболевания возникает пневмония, сначала очаговая, которая быстро превращается в сливную долевом. Поражается система мононуклеарных фагоцитов (СМФ), развивается лимфопения, подавляется синтез интерферона. Новый коронавирус имеет выразительный иммуносупрессивным эффект обусловливает частое присоединение грибковой и бактериальной флоры как суперинфекции.

Клинические проявления

В МКБ-10 в разделе XXII «Коды для специальных целей», блоке «Предыдущее расположения болезней неясной этиологии», классе «ТОРС» выделяют «ТОРС не уточнен» (U04.9). Инкубационный период составляет в среднем от 2 до 10 дней. Начало болезни острое, с ознобом и повышением температуры тела до 38 ° С и выше. Наблюдаются головная боль, недомогание, головокружение, миалгии (боли в мышцах), иногда умеренный катаральный синдром, сухой кашель, боль в горле. В клиническом течении болезни различают 3 клинические периоды.

Продромальный период

Длится 3-5 дней. Характеризуется лихорадкой, ознобом, слабостью, миалгией. Респираторные синдромы невыраженные, на 2-7-е сутки появляется непродуктивный кашель. Особенностью течения является отсутствие насморка.

Период роста респираторных расстройств

Развивается на 3-7-е сутки от начала заболевания. Характеризуется появлением одышки, ростом гипоксемии, при аускультации дыхание в легких ослаблено, можно выслушать крепитацию. Нехарактерные свистящие хрипы. У некоторых больных симптомы болезни самостоятельно исчезают через несколько дней, но в конце первой недели заболевания у 10-12% больных развивается ГРДСД взрослых, что требует перевода на искусственную вентиляцию легких. Независимыми факторами риска тяжелого течения заболевания является возраст старше 60 лет и хронический вирусный гепатит B, а особенно такой, при лечение которого использовался ламивудин.

Период новой волны болезни

Начинается после 7-8 суток заболевания и в 85% случаев приводит к новой волне лихорадки. Возможно появление диареи, на рентгенограммах появляются новые очаги поражений легких.

Для ТОРС нехарактерный любой сыпь, а также лимфаденопатия.

Диагностика

Поскольку ТОРС не имеет специфических симптомов, эксперты CDC и ВОЗ в 2003 году обнародовали клинические, лабораторные и эпидемиологические критерии, позволяющие при подозрении на ТОРС сузить диагностический поиск.

Клинические критерии

К клиническим критериям относятся:

  • асимптоматическое или легкое респираторное заболевание;
  • респираторное заболевание средней тяжести: — температура ниже 38 ° C и одна или более клинических признаков респираторного заболевания (кашель, одышка или гипоксия)
  • тяжелое респираторное заболевание: — температура выше 38 ° C и одна или более клинических признаков респираторного заболевания (кашель, одышка или гипоксия) и рентгенологические признаки пневмонии, или ГРДСД, или данные аутопсии (признаки пневмонии или ГРДСД без идентифицированной причины)

Эпидемиологические критерии

К эпидемиологических критериям относятся:

  • путешествие (включая транзитным пребыванием в аэропорту) в течение 10 дней перед началом заболевания в район с недавно задокументированным или подозреваемым популяционной (общественным) распространением ТОРС;
  • близкий контакт (уход, проживание с лицом с известной SARS-инфекцией или высокой вероятностью прямого контакта с респираторными секретами и / или другими биологическими жидкостями) в течение 10 дней до начала признаков заболевания с лицом с известной или подозреваемой ТОРС-инфекцией.

Лабораторные критерии

Среди лабораторных критериев выделяют:

  • подтвержден
    • выявление антител к ТОРС-АКВ из образцов, полученных в течение острого периода заболевания, или через 21 день от начала заболевания;
    • выявление ТОРС-АКВ РНК в двух образцах с помощью полимеразной цепной реакции;
    • выделение ТОРС-АКВ;
  • отрицательный
    • отсутствие антител к ТОРС-АКВ в сыворотке крови, полученной через 21 день и более с момента появления клинической симптоматики;
  • неопределенный
    • лабораторные тесты либо не проводились, либо являются неполными.

Конечная классификация клинических случаев

Вероятный случай

Соответствует клиническим критериям тяжелого ОРЗ неизвестной этиологии с 1 февраля 2003 года и эпидемиологическим критериям, лабораторные критерии подтверждены, негативные или неопределенные;

Подозреваемый случай

Соответствует клиническим критериям средней тяжести ОРЗ неизвестной этиологии с началом заболевания с 1 февраля 2003 и эпидемиологическим критериям; лабораторные критерии подтверждены, негативные или неопределенные;

Подтвержденный случай на уровне государства

Любая больной человек, который отвечает клиническим и лабораторным критериям подтвержденного случая, где тестирование выполнено в национальной референс-лаборатории.

Подтвержденный случай для передачи показаний к ВОЗ

Любая больной человек, который отвечает клиническим и лабораторным критериям подтвержденного случая, где тестирование было выполнено в сертифицированной референс-лаборатории ТОРС ВОЗ.

Изменения в лабораторных тестах и ​​инструментальных исследованиях

Обще и инструментальная диагностика

В общем анализе крови наблюдается нормоцитоз или лейкопения на фоне выраженной лимфопении и тромбоцитопении. Изменения в легких варьируют от интактной рентгенологической картины распространенной двусторонней многофокусного инфильтрации легочной ткани. Примерно в половине случаев возникают односторонние монофокусни затмение, в других случаях — двусторонние многофокусного затмение. Характерно отсутствие плеврального выпота, деструктивных изменений в легких и внутрилегеневои лимфаденопатии. В биохимическом анализе крови нередко обнаруживают повышение активности КФК, аминотрансфераз — АлАТ и АсАТ.

Специфическая диагностика

Основывается на:

  • иммуноферментном анализе (ELISA), что позволяет определить IgM и IgG в сыворотке крови;
  • непрямой реакции иммунофлюоресценции — вероятно определяет содержание IgM в плазме крови пациентов ТОРС через 10 дней с момента появления первых симптомов заболевания;
  • ПЦР с обнаружением РНК коронавируса.

Все результаты серологических тестов можно окончательно интерпретировать через 21 день от начала заболевания. Положительный результат серологического исследования указывает на предыдущее инфицирование ТОРС-АКВ. Только сероконверсия негативного предыдущего исследования к положительному результату, или четырехкратное увеличение титра антител в крови, взятой в острый период болезни и в период реконвалесценции свидетельствует о только что перенесенное заболевание ТОРС-АКВ.

Лечение

При лечении больных ТОРС не получены окончательные ответы на то, какими препаратами лечить эту болезнь. На данный момент не создан окончательный протокол лечения этого заболевания. Применение различных антибиотиков, ингибиторов нейраминидазы, рибавирина не дало положительного эффекта. Есть мнение, подкрепленное результатами экспериментальных исследований на обезьянах, что комбинация интерферона с ГКС может быть результативной при ТОРС. При развитии ГРДСД проводят интенсивную терапию, больных переводят на искусственную вентиляцию легких.

Профилактика

Основные методы профилактики являются неспецифическими, предусматривают госпитализацию больного, использование индивидуальных масок однократного применения, ограничения контактов людей в условиях напряженной эпидемической ситуации, использование лекарственных средств, активизируют систему неспецифической защиты (адаптогены, индукторы эндогенного интерферона). Средства специфической профилактики не разработаны.

Видео по теме

Изображения по теме

Что такое SARS? | Здоровая жизнь | Здоровье



Фото: Shutterstock.com

В китайском городе Ухань в провинции Хубэй зафиксировали случаи заболевания неизвестной пневмонией. Как заявили местные власти, всего было выявлено 27 случаев заболевания, семь человек находятся в крайне тяжелом состоянии.

По словам врачей, вспышка заболевания произошла на рынке морепродуктов. Пока медики не определили, какой это тип пневмонии. В городском комитете здравоохранения заявили, что ведут статистику и отслеживают все случаи с больными воспалением легких. Медики призвали население не паниковать, поскольку в интернете распространились слухи, что это может быть SARS (Severe Acute Respiratory Syndrome – тяжелый острый респираторный синдром, или ТОРС, заболевание, которое еще называют атипичной пневмонией). 

Ранее в Китае не раз регистрировали вспышки этой болезни. Впервые SARS  выявили в ноябре 2002 года в провинции Гуандун. Тогда меры по предотвращению распространения эпидемии были приняты не сразу, так как правительство КНР первое время скрывало появление этого заболевания в стране. В результате SARS быстро распространился сначала на соседние Гонконг и Вьетнам и затем на другие страны и континенты.

По данным Всемирной организации здравоохранения (ВОЗ), время эпидемии в 2002–2003 годах на материковой части страны от этого недуга умерли около 350 человек, а общее число заболевших превысило пять тысяч.

Что за болезнь SARS и почему ее еще называют атипичной пневмонией? 

Severe Acute Respiratory Syndrome – это инфекционное вирусное заболевание, проявляющееся лихорадкой и быстрым развитием пневмонии или острого респираторного синдрома.

Термин SARS был предложен ВОЗ вместо принятого ранее термина «атипичная пневмония» после того, как в ноябре-декабре 2002 года в западных провинциях Китая, в Гонконге, Вьетнаме, Сингапуре были отмечены первые случаи тяжелых острых респираторных заболеваний с нетипичной воспалительной реакцией дыхательных путей.

Из-за чего возникает заболевание?

SARS вызывает один из представителей коронавирусов. Он был идентифицирован 17 марта 2003 года. Позже эксперты ВОЗ установили, что возбудитель представляет собой новый тип коронавируса, который ранее никогда не встречался у человека и животных. Новый вирус назвали SARS-ассоциированным коронавирурусом.

Какие симптомы SARS?

Симптомами атипичной пневмонии являются высокая температура и сухой кашель, а также затрудненное или учащенное дыхание. При обследовании грудной клетки флюорография показывает картину воспаления легких. Также могут наблюдаться другие симптомы – озноб, головные боли, потеря аппетита, недомогание и боли в мышцах, сухость кожи и диарея. У больного преобладают симптомы общей интоксикации, которые отодвигают на второй план легочные проявления.

Заболевание может протекать как малосимптомно, так и тяжело, с развитием опасных для жизни осложнений. Характерной особенностью SARS является отсутствие чихания и насморка – симптомов, которые обычно сопровождают простудное заболевание. Как правило, болезнь начинается с лихорадки, которая возникает через 2-7 дней после инфицирования, но в тоже время симптомы могут отсутствовать на протяжении 10 дней. Примерно через неделю с момента начала заболевания появляется сухой кашель. При отсутствии правильного лечения ТОРС прогрессирует в тяжелую пневмонию, приводящую к дыхательной недостаточности.

Как лечат SARS?

Лечение SARS проводят в специализированных блоках интенсивной терапии. Врачи используют противовирусные средства, антибиотики последних поколений, глюкокортикостероидные препараты, а также сочетания глюкокортикостероидов и противовирусных лекарств.

Какие существуют методы профилактики SARS? 

Согласно рекомендациям ВОЗ, основные принципы профилактики включают запрещение для посещения регионов, неблагоприятных в отношении этой инфекции, а также строгий противоэпидемический контроль лиц, возвращающихся из данных регионов. Специалисты также советуют пользоваться индивидуальными масками однократного применения в случае необходимости контакта с лицами, подозрительными в отношении развития SARS.

Смотрите также:

Что такое острый респираторный дистресс-синдром

Основная причина смерти при COVID-19 — острый респираторный дистресс-синдром. Meduza объясняет, что это такое и почему он так опасен.

Фото: Reuters

Что такое острый респираторный дистресс-синдром — ОРДС?

Во многих случаях новая коронавирусная инфекция не вызывает симптомов или вызывает лишь незначительные. Когда заболевание проявляется серьезнее, у человека развивается пневмония, то есть воспаление легких. Это может привести к состоянию под названием острый респираторный дистресс-синдром (ОРДС). Если коротко, при ОРДС легкие повреждены из-за воспаления, они вмещают меньше воздуха, альвеолы схлопываются и кислород не может в нужном объеме попадать в кровь. В результате у человека появляется сильная одышка и до органов доходит меньше кислорода, чем нужно. ОРДС — основная причина смерти при новой коронавирусной инфекции.

По имеющимся данным, если у человека с COVID-19 развивается ОРДС, то обычно это происходит так: на шестой-седьмой день после появления симптомов возникает одышка, а на второй-третий день после этого — острый респираторный дистресс-синдром. Это происходит, по разным данным, в 3−17% случаев.

Риск, что пневмония закончится ОРДС, выше, если заболевший — человек старшего возраста, если он злоупотребляет алкоголем, курил раньше или курит сейчас, проходит химиотерапию или у него ожирение.

Правда, ОРДС возникает не только из-за пневмонии (хотя это основная причина), но и из-за других повреждений легких вплоть до тупой травмы груди. Такого рода состояние врачи стали замечать еще во времена Первой мировой войны, название у него появилось в 1967 году, а определение — только в 1994-м.

Как именно развивается ОРДС

Считается, что ОРДС возникает из-за того, что по какой-то причине начинается воспаление, на помощь приходят нейтрофилы (клетки иммунной системы) и в процессе своей работы производят токсичные вещества, которые поражают ткань, выстилающую сосуды и альвеолы. В норме кислород из воздуха в альвеолах передается в кровь, находящуюся в сосудах, а из нее обратно идет углекислый газ. Но из-за повреждения тканей барьер между сосудами и альвеолами нарушается. Воспаление само по себе также приводит к большей проницаемости капилляров. В результате жидкость (состоящая из компонентов крови и других клеток) оказывается там, где не должна находиться, а именно в пространстве, окружающем сосуды и мелкие дыхательные пути. Кроме того, как следствие, возникает отек ткани, окружающей альвеолы. В конце концов альвеолы схлопываются.

Главное, что человек чувствует при ОРДС, — одышка. Он не может договорить предложение без вдоха, ему не хватает воздуха. Но одышка часто бывает и при менее серьезных состояниях, которые, правда, могут постепенно достигнуть тяжести, которая будет определяться как ОРДС. Поставить точный диагноз помогает компьютерная томография (она в этом плане гораздо лучше обычной рентгенографии и тем более флюорографии) и оценка других показателей, касающихся работы легких.

Почему этот синдром особенно часто встречается при COVID-19

Новый коронавирус умеет попадать в клетки дыхательных путей, альвеол, сосудов, сердца, почек и желудочно-кишечного тракта. Хотя легкие все же страдают больше всего. Пораженные клетки производят множество копий коронавируса и в итоге погибают. Все это запускает и поддерживает воспалительный ответ иммунной системы.

В норме сама иммунная система со временем подавляет это воспаление, и человек выздоравливает. Но при инфицировании коронавирусом чаще, чем во многих других случаях, бывает, что тормозящие механизмы иммунной системы не срабатывают как надо. В худшем варианте развития событий это приводит к состоянию под названием «цитокиновый шторм». Тогда захватывается весь организм и могут поражаться даже почки и сердце. И, конечно, кроме прочего, развивается ОРДС. Другими словами, в масштабных повреждениях может принимать участие уже не вирус, который запустил агрессивный ответ, а непосредственно иммунная система человека, которая вышла из-под контроля.

Справиться с ОРДС очень непросто

При ОРДС по-хорошему нужно решить две задачи: добиться того, чтобы уровень насыщения крови кислородом был достаточным и чтобы иммунная система перестала уничтожать легкие. Первая проблема изучена лучше второй, и решения там, можно сказать, есть.

Насыщение крови кислородом

Острый респираторный дистресс-синдром не всегда означает, что за человека дышит аппарат искусственной вентиляции легких (ИВЛ). На самом деле в определенных условиях можно обойтись другими методами, хотя все же стандартная тактика — ИВЛ. Правда, не всегда аппарат именно дышит за человека: бывает, он работает во вспомогательном режиме. Оставлять человека без такой помощи в надежде, что организм справится сам, довольно опасно. Кроме того, если человек умрет, то смерть его, вполне вероятно, будет мучительной.

Как это описал врач

Из поста нью-йоркского реаниматолога Евгения Пинелиса:

«ИВЛ — поддерживающая терапия. Альтернатива ей — смерть от удушья.

Это не слишком честный полемический ход, но я могу. Вы видели, как умирают от удушья? <…> Я — видел. И помнить буду всегда и всех. Пациент с терминальной стадией фиброза легких, которому ИВЛ действительно был противопоказан, так как он не мог получить легочный трансплантат. Пожилые люди с тяжелой пневмонией, которые сами выбрали отказаться от вентиляции. Морфий помогает, но не полностью. И его надо ждать из аптеки. И видеть дыхание по сорок пять раз в минуту (попробуйте просто), синеющие губы, бред или ужас.

Во время эпидемии COVID-19 все мы видели это десятки раз. Пациенты, вырывающиеся из рук врачей и медсестер и сдирающие с себя кислородные маски. Или просто сконцентрированные только на дыхании. На всех этих 45 вдохах и выдохах. За шестьдесят секунд. Когда вместе с диафрагмой работает все тело, кажется иногда, что даже икроножные мышцы».

Если стандартная версия ИВЛ не помогает, человека могут положить на живот, продолжая вентиляцию легких (это предлагает и Всемирная организация здравоохранения). Так, судя по всему, перераспределяется кровоток в легких, и кровь протекает по тем участкам, в которых кислород может в нее попасть.

При тяжелом ОРДС еще используют препараты для нейромышечной блокады и — редко — оксид азота. Хотя польза от этих препаратов вызывает споры.

В крайнем случае можно использовать экстракорпоральную мембранную оксигенацию (ЭКМО), то есть пропускать кровь пациента через аппарат, который обогащает ее кислородом, забирает углекислый газ и возвращает ее человеку. Но такие аппараты редки и требуют большого количества специально обученного персонала. Кроме того, эффективность ЭКМО при новой коронавирусной инфекции под сомнением, хотя Всемирная организация здравоохранения предлагает рассмотреть такой вариант.

Налаживание работы иммунной системы

Что касается работы иммунной системы, сейчас есть средства, которые, предположительно, могут сработать точечно и повлиять на нужные механизмы. Но, как обычно бывает в случае COVID-19, достаточно хороших исследований еще нет. При похожих состояниях — когда иммунная система ведет себя агрессивно — иногда назначаются некоторые моноклональные антитела (например, тоцилизумаб). Они могут снижать уровень веществ, участвующих в процессе воспаления. Есть небольшие работы, которые показывают эффективность тоцилизумаба, но пока нет по-настоящему надежных исследований, которые бы показывали эффективность этого подхода при новой коронавирусной инфекции. По всей видимости, если он и работает, то в тяжелых случаях, но при этом до развития ОРДС.

Более грубое вмешательство может привести к распространению вируса. Поэтому, например, глюкокортикоиды, которые подавляют работу иммунной системы, рекомендуют использовать только в крайних случаях, и то не все организации.

С этим синдромом есть еще одна проблема, которая делает новый коронавирус особенно опасным

Даже если человек пережил ОРДС, это не значит, что он станет прежним и в психическом, и в физическом смысле. Примерно у 40% бывших пациентов в той или иной степени нарушается мышление. Возможно, это связано с тем, что какое-то время мозг получал недостаточно кислорода. У таких людей чаще бывают депрессия, тревога и посттравматическое стрессовое расстройство. Части из них сложнее выдерживать прежние физические нагрузки, а легкие обычно работают хуже, чем раньше.

Читайте также

Тяжелый острый респираторный синдром (ТОРС) — Симптомы и причины

Обзор

Тяжелый острый респираторный синдром (ТОРС) — это заразное и иногда смертельное респираторное заболевание. SARS впервые появился в Китае в ноябре 2002 года. В течение нескольких месяцев SARS распространился по всему миру, его переносили ничего не подозревающие путешественники.

SARS показал, насколько быстро инфекция может распространяться в высокомобильном и взаимосвязанном мире.С другой стороны, совместные международные усилия позволили специалистам в области здравоохранения быстро сдержать распространение болезни. С 2004 года не было зарегистрировано случаев передачи SARS где-либо в мире.

Продукты и услуги

Показать другие продукты Mayo Clinic

Симптомы

SARS обычно начинается с симптомов и симптомов гриппа — лихорадки, озноба, мышечной боли, головной боли и иногда диареи.Примерно через неделю признаки и симптомы включают:

  • Температура 100,5 F (38 C) или выше
  • Сухой кашель
  • Одышка

Когда обращаться к врачу

SARS — серьезное заболевание, которое может привести к смерти. Если у вас есть признаки или симптомы респираторной инфекции или у вас появились симптомы гриппа с лихорадкой после поездки за границу, немедленно обратитесь к врачу.

Причины

SARS вызван штаммом коронавируса, того же семейства вирусов, которое вызывает простуду.Раньше эти вирусы никогда не были особо опасными для человека.

Коронавирусы, однако, могут вызывать тяжелые заболевания у животных, и поэтому ученые подозревали, что вирус SARS мог перейти от животных к человеку. Теперь кажется вероятным, что вирус превратился из одного или нескольких вирусов животных в новый штамм.

Как распространяется SARS

Большинство респираторных заболеваний, в том числе SARS , передаются через капли, попадающие в воздух, когда больной кашляет, чихает или разговаривает.Большинство экспертов считают, что SARS распространяется в основном при тесном личном контакте, например, при уходе за больным SARS . Вирус также может распространяться на зараженные объекты, такие как дверные ручки, телефоны и кнопки лифта.

Факторы риска

В целом наибольшему риску SARS подвержены люди, которые имели прямой, тесный контакт с кем-то инфицированным, например, члены семьи и медицинские работники.

Осложнения

У многих людей с SARS развивается пневмония, и проблемы с дыханием могут стать настолько серьезными, что потребуется механический респиратор. SARS в некоторых случаях приводит к летальному исходу, часто из-за дыхательной недостаточности. Другие возможные осложнения включают сердечную и печеночную недостаточность.

Люди старше 60 лет, особенно с сопутствующими заболеваниями, такими как диабет или гепатит, подвергаются наибольшему риску серьезных осложнений.

Профилактика

Исследователи работают над несколькими типами вакцин против SARS , но ни одна из них не была протестирована на людях. При повторном появлении инфекции SARS следуйте этим правилам безопасности, если вы ухаживаете за человеком, у которого может быть инфекция SARS :

  • Вымойте руки. Часто мойте руки горячей водой с мылом или используйте спиртосодержащую антисептическую жидкость для рук, содержащую не менее 60% спирта.
  • Надеть одноразовые перчатки. При контакте с жидкостями или фекалиями человека наденьте одноразовые перчатки. Выбросьте перчатки сразу после использования и тщательно вымойте руки.
  • Носите хирургическую маску. Когда вы находитесь в одной комнате с человеком с SARS , прикрывайте рот и нос хирургической маской.Ношение очков также может обеспечить некоторую защиту.
  • Вымойте личные вещи. Используйте мыло и горячую воду для мытья посуды, полотенец, постельного белья и одежды человека с SARS .
  • Продезинфицировать поверхности. Используйте бытовое дезинфицирующее средство для очистки любых поверхностей, которые могли быть загрязнены потом, слюной, слизью, рвотой, калом или мочой. Надевайте одноразовые перчатки при чистке и выбросьте перчатки, когда закончите.

Соблюдайте все меры предосторожности в течение как минимум 10 дней после исчезновения признаков и симптомов человека.Не пускайте детей в школу, если у них разовьется лихорадка или респираторные симптомы в течение 10 дней после контакта с кем-то с SARS .

24 сентября 2019 г.

SARS (тяжелый острый респираторный синдром)

  1. Учетные записи
  2. SARS (тяжелый острый респираторный синдром)

Этот материал нельзя использовать в коммерческих целях, в больницах или медицинских учреждениях.Несоблюдение может повлечь судебный иск.

ЧТО НУЖНО ЗНАТЬ:

Что такое тяжелый острый респираторный синдром?

Тяжелый острый респираторный синдром (SARS) — это заболевание, вызванное вирусом, поражающим воздушные мешочки легких. Ткани легких воспаляются и покрываются рубцами. Поврежденные воздушные мешочки не позволяют кислороду попадать в кровоток, что может вызвать дыхательную недостаточность. Дыхательная недостаточность означает, что вы не можете дышать достаточно хорошо, чтобы доставлять кислород клеткам вашего тела.Вирус SARS связан с другими вирусами, вызывающими простуду и диарею. Его можно найти в слюне, мокроте или выделениях из носа инфицированного человека.

Что увеличивает мой риск заболевания атипичной пневмонией?

  • Вы вдыхаете микробы, когда инфицированный человек кашляет или чихает рядом с вами. Это наиболее распространенный способ распространения атипичной пневмонии.
  • Вы используете общую посуду или пожмете руку инфицированному человеку.
  • У вас был тесный контакт с человеком, который заболел в течение 10 дней после возвращения из зоны вспышки атипичной пневмонии.
  • Вы живете с больным SARS, посещаете или ухаживаете за ним.
  • Вы путешествуете в регионы, где распространилась атипичная пневмония, например в континентальный Китай, Гонконг, Тайвань или Канаду.

Каковы признаки и симптомы ОРВИ?

Признаки и симптомы обычно появляются через 4-10 дней после контакта с вирусом SARS:

  • Озноб и высокая температура 100,4 ° F (38 ° C) или выше
  • Головная боль, ломота и боли в теле и слабость
  • Диарея, тошнота или рвота
  • Кашель и одышка (могут появиться через 2-7 дней после появления первых симптомов)

Как диагностируется SARS?

Медицинские работники могут диагностировать SARS на основании ваших признаков и симптомов, а также на основании недавних путешествий.Они также могут захотеть узнать, был ли у вас возможный контакт с кем-то, инфицированным SARS. Вам также может понадобиться один или несколько из следующих тестов:

  • Газы крови: Это также называется газом артериальной крови или ABG. Кровь берется из артерии (кровеносного сосуда) на запястье, руке или паху. Ваша кровь проверяется на содержание в ней кислорода и углекислого газа. Результаты могут сказать медицинским работникам, насколько хорошо работают ваши легкие.
  • Анализы крови: Вам может потребоваться взятие крови, чтобы предоставить медицинским работникам информацию о том, как работает ваше тело.Кровь можно взять из руки, руки или внутривенно.
  • Рентген грудной клетки: Это снимок ваших легких и сердца. Медицинские работники используют его, чтобы увидеть, как работают ваши легкие и сердце. Медицинские работники могут использовать рентгеновский снимок для поиска признаков инфекции, например пневмонии, или для поиска коллапса легких. Рентген грудной клетки может показать опухоли, сломанные ребра или жидкость вокруг сердца и легких.
  • Компьютерная томография: Этот тест также называется компьютерной томографией. Рентгеновский аппарат использует компьютер, чтобы делать снимки ваших легких.На фотографиях может быть изображена пневмония. Вам могут дать краситель, чтобы ваши легкие лучше отображались на фотографиях. Сообщите врачу, если у вас когда-либо была аллергическая реакция на контрастный краситель.
  • Посев или анализы: Могут собираться респираторные жидкости, например слизь из горла или носа. Образец вашей мочи или испражнения также может быть отправлен в лабораторию для анализа. Они могут показать, какой микроб вызывает ваше заболевание, и помочь поставщикам медицинских услуг спланировать для вас наилучшее лечение.

Как лечится ОРВИ?

Не существует лекарств от ОРВИ. Медицинские работники будут лечить симптомы пневмонии, вызванные атипичной пневмонией. Вам может понадобиться любое из следующего:

  • Лекарства: Вам могут дать лекарства для снятия жара, кашля и боли. Также могут быть назначены противовирусные препараты. Вам также могут понадобиться лекарства, чтобы уменьшить отек в легких и облегчить дыхание.
  • Респираторная поддержка:
    • Вам может потребоваться дополнительный кислород , если уровень кислорода в крови ниже, чем должен быть.Вы можете получить кислород через маску, надетую на нос и рот, или через маленькие трубки, вставленные в ноздри. Перед тем, как снимать маску или кислородную трубку, проконсультируйтесь с лечащим врачом.
    • Эндотрахеальная (ЭТ) трубка: Эндотрахеальная трубка может быть вставлена ​​в рот или нос. Он спускается в дыхательное горло, чтобы поддерживать дыхательные пути открытыми и помогать дышать. Он может быть подключен к вентилятору (дыхательному аппарату), и вы можете получить дополнительный кислород через трубку ET. Вы не сможете разговаривать, пока установлена ​​трубка ET.

Каковы риски SARS?

ТОРС — серьезное, опасное для жизни заболевание, лечение которого откладывать не следует. Если не лечить на ранней стадии, вирус атипичной пневмонии может серьезно повредить ваши легкие и вызвать дальнейшие проблемы с дыханием. SARS может привести к пневмонии. Пневмония вызывает опухание легких и их заполнение жидкостью. Жидкость в легких вызывает сильную одышку и может привести к дыхательной недостаточности. Дыхательная недостаточность означает, что вы не можете дышать достаточно хорошо, чтобы доставлять кислород клеткам вашего тела.Это может повлиять на ваше сердце и мозг и быть опасным для жизни.

Как предотвратить атипичную пневмонию?

  • Во время путешествия:
    • Если вам необходимо поехать в район, где есть вспышка атипичной пневмонии, избегайте нахождения среди больших групп людей. Возможно, вам также понадобится принести с собой одноразовые (одноразовые) перчатки или маски.
    • Часто мойте руки теплой водой с мылом. Лосьоны или гели для уничтожения микробов можно использовать при отсутствии воды.
  • При уходе за больным атипичной пневмонией:
    • Всегда мойте руки, особенно до и после того, как вы войдете в комнату этого человека.
    • Не используйте вместе с этим постельное белье, постельное белье или столовые приборы.
    • Пусть зараженный человек носит маску, когда другие находятся в комнате с ним. Если он не может носить маску, помогите ему прикрыть рот или нос, когда он кашляет или чихает.
    • Поместите влажное белье в пластиковый пакет и постирайте его горячей водой с мылом.
    • Выбросьте бумажную салфетку после того, как вытерли нос или высморкались.
    • При чистке поверхностей используйте дезинфицирующие средства на спиртовой или хлорной основе (убийцы микробов).Надевайте одноразовые перчатки, маску и халат, чтобы защитить себя.
    • Попросите всех, кто находится в тесном контакте с этим человеком, пройти тестирование на SARS.

Как я могу предотвратить распространение SARS среди других людей, если я инфицирован?

  • Не допускайте посетителей в комнату, особенно если симптомы не исчезнут.
  • Прикрывайте рот и нос салфеткой, когда чихаете или кашляете.
  • Сообщите своим поставщикам медицинских услуг, что у вас может быть атипичная пневмония, прежде чем они свяжутся с вами.Это предупредит их, чтобы они могли защитить себя и своих сотрудников от вируса атипичной пневмонии.
  • Держитесь подальше от других, пока ваш поставщик медицинских услуг не скажет, что вы больше не можете распространять вирус SARS. Возможно, вам придется оставаться дома, пока симптомы SARS не исчезнут, в течение 10 дней или дольше. Не ходите на работу, в школу или в другие общественные места, пока ваш лечащий врач не скажет, что это нормально.
  • Мойте руки до и после еды, касайтесь предметов или людей и сходите в ванную.
  • Носите маску, когда в комнате с вами другие люди.

Где я могу найти дополнительную информацию?

  • Центры по контролю и профилактике заболеваний
    1600 Clifton Road
    Atlanta, GA 30333
    Телефон: 1-404-6393311
    Телефон: 1-800 — 3113435
    Адрес в Интернете: http://www.cdc.gov
  • Всемирная организация здравоохранения
    Адрес в Интернете: www.who.int

Когда мне следует связаться с поставщиком медицинских услуг?

  • У вас жар.
  • Вы кашляете с кровавой мокротой.
  • У вас есть вопросы или опасения по поводу вашего состояния или ухода.

Когда мне следует немедленно обратиться за медицинской помощью или позвонить по номеру 911?

  • У вас внезапная одышка.
  • У вас учащенное сердцебиение или боль в груди.
  • У вас настолько кружится голова, что вам трудно встать.
  • Ваши губы и ногти синеют.

Соглашение об уходе

У вас есть право помочь спланировать свое лечение. Узнайте о своем состоянии здоровья и о том, как его можно лечить.Обсудите варианты лечения со своими поставщиками медицинских услуг, чтобы решить, какое лечение вы хотите получать. Вы всегда имеете право отказаться от лечения. Вышеуказанная информация носит исключительно учебный характер. Он не предназначен для использования в качестве медицинского совета по поводу индивидуальных состояний или лечения. Поговорите со своим врачом, медсестрой или фармацевтом перед тем, как следовать любому лечебному режиму, чтобы узнать, безопасно ли оно для вас и эффективно.

© Copyright IBM Corporation 2020 Информация предназначена только для использования Конечным пользователем, ее нельзя продавать, распространять или иным образом использовать в коммерческих целях.Все иллюстрации и изображения, включенные в CareNotes®, являются собственностью A.D.A.M., Inc. или IBM Watson Health

, защищенной авторским правом. Дополнительная информация

Всегда консультируйтесь со своим поставщиком медицинских услуг, чтобы убедиться, что информация, отображаемая на этой странице, применима к вашим личным обстоятельствам.

Заявление об отказе от ответственности за медицинские услуги

Подробнее о SARS (тяжелый острый респираторный синдром)

Сопутствующие препараты
Клинические коды МКБ-10 CM (внешние)

Острый респираторный дистресс-синдром — американский семейный врач

Острый респираторный дистресс-синдром — это клиническое проявление тяжелого острого повреждения легких.Он характеризуется острым началом диффузных двусторонних легочных инфильтратов, вторичных по отношению к некардиогенному отеку легких, рефрактерной гипоксии и снижению эластичности легких. Синдром острого респираторного дистресс-синдрома чаще всего возникает при сепсисе, аспирации желудочного содержимого, травме или множественных переливаниях крови. Его сложная патофизиология включает в себя провоцирующее локальное или системное событие, которое инициирует повреждение эндотелия и эпителия легких и последующее повышение проницаемости.Тахипноэ, гипоксия и респираторный алкалоз — типичные ранние клинические проявления, за которыми обычно следует появление диффузных легочных инфильтратов и дыхательной недостаточности в течение 48 часов. Важное значение имеют раннее выявление и лечение основного заболевания, а также агрессивная поддерживающая терапия. Экспериментальные методы лечения, в том числе с использованием оксида азота и сурфактанта, не показали улучшения смертности у пациентов с ОРДС, но было показано, что новые терапевтические подходы, такие как вентиляция с низким объемом, снижают смертность.Многие пациенты, пережившие ОРДС, имеют необратимые, легкие или умеренные нарушения функции легких. Качество жизни после госпитализации с ОРДС может быть хуже, чем у аналогичных пациентов без ОРДС.

Острый респираторный дистресс-синдром (ОРДС) характеризуется острым повреждением легких, некардиогенным отеком легких и тяжелой гипоксией. Распространенное заболевание со сложной патофизиологией, часто встречается у тяжелобольных медицинских и хирургических пациентов. С тех пор, как ОРДС был впервые описан в 1967 году, я значительно продвинулся в понимании его патофизиологии.

Многочисленные предыдущие испытания новых фармакологических и вентиляционных методов не смогли продемонстрировать улучшение показателей смертности. Однако недавние испытания, в которых использовался новый «защитный для легких» подход к механической вентиляции, привели к значительному снижению показателей смертности.2,3 Данные этих исследований представляют собой обнадеживающий прорыв в лечении ОРДС.

Многие семейные врачи лечат пациентов с ОРДС, а многие пациенты, пережившие ОРДС, получают лечение в отделениях интенсивной терапии (ОИТ) у семейных врачей.Поэтому необходимо всестороннее понимание этого синдрома.

Определение

Наиболее широко используемое определение ОРДС было опубликовано в заявлении Американо-европейской конференции по консенсусу в 1994 году.4 В нем ОРДС описывался как синдром воспаления и повышенной проницаемости, связанный с совокупностью клинических, радиологических и физиологических отклонений, не объясняемых высотой в левом предсердии или легочном капиллярном давлении. Определяющие диагностические критерии приведены в таблице 1.Эти критерии легко идентифицировать клинически и учитывать тяжесть повреждения легких.5 Рассматриваются пациенты с отношением парциального давления артериального кислорода (Pao 2 ) к процентному содержанию вдыхаемого кислорода (Fio 2 ) 300 или меньше. иметь «острое повреждение легких», тогда как пациенты с более тяжелой гипоксией (определяемые как измеренное парциальное давление артериального кислорода по отношению к фракции вдыхаемого кислорода [Pao 2 / Fio 2 ], составляющей менее 200), классифицируются как с ОРДС.

Просмотреть / распечатать таблицу

ТАБЛИЦА 1

Диагностические критерии ОРДС
дистресс-синдром присутствует, если Pao 2 / Fio 2 соотношение ≤ 200

Идентифицируемое сопутствующее состояние

Острое начало

Клиническое давление в легочной артерии ≤ Клиническое давление в легочной артерии доказательства гипертензии левого предсердия

Двусторонние инфильтраты на рентгенограмме грудной клетки

Острое повреждение легких присутствует, если соотношение Pao 2 / Fio 2 ≤ 300 *

ТАБЛИЦА 1

Диагностические критерии ОРДС

респираторный дистресс-синдром присутствует, если соотношение Pao 2 / Fio 2 ≤ 200

Идентифицируемое ассоциированное состояние

39

9 904 Острое начало Давление заклинивания в легочной артерии ≤ 18 мм рт. Ст. Или отсутствие с клинические данные о гипертонии левого предсердия

Двусторонние инфильтраты на рентгенограмме грудной клетки

Острое повреждение легких присутствует, если соотношение Pao 2 / Fio 2 ≤ 300 *

Эпидемиология

ЗАБОЛЕВАЕМОСТЬ

В 1972 году группа Национальных институтов здравоохранения оценила заболеваемость ОРДС примерно в 75 на 100000 населения. в год.6 Однако сейчас общее согласие обнаруживает, что это завышенная оценка. В проспективных исследованиях сообщалось, что заболеваемость ОРДС колеблется от 1,5 до 8,3 случая на 100000 населения в год.7,8 Эти отчеты подверглись критике за исключение пациентов с соотношением Pao 2 / Fio 2 более 150 Следовательно, заболеваемость может быть выше, чем предполагают эти цифры.

ФАКТОРЫ РИСКА

Выявлены клинические состояния, связанные с ОРДС (таблица 2).5 Эти состояния делятся на две категории: те, которые вызывают прямое повреждение легких, и те, которые вызывают непрямое повреждение легких путем активации системной воспалительной реакции. Из различных факторов риска сепсис связан с самым высоким риском прогрессирования ОРДС. Аспирация желудочного содержимого, множественная травма, множественные переливания крови, диффузная пневмония и диссеминированное внутрисосудистое свертывание также связаны с высоким риском развития ОРДС. Определенные ранее существовавшие состояния, такие как хроническое заболевание легких и хронический алкоголизм, значительно повышают риск развития ОРДС.9,10 ARDS, по-видимому, чаще встречается у пациентов старше 65 лет в группах пациентов с аналогичными факторами риска.9 Однако пол, похоже, не влияет на вероятность развития синдрома.9

Посмотреть / распечатать таблицу

ТАБЛИЦА 2

Состояния, связанные с ОРДС
Прямое повреждение легкого Непрямое повреждение легкого

Пневмония

Сепсис

9000 9000

Множественные переливания крови

Ушиб легкого

Жировая эмболия

Сердечное шунтирование

Ожоги

905 00

Реперфузионный отек легких

Острый панкреатит

Передозировка наркотиками

ТАБЛИЦА 2

Состояния, связанные с ОРДС

9047 9 Непрямое повреждение легких

Сепсис

Аспирация содержимого желудка

Множественная травма

Множественные переливания крови

Искусственное кровообращение

Травма при вдыхании

Почти утопление

Ожоги

Реперфузионный отек легких

Острый отек легких

Передозировка лекарством

Гистопатологические изменения

Диффузное альвеолярное повреждение — это описательный термин для гистопатологических данных, обнаруженных при остром повреждении легких.Диффузное альвеолярное поражение подразделяется на экссудативную (рис. 1) и фибропролиферативную фазы. Хотя каждая фаза имеет свои собственные гистологические характеристики, между двумя стадиями существует значительное совпадение (рис. 2), которые клинически неотличимы. Степень фиброза сильно варьируется среди пациентов. У одних он может отсутствовать, тогда как у других может развиться тяжелый фиброз с сотами.

Просмотр / печать Рисунок

РИСУНОК 1.

Вскрытие легкого, показывающее экссудативную стадию острого респираторного дистресс-синдрома.Обратите внимание на внутриальвеолярные скопления отечной жидкости, воспалительных клеток и красных кровяных телец. Отмечается выраженная десквамация эпителиальных клеток I типа. (гематоксилин и эозин, X 100)


РИСУНОК 1.

Вскрытие легкого, показывающее экссудативную стадию острого респираторного дистресс-синдрома. Обратите внимание на внутриальвеолярные скопления отечной жидкости, воспалительных клеток и красных кровяных телец. Отмечается выраженная десквамация эпителиальных клеток I типа. (гематоксилин и эозин, X 100)

Просмотр / печать рисунка

РИСУНОК 2.

Образец биопсии легкого, выявляющий наложение фибропролиферативной стадии и экссудативной стадии. Обратите внимание на обширное отложение коллагена, которое находится рядом с областями десквамации эпителия и внутриальвеолярными скоплениями воспалительных клеток. (гематоксилин и эозин, X 100)


РИСУНОК 2.

Образец биопсии легкого, выявляющий перекрытие фибропролиферативной стадии и экссудативной стадии. Обратите внимание на обширное отложение коллагена, которое находится рядом с областями десквамации эпителия и внутриальвеолярными скоплениями воспалительных клеток.(гематоксилин и эозин, X 100)

Патогенез

Точная последовательность событий при ОРДС неизвестна. В ответ на прямое повреждение легких или системное поражение, такое как эндотоксин, происходит увеличение провоспалительных цитокинов в легких или кровообращении. Также могут быть нарушения в балансе про- и противовоспалительных цитокинов.11 Нейтрофилы, активируемые цитокинами, прикрепляются к эндотелиальной поверхности легочных капилляров и мигрируют в интерстициальное и альвеолярное пространство. Активированные нейтрофилы секретируют цитокины, такие как фактор некроза опухоли альфа и интерлейкины, которые усиливают воспалительный ответ.Нейтрофилы также продуцируют кислородные радикалы и протеазы, которые могут повредить капиллярный эндотелий и альвеолярный эпителий.5 Нейтрофильные метаболиты арахидоновой кислоты могут вызывать изменения в саморегуляции легочных сосудов и проницаемости сосудов.12 Повреждение эпителия и эндотелия, в свою очередь, приводит к увеличению проницаемости и последующий приток богатой белком жидкости в альвеолярное пространство. Помимо этих структурных изменений, есть данные о нарушении фибринолиза при ОРДС, что приводит к тромбозу капилляров и микроинфаркту.

Однако основная роль нейтрофилов подвергается сомнению. Например, ОРДС может развиться у пациентов с нейтропенией. Альвеолярные макрофаги также продуцируют различные воспалительные процессы.

Понимание фибропролиферативного процесса ограничено. Некоторые пациенты достигают полного исчезновения повреждения легких до перехода в фибропролиферативную стадию, тогда как у других прогрессирует непосредственно до развития фиброза. Степень фиброза может определяться тяжестью первоначального повреждения, продолжающимся или повторяющимся повреждением легких, токсическим воздействием кислорода и повреждением легких, связанным с вентилятором.

Клинические результаты

ПРЕЗЕНТАЦИЯ

У пациентов с ОРДС наблюдается прогрессирование клинических результатов. Тахипноэ, тахикардия и респираторный алкалоз обычно развиваются в течение первых 12–24 часов после провоцирующего события и могут предшествовать появлению инфильтратов на рентгенограмме грудной клетки. Воспалительный процесс и альвеолярное кровотечение приводят к серьезному несоответствию вентиляции и перфузии и внутрилегочному шунту, которые клинически проявляются как тяжелая гипоксия с уменьшением отношения Pao 2 / Fio 2 .Как правило, происходит заметное снижение растяжимости легких, что увеличивает работу дыхания. Физиологическое мертвое пространство увеличивается при ОРДС, и для поддержания нормального или почти нормального парциального давления углекислого газа (PCO 2 ) пациенты должны увеличивать минутную вентиляцию.

Тяжелая гипоксия, увеличенное мертвое пространство и снижение эластичности легких способствуют развитию дыхательной недостаточности. У большинства пациентов развиваются диффузные альвеолярные инфильтраты и прогрессируют до дыхательной недостаточности в течение 48 часов после появления симптомов.

ИЗОБРАЖЕНИЕ ЛЕГКИХ

Во время экссудативной фазы рентгенограммы грудной клетки выявляют прогрессирование от диффузных интерстициальных инфильтратов к диффузным пушистым альвеолярным помутнениям (рис. 3). Хотя ОРДС нельзя достоверно отличить от кардиогенного отека легких по рентгенологическим признакам, у пациентов с ОРДС часто отсутствуют кардиомегалия, плевральный выпот и сосудистое перераспределение. Может возникнуть ретикулярное помутнение, что свидетельствует о развитии интерстициального фиброза.

Просмотр / печать рисунка

РИСУНОК 3.

Переднезадний рентгеновский снимок грудной клетки 50-летнего пациента с острым респираторным дистресс-синдромом через 12 часов после интубации. Двусторонние диффузные альвеолярные инфильтраты соответствуют отеку легких. Обратите внимание на отсутствие кардиомегалии и плеврального выпота, которые часто наблюдаются у пациентов с кардиогенным отеком легких.


РИСУНОК 3.

Переднезадняя рентгенограмма грудной клетки 50-летнего пациента с острым респираторным дистресс-синдромом через 12 часов после интубации.Двусторонние диффузные альвеолярные инфильтраты соответствуют отеку легких. Обратите внимание на отсутствие кардиомегалии и плеврального выпота, которые часто наблюдаются у пациентов с кардиогенным отеком легких.

Компьютерная томография (КТ) грудной клетки позволила лучше понять структурные аномалии, возникающие на разных стадиях ОРДС.13 Двусторонние альвеолярные помутнения наблюдаются во время острой фазы ОРДС и более выражены в зависимых, задних зонах легких. . Передние области легких относительно свободны, что подчеркивает неоднородное распределение воспаления в легких.КТ может выявить заметное улучшение аэрации зависимых (задних) областей легких при применении положительного давления в конце выдоха (ПДКВ) (рис. 4) .14 Двусторонние ретикулярные помутнения, уменьшение объема легких и, иногда, большие пузыри — это КТ находки во время фибропролиферативной стадии.

Просмотр / печать Рисунок

РИСУНОК 4.

Четыре компьютерных томографических изображения грудной клетки на среднем уровне лежащего на спине пациента с острым респираторным дистресс-синдромом.Каждое изображение представляет разные условия вентиляции. (A) Окончание выдоха при нулевом уровне давления в конце выдоха. (B) Завершите выдох с помощью PEEP. (C) Закончите вдох с уменьшенным дыхательным объемом и ПДКВ (ПДКВ + ограниченный дыхательный объем). (D) Завершите вдох с 10 мл на кг дыхательного объема и ПДКВ (ПДКВ + дыхательный объем 10). Обратите внимание на асимметричное распределение ателектазов и отеков в зависимых областях легких, которое улучшается при использовании PEEP и более высоких дыхательных объемов. (PEEP = положительное давление в конце выдоха)

Используется с разрешения Dambrosio M, Roupie E, Mollet JJ, Anglade MC, Vasile N, Lemaire F, et al.Влияние положительного давления в конце выдоха и различных дыхательных объемов на рекрутирование альвеол и гиперинфляцию. Анестезиология 1997; 87: 495–503.

Дифосфат хлорохина для лечения тяжелого острого респираторного синдрома, вторичного по отношению к SARS-CoV2 — Просмотр полного текста

Краткое описание:

В декабре 2019 года муниципальный комитет здравоохранения Уханя, Китай, выявил вспышку вирусной пневмонии неизвестной причины. Этот новый коронавирус получил название SARS-CoV-2, а заболевание, вызванное этим вирусом, — COVID-19.Последние данные показывают, что во всем мире было диагностировано 222 643 инфекции и 9115 смертей. В настоящее время нет одобренных терапевтических средств для лечения коронавирусов. В этом сценарии ситуация глобальной чрезвычайной ситуации в области общественного здравоохранения и доказательства потенциального положительного эффекта хлорохина (CQ) на большинство коронавирусов, включая SARS-CoV-1, а также недавние данные о небольших испытаниях SARS-CoV-2, исследователи намереваются изучить эффективность и безопасность дифосфата CQ при лечении госпитализированных пациентов с тяжелым острым респираторным синдромом в сценарии SARS-CoV2.Предварительные исследования in vitro и неконтролируемые испытания с небольшим количеством пациентов с репозиционированием CQ при лечении COVID-19 обнадеживают. Основная гипотеза заключается в том, что дифосфат CQ снизит смертность на 50% у людей с тяжелым острым респираторным синдромом, инфицированных SARS-COV2. Поэтому основная цель — оценить, снижает ли использование хлорохиндифосфата смертность на 50% в исследуемой популяции. Первичный результат — летальность на 28-е сутки наблюдения. Согласно местному плану действий в чрезвычайных ситуациях, разработанному местным правительством для COVID-19 в штате Амазонас, больница Пронто-Сокорро Дельфина Азиз, расположенная в Манаусе, является справочным центром для приема серьезных случаев нового вируса.В настоящее время в отделении имеется 50 коек интенсивной терапии с возможностью расширения до 335 коек при необходимости. Больница также имеет обученные многопрофессиональные человеческие ресурсы и соответствующую инфраструктуру. В общей сложности 440 участников (220 на группу) будут получать либо режим высокой дозы хлорохина 600 мг два раза в день (4 таблетки по 150 мг, каждые 12 часов, D1-D10), либо режим низкой дозы хлорохина 450 мг два раза в день (3 таблетки по 150 мг + 1 таблетка плацебо каждые 12 часов. на D1, 3 таблетки по 150 мг + 1 плацебо, затем 4 таблетки плацебо через 12 часов с D2 до D5 и 4 таблетки плацебо каждые 12 часов, D6-D10).Таблетки плацебо использовались для стандартизации продолжительности лечения, а также для слепой исследовательской группы и пациентов.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *