Мкб 10 открытое овальное окно: Ваш браузер устарел

Содержание

«Клинические рекомендации «Дефект межжелудочковой перегородки»
(утв. Минздравом России)

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ

КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ

ДЕФЕКТ МЕЖЖЕЛУДОЧКОВОЙ ПЕРЕГОРОДКИ

МКБ 10: Q21.1

Год утверждения (частота пересмотра): 2018 (не реже 1 раза в 3 года)

ID: КР46

URL

Профессиональные ассоциации

— Ассоциация сердечно-сосудистых хирургов России

Ключевые слова

— одышка

— сердцебиение

— цианоз

— кардиомегалия

— недостаточность кровообращения

— аритмии

— парадоксальная эмболия

— неполная блокада правой ножки пучка Гиса

— посткардиотомный синдром

— тампонада сердца

Список сокращений

ВПС — врожденные пороки сердца

ДМПП — дефект межпредсердной перегородки

ИБС — ишемическая болезнь сердца

КТ — компьютерная томография

МРТ — магнитно-резонансная томография

ОЛС — общелегочное сосудистое сопротивление

ОРИТ — отделение реанимации и интенсивной терапии

ПЖ — правый желудочек

ПП — правое предсердие

ЭКГ — электрокардиография

ЭхоКГ — эхокардиография

Qp/Qs — соотношение объемов кровотока по малому и большому кругам кровообращения

Термины и определения

Кардиомегалия — увеличение сердца, вызванное гипертрофией объема сердечной мышцы или дилатацией камер сердца.

Катетеризация сердца — инвазивная процедура, проводимая с лечебными или диагностическими целями при патологии сердечно-сосудистой системы.

Посткардиотомный синдром — осложнение раннего послеоперационного периода в хирургии врожденных пороков сердца, проявляющееся наличием выпота в перикардиальной полости.

1. Краткая информация

1.1. Определение

Дефект межпредсердной перегородки (ДМПП) — врожденный порок сердца (ВПС), характеризующийся наличием сообщения (отверстия) между правым и левым предсердием, который обусловливает существование артериовенозного сброса между ними.

1.2. Этиология и патогенез

Формирование дефекта связано с недоразвитием первичной и вторичной межпредсердной перегородки и эндокардиальных валиков в эмбриональном периоде. К нарушению органогенеза приводят генетические, физические, экологические и инфекционные факторы. Риск развития ДМПП у будущего ребенка существенно выше в тех семьях, где есть родственники с ВПС. Кроме наследственной обусловленности, к возникновению ДМПП могут приводить вирусные заболевания беременной (краснуха, ветряная оспа и др.), эндокринопатии, прием некоторых медикаментов и алкоголя во время беременности, производственные вредности, гестационные осложнения (токсикозы, угроза выкидыша и др.).

1.3. Эпидемиология

ДМПП составляет 7,1 — 8,7% от всех врожденных пороков сердца [1]. Заболеваемость ДМПП колеблется от 0,317 до 0,941 случая на 1000 живорожденных детей в зависимости от популяции, методов диагностики и времени эпидемиологических исследований [1, 2].

1.4. Кодирование по МКБ 10

Q21.1 — Дефект межпредсердной перегородки.

1.5. Классификация

Классификация ДМПП [2, 3]:

— открытое овальное окно;

— первичный дефект межпредсердной перегородки;

— вторичный дефект межпредсердной перегородки;

— дефект венозного синуса:

— верхний;

— нижний.

— дефект коронарного синуса (обескрышенный коронарный синус):

— проксимальный;

— средний;

— дистальный.

1.6. Клиническая картина

Пороки этого типа имеют скудную клиническую картину и часто протекают бессимптомно. Они могут манифестировать сниженной толерантностью к физической нагрузке, частыми инфекционными заболеваниями легких. Явления недостаточности кровообращения незначительны и могут ограничиваться умеренно выраженной слабостью, потливостью ребенка, цианозом носогубного треугольника. Дети нередко имеют астеническое телосложение с заметной бледностью кожных покровов. Диффузный цианоз может отмечаться в случаях вено-артериального сброса.

При физикальном осмотре могут отмечаться расщепление II тона (следствие большей продолжительности систолы правого желудочка) и/или систолический шум функционального стеноза над легочной артерией. В случаях больших дефектов возможно наличие диастолических шумов над трехстворчатым клапаном (функциональный стеноз) и легочной артерией (недостаточность клапана легочной артерии, шум Грехема-Стилла).

2. Диагностика

2. 1. Жалобы и анамнез

— При сборе анамнеза рекомендуется выявить у родителей ребенка или пациентов взрослого возраста с подозрением на ДМПП наличие ВПС в семье и у родственников, уточнить течение беременности матери ребенка (как протекала, имели ли место инфекционные заболевания беременной, осложнения во время вынашивания плода и др.) для верификации диагноза [2 — 7].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Как правило, данный ВПС имеет скудную клиническую картину и часто протекает бессимптомно. Большинство ДМПП выявляются случайно при медицинских осмотрах или диагностических исследованиях (обзорная рентгенография, ультразвуковое исследование).

— При сборе жалоб при подозрении на ДМПП рекомендуется уточнить у родителей информацию об одышке, сердцебиении, утомляемости, возникающих у ребенка после физических нагрузок; плохой прибавке массы тела, частых инфекционных заболеваниях легких для верификации диагноза [2 — 5].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Одышка и сердцебиение являются наиболее частыми ранними симптомами заболевания при больших ДМПП у детей, но обычно в течение первых месяцев жизни происходят компенсация гемодинамики и регресс клинической картины. В дальнейшем у большей части детей ДМПП протекают асимптомно, пациенты жалоб не имеют. Явления недостаточности кровообращения незначительны и могут ограничиваться умеренно выраженной слабостью, потливостью ребенка, цианозом носогубного треугольника. Дети нередко имеют астеническое телосложение с заметной бледностью кожных покровов.

— При сборе жалоб и анамнеза при подозрении на ДМПП у взрослых пациентов рекомендуется выяснить информацию о нарушениях ритма сердца для верификации диагноза [2 — 5, 8].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Проявлениями ДМПП у взрослых, которым этот диагноз не был ранее поставлен, являются суправентрикулярные нарушения ритма: предсердные экстрасистолы, суправентрикулярная пароксизмальная тахикардия, трепетание или фибрилляция предсердий (их возникновение связывают с дилатацией предсердий и митральной регургитацией), а также парадоксальная эмболия [2, 3, 9 — 12]. Пациенты с небольшими дефектами (менее 8 — 10 мм) могут оставаться бессимптомными в течение четвертого и пятого десятилетий жизни, нередки случаи выявления порока у пациентов старше 70 лет, известно о четырех случаях выявления ДМПП у долгожителей [2, 3]. Причинами смерти пациентам с ДМПП являются пневмония, сердечная недостаточность или высокая легочная гипертензия.

2.2. Физикальное обследование

— Всем пациентам при подозрении на ДМПП рекомендуется выполнить аускультацию сердца для диагностики ВПС [2 — 5, 8].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Клиническая диагностика порока в обычных случаях достаточно проста и основывается на специфической аускультативной картине. При аускультации сердца выслушивается систолический шум во втором и третьем межреберьях слева от грудины, акцент второго тона в проекции легочной артерии. В случаях больших дефектов возможно наличие диастолических шумов над трехстворчатым клапаном и легочной артерией.

2.3. Лабораторная диагностика

— Если пациент с ДМПП поступил в профильный стационар для оперативного лечения порока рекомендуется определить группу крови и резус-фактор для подбора крови [2].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Рекомендуется всем пациентам выполнять общий анализ крови для определения исходного уровня гемоглобина и тромбоцитов перед оперативным вмешательством [2].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

2.4. Инструментальная диагностика

Диагноз ДМПП ставится на основании визуализирующих методов, которые демонстрируют сброс крови через дефект, признаки перегрузки объемом правого желудочка (ПЖ) и связанные с ними аномалии.

— Рекомендуется всем пациентам выполнение трансторакальной эхокардиографии (ЭхоКГ) с применением режима цветного допплеровского картирования, что является основным диагностическим инструментом в постановке диагноза ДМПП, определении его размера, локализации, объема и направления шунтирования крови [2 — 5].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Косвенными признаками ДМПП при ультразвуковой диагностике являются увеличение линейных и объемных размеров правого желудочка, появление трехстворчатой или легочной регургитации, парадоксальное движение межжелудочковой перегородки, возможно уменьшение объема левого желудочка.

— Выполнение магнитно-резонансной томографии (МРТ) для уточнения диагноза ДМПП рекомендуется в том случае, если результаты ЭхоКГ неубедительны [2, 3].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Катетеризация сердца с ангиографией рекомендуется для выявления сопутствующей ишемической болезни сердца у пациентов с возрастными или другими факторами риска [2, 3, 5].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: В настоящее время ангиокардиографическая диагностика ДМПП выполняется при наличии сопутствующих аномалий развития сердца, а также у пациентов с подозрением на легочную гипертензию. Диагностическое обследование пациента с подозрением на ДМПП направлено на определение размера и расположения ДМПП, функциональной оценки правого и левого желудочков и легочного кровообращения, а также сопутствующих пороков.

— Диагностическая катетеризация сердца не рекомендуется детям с неосложненным ДМПП, у которых результаты неинвазивных исследований не вызывают сомнений [2, 3].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

— Всем пациентам с подозрением на ДМПП рекомендуется выполнение рентгенографии органов грудной клетки для определения конфигурации сердца [2 — 5].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Рентгенография грудной клетки позволяет выявить увеличение ПЖ или правого предсердия (ПП), выбухание дуги легочной артерии и усиление легочного артериального рисунка, свидетельствующее о перегрузке правых отделов сердца.

— Всем пациентам с подозрением на ДМПП рекомендуется выполнить электрокардиографию (ЭКГ) для определения перегрузки правых отделов сердца, электрической оси сердца, оценки сердечного ритма и проводимости [2 — 5, 8, 12].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: На ЭКГ часто имеют место отклонение электрической оси сердца вправо, увеличение правого предсердия (ПП), неполная блокада правой ножки пучка Гиса или аномальная ось зубца P (дефект венозного синуса).

2.5. Иная диагностика

Клиническая диагностика ДМПП в обычных случаях достаточно проста и основывается на специфической аускультативной картине, данных ЭКГ и рентгенологическом исследовании.

— Дифференцировать порок рекомендуется со стенозом легочной артерии, открытым артериальным протоком с высокой легочной гипертензией, дефектом межжелудочковой перегородки [2 — 5].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

3. Лечение

3.1. Консервативное лечение

— Рекомендуется назначение диуретиков в возрастных дозировках пациентам, у которых течение порока сопровождается явлениями недостаточности кровообращения [2 — 5, 8].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Начальная разовая доза фуросемида** у детей определяется из расчета 1 — 2 мг/кг массы тела/сутки с возможным увеличением дозы до максимальной 6 мг/кг/сутки, при условии приема препарата не чаще, чем через 6 ч. Начальная доза фуросемида** для взрослых составляет 20 — 80 мг/сутки. Рекомендуется делить суточную дозу на 2 — 3 приема.

Пациенты с небольшими ДМПП и нормальным размером ПЖ обычно не имеют симптомов, и им не требуется медикаментозная терапия.

— У взрослой категории пациентов рекомендуется лечить суправентрикулярные аритмии назначением антиаритмических препаратов [2, 12, 14, 15].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Взрослой категории пациентов, у которых в результате некорригированного ДМПП развивается необратимая легочная гипертензия, рекомендуется назначение легочных вазодилататоров [16].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

3. 2. Хирургическое лечение

— Оперативное лечение при ДМПП рекомендуется пациентам при соотношении объемов кровотока по малому и большому кругам кровообращения (Qp/Qs) более 1,5 [2 — 4].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Ранняя смертность составляет примерно 1% при отсутствии легочной артериальной гипертензии или других серьезных сопутствующих заболеваний. Отдаленные результаты после операции хорошие. Необходимость повторного хирургического вмешательства по поводу рецидива ДМПП возникает редко. ДМПП без признаков перегрузки объемом ПЖ не влияют на продолжительность жизни человека и, поэтому, никакого закрытия не требуется, если только не наблюдается парадоксальная эмболия. При более крупных дефектах с признаками перегрузки объемом ПЖ (по данным ЭхоКГ) симптомы развиваются на третьей декаде жизни пациента, поэтому закрытие таких дефектов предпочтительно в раннем детском возрасте для профилактики отдаленных осложнений, таких как: снижение толерантности к физической нагрузке, недостаточность трехстворчатого клапана, суправентрикулярные аритмии и сброс крови справа налево.

— Хирургическое лечение ДМПП рекомендуется выполнять в возрасте 1 — 2 года жизни ребенка [2 — 5].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Хирургическое лечение неосложненных ДМПП не рекомендуется детям в возрасте менее 6 месяцев [2 — 5, 8].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Лечение дефекта венозного синуса рекомендуется пациентам проводить хирургическим, а не чрескожным путем [2, 3, 13, 16].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

— Хирургическое закрытие вторичного ДМПП рекомендуется пациентам, если рассматривается сопутствующая хирургическая реконструкция/протезирование трехстворчатого клапана или если анатомия дефекта исключает чрескожный способ [2, 17, 18].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

— Хирургическое закрытие (в т.ч. эндоваскулярно) ДМПП рекомендуется пациентам при наличии парадоксальной эмболии [2, 3, 9 — 11].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Пациентам с тяжелой необратимой легочной гипертензией без признаков сброса крови слева направо не рекомендуется выполнять закрытие ДМПП [3].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Чрескожное закрытие ДМПП рекомендуется при увеличении у пациентов ПЖ и ПП, при наличии симптомов или без таковых [19, 20].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

Комментарии: В настоящее время большинство вторичных ДМПП с подходящей морфологией могут быть закрыты с помощью чрескожного катетерного метода [2, 3, 19, 20]. Если эта процедура технически невыполнима или не подходит пациенту, то рекомендуется выполнение стандартного открытого хирургического вмешательства.

— Катетерное вмешательство не рекомендуется у детей до 3-х лет [2, 3, 18 — 20].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

Комментарии: в силу несоответствия размеров сосудов и доставляющих систем.

3.3. Иное лечение

Обезболивающая терапия у детей

— Рекомендуется пациентам для премедикации, с целью седации и обеспечения эмоциональной стабильности перед транспортировкой в операционную, применять опиаты и/или бензодиазепины в возрастных дозировках [21 — 23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Дети до 6 месяцев в премедикации не нуждаются. Дети от 6 месяцев до 3 лет: мидазолам** или диазепам** в/м, либо в/в в возрастных дозировках. Дети старше 3 лет: тримепередин** и/или мидазолам**, либо диазепам** в/м, в/в в возрастных дозировках.

— Рекомендуется пациентам для индукции в наркоз и поддержания анестезии использовать: фентанил**, пропофол**, бензодиазепины, натрия оксибутират**, фторсодержащие газовые анестетики в возрастных дозировках. Предпочтительным является проведение комбинированной анестезии с применением галогенсодержащих газовых анестетиков на всех этапах хирургического вмешательства, включая искусственное кровообращение [21 — 23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для индукции и поддержания анестезии у детей:

Индукция: Дети до 1 месяца: мидазолам**/натрия оксибутират** и фентанил** в/в в возрастных дозировках. Дети старше 1 месяца: мидазолам**/натрия оксибутират**/пропофол** и фентанил** — в/в в возрастных дозировках. Во всех возрастных группах возможно проведение индукции севофлураном** (как моноиндукции, так и в комбинации с в/в введением фентанила**).

Поддержание анестезии: Дети до 1 месяца: мидазолам**/натрия оксибутират** и фентанил** в/в в возрастных дозировках. Дети старше 1 месяца: мидазолам**/натрия оксибутират**/пропофол** и фентанил** в/в в возрастных дозировках. Во всех возрастных группах возможно применение галогенсодержащих газовых анестетиков в комбинации с фентанилом**. При превышении дозировок (применении дозировок, превышающих указанные в инструкции к препарату) необходимо решение врачебной комиссии.

— Рекомендуется пациентам для обезболивания в раннем послеоперационном периоде использовать опиаты и нестероидные противовоспалительные препараты в возрастных дозировках [21 — 23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для обезболивания в послеоперационном периоде:

Первые сутки после операции — тримепередин** в/м каждые 6 — 8 часов, либо в/в инфузия морфина** в возрастных дозировках, далее НПВП. При сохранении выраженного болевого синдрома тримеперидин**/морфин** в возрастных дозировках по показаниям. При превышении дозировок (применении дозировок, превышающих указанные в инструкции к препарату) необходимо решение врачебной комиссии. При сохранении выраженного болевого синдрома тримеперидин**/морфин** в возрастных дозировках по показаниям.

Обезболивающая терапия у взрослых

— Рекомендуется пациентам для премедикации с целью седации и обеспечения эмоциональной стабильности вечером накануне операции с целью уменьшения эмоционального стресса назначить транквилизаторы и нейролептики. Для премедикации перед подачей пациента в операционную с целью седации и обеспечения эмоциональной стабильности применяются опиаты и/или бензодиазепины [22, 23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Вечером накануне операции: бензодиазепины (Бромдигидрохлорфенилбензодиазепин**, лоразепам), атипичные нейролептики (тиоридазин**, сульпирид**) в индивидуальных дозировках. Перед подачей в операционную в/м тримепередин** и/или диазепам**/мидазолам**.

— Рекомендуется пациентам для индукции в наркоз использовать: фентанил**, пропофол**, бензодиазепины, для поддержания анестезии — фентанил**, пропофол**, бензодиазепины, фторсодержащие газовые анестетики. Предпочтение необходимо отдавать проведению комбинированной анестезии с применением галогенсодержащих газовых анестетиков на всех этапах хирургического вмешательства, включая искусственное кровообращение [22, 23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для индукции и поддержания анестезии:

Индукция: мидазолам**/диазепам**/пропофол** и фентанил** в/в в расчетных дозировках.

Поддержание анестезии: мидазолам**/диазепам**/пропофол** и фентанил** — в/в в расчетных дозировках. Возможно применение галогенсодержащих газовых анестетиков в комбинации с фентанилом**. При превышении дозировок (применении дозировок, превышающих указанные в инструкции к препарату) необходимо решение врачебной комиссии.

— Рекомендуется пациентам для обезболивания в раннем послеоперационном периоде использовать опиаты и НПВП в возрастных дозировках [22, 23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для обезболивания в послеоперационном периоде:

Первые сутки после операции — тримепередин**, либо морфин** в/м каждые 4 — 8 часов, далее НПВП. При наличии специальных дозаторов эффективно применение пациент-контролируемой анальгезии фентанилом**. При сохранении выраженного болевого синдрома тримепередин**/морфин**/фентанил** по показаниям.

4. Реабилитация

— В течение 3 месяцев после операции всем пациентам рекомендуется пройти восстановительное лечение в условиях санатория кардиологического профиля или реабилитационного центра [24].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Рекомендуется ограничить всем пациентам физическую нагрузку в течение полугода с момента выписки из стационара [24].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Большинство программ кардиологической реабилитации длятся от трех до шести месяцев.

— При развитии у пациентов в послеоперационном периоде посткардиотомного синдрома рекомендуется немедленное выполнение ЭхоКГ с целью исключения этого осложнения [2, 3, 5, 8].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Ранние послеоперационные симптомы, такие как повышение температуры, утомляемость, рвота, боль в груди или абдоминальная боль, могут означать посткардиотомный синдром с тампонадой сердца, которые могут возникнуть через несколько недель после хирургического закрытия ДМПП, и их необходимо оценить клинически и с помощью ЭхоКГ до выписки и в течение месяца после выписки пациента. Пациенты, их родители и врачи первичного звена должны быть проинструктированы о том, что необходимо сообщать о температуре или необычных симптомах (грудной или абдоминальной боли, рвоте, непривычной утомляемости) в первые недели после операции, так как эти симптомы могут представлять ранние признаки сердечной тампонады.

5. Профилактика

— Рекомендуется детям первого года жизни диспансерное наблюдение у врача-кардиолога в первом полугодии после оперативного вмешательства 2 раза в месяц, во втором — ежемесячно; на втором году жизни 2 раза в год, далее ребенок наблюдается не реже 1 раза в 2 года [24].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Один раз в квартал необходимо выполнение ЭКГ, два раза в год проводится ЭхоКГ и один раз в год — рентгенография грудной клетки (во фронтальной и боковой проекциях).

— Ежегодный клинический осмотр у кардиолога рекомендуется пациентам после операции, если ДМПП был закрыт, а остались или появились следующие состояния [2, 3, 8, 12, 17]:

1. Легочная артериальная гипертензия.

2. Суправентрикулярная аритмия.

3. Правожелудочковая или левожелудочковая дисфункция.

4. Сопутствующие пороки или другие заболевания сердца.

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

Комментарии: Клиническое обследование и ЭКГ по поводу рецидивирующей или вновь появившейся аритмии является важной частью послеоперационного обследования.

— При наблюдении пациентов после транскатетерного закрытия ДМПП рекомендуется клиническая оценка возможных приступов аритмии, болей в груди или симптомов эмболии, а также ЭхоКГ-исследования положения окклюдера, резидуального сброса (шунта), осложнений, таких как: тромбоз или перикардиальный выпот [18 — 20].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

Комментарии: Обычно ЭхоКГ выполняют через 24 ч после операции, перед выпиской из стационара, в 1 мес., 6 мес. и 1 год с последующими обследованиями на регулярной основе.

6. Дополнительная информация, влияющая на течение и исход заболевания

Нет.

7. Организация медицинской помощи

Показания для плановой госпитализации:

1. наличие симптомов недостаточности кровообращения;

2. наличие суправентрикулярных нарушений ритма сердца;

3. плановое оперативное лечение.

Показания для экстренной госпитализации:

1. ухудшение функционального статуса пациента в связи с прогрессированием симптомов недостаточности кровообращения;

2. наличие парадоксальной эмболии системных сосудов, в том числе мозга.

Показания к выписке пациента из стационара:

1. отсутствие сброса на межпредсердной перегородке после хирургической коррекции порока;

2. отсутствие симптомов недостаточности кровообращения.

Критерии оценки качества медицинской помощи

N

Критерии качества

Уровень достоверности доказательств

Уровень убедительности рекомендаций

Этап постановки диагноза

1

Выполнен сбор анамнеза и жалоб пациента

4

C

2

Выполнена аускультация сердца

4

C

3

Выполнена эхокардиография с применением режима цветного допплеровского картирования

4

C

Этап консервативного и хирургического лечения

1

Назначены диуретики

4

C

2

Выполнено оперативное вмешательство по устранению дефекта межпредсердной перегородки

4

C

Этап послеоперационного контроля

1

Выполнена эхокардиография перед выпиской из стационара

3

C

2

Пациент направлен на реабилитацию

4

C

Список литературы

1. Hoffman JIE, Kaplan S. The incidence of congenital heart disease. J Am CollCardiol. 2002; 39: 1890 — 900.

2. Kouchoukos N.T., Blackstone E.H., Hanley F.L., Kirklin J.K. Kirklin/Barratt-Boyes cardiac surgery: morphology, diagnostic criteria, natural history, techniques, results, and indications. — 4th ed. Philadelphia: Elsevier; 2013.

3. Купряшов А.А. Дефект межпредсердной перегородки. Частичный аномальный дренаж легочных вен. В кн.: Бокерия Л.А., Шаталов К.В. (ред.). Детская кардиохирургия. Руководство для врачей. ФГБУ «НМИЦССХ им. А.Н. Бакулева» МЗ РФ, 2016, с. 294 — 312.

4. Шарыкин А.С. Врожденные пороки сердца. Руководство для педиатров, кардиологов, неонатологов. М.: Теремок; 2005.

5. Бураковский В.И., Бокерия Л.А. // Сердечно-сосудистая хирургия // М., 1996.

6. Benson DW, Sharkey A, Fatkin D, et al. Reduced penetrance, variable expressivity, and genetic heterogeneity of familial atrial septal defects. Circulation. 1998; 97: 2043 — 8.

7. Basson CT, Bachinsky DR, Lin RC, et al. Mutations in human TBX5 [corrected] cause limb and cardiac malformation in Holt-Oram syndrome. Nat Genet. 1997; 15: 30 — 5.

8. Fuster V, Brandenburg RO, McGoon DC, Giuliani ER. Clinical approach and management of congenital heart disease in the adolescent and adult. CardiovascClin. 1980; 10: 161 — 97.

9. Loscalzo J. Paradoxical embolism: clinical presentation, diagnostic strategies, and therapeutic options. Am Heart J. 1986; 112: 141 — 5.

10. Ward R, Jones D, Haponik EF. Paradoxical embolism. An underrecognized problem. Chest. 1995; 108: 549 — 58.

11. Silka MJ, Rice MJ. Paradoxic embolism due to altered hemodynamic sequencing following transvenous pacing. Pacing ClinElectrophysiol. 1991; 14: 499 — 503.

12. Prystowsky EN, Benson DW Jr, Fuster V, et al. Management of patients with atrial fibrillation. A statement for healthcare professionals. From the Subcommittee on Electrocardiography and Electrophysiology, American Heart Association. Circulation. 1996; 93: 1262 — 77.

13. Konstantinides S, Geibel A, Olschewski M, et al. A comparison of surgical and medical therapy for atrial septal defect in adults. NEnglJMed. 1995; 333: 469 — 73.

14. Клинические рекомендации: Наджелудочковые нарушения ритма сердца у взрослых. http://cr.rosminzdrav.ru/#!/schema/242#doc_abbreviation (дата обращения 18.06.2019).

15. Клинические рекомендации: Фибрилляция и трепетание предсердий у взрослых. http://cr.rosminzdrav.ru/#!/schema/888#doc_a1 (дата обращения 18.06.2019).

16. Клинические рекомендации: Легочная гипертензия. http://cr.rosminzdrav.ru/#!/schema/136 (дата обращения 18.06.2019).

17. Helber U, Baumann R, Seboldt H, Reinhard U, Hoffmeister HM. Atrial septal defect in adults: cardiopulmonary exercise capacity before and 4 months and 10 years after defect closure. J Am CollCardiol. 1997; 29: 1345 — 50.

18. Du Z.D., Hijazi Z.M., Kleinman C.S., Silverman N.H., Larntz K. Comparison between transcatheter and surgical closure of secundum atrial septal defect in children and adults: results of a multicenter nonrandomized trial. J. Am. Coll. Cardiol. 2002; 39: 1836 — 44.

19. Fischer G, Stieh J, Uebing A, Hoffmann U, Morf G, Kramer HH. Experience with transcatheter closure of secundum atrial septal defects using the Amplatzer septal occluder: a single centre study in 236 consecutive patients. Heart. 2003; 89: 199 — 204.

20. Dhillon R, Thanopoulos B, Tsaousis G, Triposkiadis F, Kyriakidis M, Redington A. Transcatheter closure of atrial septal defects in adults with the Amplatzer septal occluder. Heart. 1999; 82: 559 — 62.

21. Рыбка М.М., Хинчагов Д.Я., Мумладзе К.В., Лобачева Г.В., Ведерникова Л.В. Под ред. Л.А. Бокерия. Протоколы анестезиологического обеспечения кардиохирургических операций, выполняемых у новорожденных и детей. Методические рекомендации. М.: НЦССХ им. А.Н. Бакулева РАМН; 2014.

22. Рыбка М.М., Хинчагов Д.Я. Под ред. Л.А. Бокерия. Протоколы анестезиологического обеспечения кардиохирургических операций, выполняемых при ишемической болезни сердца, патологии клапанного аппарата, нарушениях ритма, гипертрофической кардиомиопатии, аневризмах восходящего отдела аорты у пациентов различных возрастных групп. Методические рекомендации. М.: НЦССХ им. А.Н. Бакулева РАМН; 2015.

23. Рыбка М.М., Хинчагов Д.Я., Мумладзе К.В., Никулкина Е.С. Под ред. Л.А. Бокерия. Протоколы анестезиологического обеспечения рентгенэндоваскулярных и диагностических процедур, выполняемых у кардиохирургических пациентов различных возрастных групп. Методические рекомендации. М: НЦССХ им. А.Н. Бакулева РАМН; 2018.

24. Подзолков В.П., Кассирский Г.И. (ред.). Реабилитация больных после хирургического лечения врожденных пороков сердца. М.: НЦССХ им. А.Н. Бакулева; 2015.

25. Фальковский Г.Э., Крупянко С.М. Сердце ребенка: книга для родителей о врожденных пороках сердца. — М.: Никея, 2011.

26.



Приложение А1

СОСТАВ РАБОЧЕЙ ГРУППЫ

1. Бокерия Л.А., академик РАН (Москва), Ассоциация сердечно-сосудистых хирургов России

2. Свободов А.А., д.м.н. (Москва)

3. Арнаутова И.В., д.м.н. (Москва)

4. Белов В.Н., д.м.н. (Калининград)

5. Борисков М.В. , д.м.н. (Краснодар)

6. Волков С.С., к.м.н. (Москва)

7. Горбатиков К.В., д.м.н. (Тюмень)

8. Горбатых Ю.Н., д.м.н. (Новосибирск)

9. Горбачевский С.В., проф. (Москва)

10. Гущин Д.К. (Москва)

11. Ермоленко М.Л., д.м.н. (Москва)

12. Зеленикин М.А., проф. (Москва), Ассоциация сердечно-сосудистых хирургов России

13. Зеленикин М.М., проф. (Москва), Ассоциация сердечно-сосудистых хирургов России

14. Ким А.И., проф. (Москва)

15. Кокшенев И.В., проф. (Москва)

16. Кривощеков Е.В., д.м.н. (Томск)

17. Крупянко С.М., д.м.н. (Москва)

18. Купряшов А.А., д.м.н (Москва)

19. Мовсесян Р.Р., д.м.н. (С-Петербург), Ассоциация сердечно-сосудистых хирургов России

20. Никифоров А.Б. (Москва)

21. Петрушенко А.В., к.м.н. (Казань)

22. Плотников М.В., к.м.н. (Астрахань)

23. Подзолков В.П. академик РАН (Москва)

24. Сабиров Б.Н., д.м.н. (Москва)

25. Синельников Ю.А., д.м.н. (Пермь)

26. Сокольская Н. О. д.м.н., (Москва)

27. Туманян М.Р., проф. (Москва)

28. Шаталов К.В., д.м.н. (Москва)

29. Шмальц А.А., д.м.н. (Москва)

30. Черногривов А.Е., д.м.н. (Пенза), Ассоциация сердечно-сосудистых хирургов России

Конфликт интересов отсутствует.

Все члены Рабочей группы подтвердили отсутствие финансовой поддержки/конфликта интересов, о которых необходимо сообщить.



Приложение А2

МЕТОДОЛОГИЯ РАЗРАБОТКИ КЛИНИЧЕСКИХ РЕКОМЕНДАЦИЙ

Целевая аудитория разработанных клинических рекомендаций:

1. Врач-педиатр

2. Врач-кардиолог

3. Врач-детский кардиолог

4. Врач-сердечно-сосудистый хирург

5. Врач-хирург

6. Врач ультразвуковой диагностики

Таблица П1. Уровни убедительности рекомендаций

Уровень убедительности

Основание рекомендации

A

Основана на клинических исследованиях хорошего качества, по своей тематике непосредственно применимых к данной специфической рекомендации, включающих по меньшей мере одно РКИ

B

Основана на результатах клинических исследований хорошего дизайна, но без рандомизации

C

Составлена при отсутствии клинических исследований хорошего качества, непосредственно применимых к данной рекомендации

Таблица П2. Уровни достоверности доказательности

Уровень достоверности

Тип данных

1a

Метаанализ рандомизированных контролируемых исследований (РКИ)

1b

Хотя бы одно РКИ

2a

Хотя бы одно хорошо выполненное контролируемое исследование без рандомизации

2b

Хотя бы одно хорошо выполненное квазиэкспериментальное исследование

3

Хорошо выполненные не экспериментальные исследования: сравнительные, корреляционные или «случай-контроль»

4

Экспертное консенсусное мнение либо клинический опыт признанного авторитета

Порядок обновления клинических рекомендаций.

Механизм обновления клинических рекомендаций предусматривает их систематическую актуализацию — не реже чем один раз в три года или при появлении новой информации о тактике ведения пациентов с данным заболеванием. Решение об обновлении принимает МЗ РФ на основе предложений, представленных медицинскими некоммерческими профессиональными организациями. Сформированные предложения должны учитывать результаты комплексной оценки лекарственных препаратов, медицинских изделий, а также результаты клинической апробации.



Приложение А3

СВЯЗАННЫЕ ДОКУМЕНТЫ

1. Об основах охраны здоровья граждан в Российской Федерации (ФЗ N 323 от 21.11.2011)

2. Порядок оказания медицинской помощи больным с сердечно-сосудистыми заболеваниями (Приказ Минздрава России N 918н от 15.11.2012)

3. «О классификации и критериях, используемых при осуществлении медико-социальной экспертизы граждан федеральными государственными учреждениями медико-социальной экспертизы» (Приказ Минздрава России N 1024н от 17 декабря 2015 г.).



Приложение Б

АЛГОРИТМЫ ВЕДЕНИЯ ПАЦИЕНТА

Алгоритм ведения пациентов с ДМПП



Приложение В

ИНФОРМАЦИЯ ДЛЯ ПАЦИЕНТОВ

Дефекты межпредсердной перегородки — второй по частоте врожденный порок сердца. При этом пороке имеется отверстие в перегородке, разделяющей правое и левое предсердие на две отдельные камеры. Истинные дефекты межпредсердной перегородки могут быть очень больших размеров. Они располагаются в разных отделах самой перегородки, и тогда говорят о «центральном дефекте» или «дефекте без верхнего или нижнего края», «первичном» или «вторичном».

При существовании отверстия в перегородке возникает шунт со сбросом крови слева направо. При ДМПП кровь из левого предсердия частично уходит в правое при каждом сокращении. Соответственно правые камеры сердца переполняются, т.к. им приходится пропускать через себя, лишний объем крови, да еще один раз прошедший через легкие. Поэтому легочные сосуды переполнены кровью. Отсюда склонность к пневмониям. Давление, однако, в предсердиях низкое, а правое предсердие — самая «растяжимая» камера сердца. Поэтому оно, увеличиваясь в размерах, справляется с нагрузкой до поры до времени достаточно легко.

Новорожденные и грудные дети, да и дети раннего возраста в подавляющем большинстве растут и развиваются абсолютно нормально. Родители могут замечать их склонность к частым простудам, иногда заканчивающихся воспалением легких, что должно насторожить. Часто эти дети растут бледными, худенькими и несколько отличаются от своих здоровых сверстников.

Жалобы на сердце могут и, как правило, появляются в отроческом возрасте, и нередко — после 20 лет. Обычно это жалобы на «перебои» сердечного ритма, который человек ощущает. Со временем они становятся чаще, а иногда приводят к тому, что пациент становится уже неспособным к нормальным, обычным физическим нагрузкам. Чтобы избежать подобного «естественного» течения порока, рекомендуют отверстие закрывать хирургическим путем. Операция по поводу ДМПП проводится в условиях искусственного кровообращения, на открытом сердце, и заключается в ушивании отверстия или закрытия его заплатой.

Сегодня, кроме хирургической операции, в некоторых случаях можно безопасно закрыть дефект с помощью рентгенохирургической техники. Вместо ушивания дефекта или вшивания заплаты, его закрывают специальным устройством в виде зонтика — окклюдером, который проводят по катетеру в сложенном виде, и раскрывают, пройдя через дефект. Закрытие дефекта таким «безоперационным» методом далеко не всегда возможно и требует определенных условий: анатомического расположения отверстия, достаточный возраст ребенка и др.

Сегодня оба способа широко применяются с отличными результатами. В любом случае вмешательство носит не срочный характер. Но нужно делать его в раннем детстве, если частота простуд, и особенно пневмоний, становится устрашающей и угрожает бронхиальной астмой, а размеры сердца увеличиваются. Вообще, чем раньше будет сделана операция, тем быстрее ребенок и вы о ней забудете.



Приложение Г

Нет

Что означает открытое овальное окно, в чем состоит особенность аномалии и к какому коду по МКБ 10 относится

Открытое овальное окно – это сердечная особенность строения, которая отнесена по классификации МКБ 10 к коду дефекта перегородки, оделяющей предсердия. Оно присутствует у всех малышей в момент рождения и с их ростом закрывается по причине ненадобности. Но существуют причины, в результате которых окно не исчезает и влечет развитие последствий.

В чем заключается аномалия

Открытое овальное окно является дефектом сердечной перегородки

В процессе развития внутри утробы матери у плода уже на 3 недели начинает формироваться сердце. К концу 6 недели оно уже соучаствует в функции кровоснабжения.

Кровоток плода имеет свои особенности. В этот период движение крови происходит без участия легких. Организм матери обеспечивает поступление кислорода и выведение углекислого газа.

Кровоток проходит по следующему направлению:

  1. Боталлов проход (от сердца к аорте)
  2. Овальное окно (из предсердия правой части в левое)

С момента рождения у малыша развивается функция дыхания с участием легких и налаживается естественный ход крови. Конструкция сердца изменяется – проход и окно закрываются по их ненадобности.

После достижения годовалого возраста вместо овального окна образуется перегородка, отделяющая предсердия. Это изменение может продолжаться большее время. По некоторым факторам щель остается. Если она диагностируется в 1-2 года, то ее относят к группе малых аномалий сердечного развития. У взрослых пациентов патология выявляется в основном случайно.

Под открытым овальным окном подразумевают отверстие в перегородке, отделяющей предсердия. Ее величина измеряется в нескольких миллиметрах. Сквозь щель иногда может проходить кровь из предсердия одной части сердца в другое. Часто она не имеет определенных признаков и не изменяет качество жизни.

Овальное окно нельзя назвать врожденным видом порока или дефектом перегородки. Это скорее особенности развития организма.

Факторы аномалии

К появлению открытого овального окна в сердце может привести курение матери во время беременности

Точной причины не закрытия овального окна до настоящего момента не выяснено. Одним из главных факторов считается наследственная предрасположенность.

Специалисты также выделяют несколько причин, которые относятся к периоду вынашивания плода и могут привести к появлению такой аномалии:

  • Курение
  • Дефицит питательных элементов и витаминов в рационе
  • Отравление лекарственными средствами
  • Злоупотребление алкоголем
  • Наркомания
  • Сильные стрессовые переживания
  • Проживание в экологически неблагоприятном районе
  • Преждевременные роды
  • Недоношенность малыша
  • Врожденные сердечные пороки

Очень много женщин ведут губительный образ жизни и при наступлении беременности не предпринимают никаких мер по его изменению. Последствия этого для ребенка ими даже не обдумываются.

Учеными было выявлено, что эта щель может присутствовать и у человека взрослого возраста, у которого имеются сердечные пороки. Среди них можно отметить порок аортального, митрального или трикуспидального клапана.

Группы риска

Плохой уровень питания женщины во время беременности является фактором риска появления открытого овального окна в сердце у ребенка

Окно остается открытым по многим причинам. Помимо генетической наследственности выделяют факторы, способствующие открытию щели:

  • Физическая активность с большой нагрузкой, это относится к тяжелоатлетам, дайвингистам или спортсменам силового спорта
  • Тромбоэмболия артерии легких, чаще у пациентов с закупоркой сосудов нижних конечностей
  • Зависимость от вредных привычек в период вынашивания плода
  • Плохой уровень питания женщины во время ожидания малыша
  • Тяжелые отравления токсинами в период беременности
  • Роды раньше срока
  • Низкий иммунитет женщины
  • Вредная окружающая экологическая обстановка

Возможные признаки

Шумы в сердце у ребенка могут указывать на наличие открытого овального окна

Признаки открытого окна практически незаметны. У взрослых пациентов патология диагностируется при обследовании организма по поводу других жалоб.

При длине окна в 2-3 мм сбоев в работе сердца и кровотоке не возникает. Пациент хорошо себя чувствует.

Осложнения могут возникать при длине более 4 мм. Признаки аномалии различаются в зависимости от возрастной категории пациента.

Симптомы у детей:

Если патология не выявлена в детском возрасте, она остается пожизненно. Взрослый пациент может долгое время даже не подозревать о своей особенности сердца.

Признаки схожи с детскими, могут проявляться в малой степени и напоминать собой другие патологии.

Признаки у взрослых:

  • Синева треугольника между губами и носом после физических действий или при простудах
  • Частые возникновения обмороков
  • Нарушен кровоток в мозгу
  • Варикоз или тромбофлебит
  • Приступы одышки
  • Частые простуды
  • Приступы тахикардии
  • Мигрени
  • Тяжелое состояние после физической активности
  • Увеличенное количество крови в легких
  • Онемение конечностей

Стадии

Параметры овального окна определяют требуется ли пациенту хирургическое вмешательство

Открытое овальное окно относят к дефектам развития сердца. Стадии аномалии различаются по степени повреждения органа и силе проявления признаков.

Аномалия входит в группу МАРС-синдрома (малых синдромов развития сердца). Местом ее расположения являются предсердия.

Любая стадия развития аномалии служит результатом дисплазии соединительной ткани. Параметры окна и роль в кровотоке определяют тяжесть аномалии.

Разновидности

Овальное окно служит естественным способом приспособления организма к окружающим условиям. Оно присутствует абсолютно у каждого малыша после рождения. По определенным причинам окно может не исчезать и оставаться открытым.

В зависимости от длины окна выделяют следующие формы аномалии:

  1. Параметры щели от 2 до 3 мм считаются нормой развития малыша и не влечет осложнений или последствий для здоровья
  2. Параметры щели от 5 до 7 мм могут не иметь явных проявлений и не угрожать здоровью, небольшие осложнения могут проявляться после активных физических действий
  3. Параметры щели более 7 мм уже представляют собой большую дыру, которая нарушает кровоток и требует вмешательства хирургического характера

В зависимости от степени участия окна в процессе кровотока можно выделит такие его формы:

  1. Щель без перетока крови не влечет перемещение крови через перегородку предсердий и не влияет на функционирование сердца
  2. Щель со сбросом с левой стороны способствует перетеканию крови через перегородку, что приводит к возрастанию давления в предсердии правой стороны сердца
  3. Окно со сбросом с правой стороны приводит к обратному перетоку крови, что вызывает аналогичный рост давления в левой части
  4. Окно с проявлением бидиректорального шунтирования может грозить развитием эмболии парадоксальной формы, которая формируется при физической активности и проявляется в тромбозе и газообразовании, которые попадают с кровотоком в головной мозг

Сложность патологии определяется в каждом случае индивидуально исходя из возраста пациента, характера его жизнедеятельности и силы проявления признаков.

Диагностика

УЗИ сердца является одним из методов диагностики открытого овального окна

Открытое овальное окно очень сложно выявить при первоначальной консультации у врача. Эта аномалия может вообще протекать бессимптомно и не служить поводом для похода в больницу. Чаще всего ее выявляют случайно при обследовании пациента по поводу других заболеваний.

Методами диагностирования служат:

  1. Сбор анамнеза – установление наследственных факторов, вредных привычек, образа жизни и т.д.
  2. Визуальный осмотр – измерение давления, осмотр кожных покровов, прослушивание ритма сердца и т.д.
  3. Лабораторное обследование организма – общий и биохимический анализ крови, анализ мочи и т.д.

Аппаратная диагностика

Важную роль в выявлении открытого овального окна служит диагностика с использованием специальных аппаратов. Она дает возможность оценить размер аномалии, ее степень влияния на кровоток и работу сердца, а также определить риск развития последствий.

Методы обследования:

Самым информативным является обследование эхокардиографии. Оно проводится через пищевод. Эта процедура дает возможность зафиксировать саму щель, ее параметры, объем пропускаемой через него крови и соотнести с дефектами перегородки между предсердиями.

Только после полного обследования врач может поставить точный диагноз и определить код по МКБ 10. Это дает ему возможность назначить правильное лечение.

Как лечится

В случае хорошего самочувствия при данной аномалии одним из способов поддержания здоровья является полноценное питание

Терапия при выявлении данной аномалии назначается в зависимости от силы проявления признаков патологии и общего состояния здоровья пациента. Среди важных условий при назначении терапии можно выделить:

  • Параметры окна
  • Количество перетекаемой крови при физической активности
  • Особенности конструкции перегородки
  • Степень увеличения предсердий
  • Давление в артерии легких
  • Сопутствующие заболевания

В случае малой длины щели и отсутствия явных признаков влияния аномалии на самочувствие человека врач назначает общие рекомендации по поддержанию здоровья.

Среди таких мер имеются:

  • Правильное и полноценное питание
  • Оптимальный распорядок дня и отдыха
  • Снижение физической активности
  • Физиотерапия
  • Санаторное лечение
  • Пребывание на улице и вдыхание свежего воздуха
  • Контроль за состоянием здоровья

В случае проявления незначительных признаков ухудшения работы сердца или сосудов, назначается следующее лечение:

  • Употребление витаминных комплексов
  • Применение лекарственных средств, которые укрепляют сердечные мышцы
  • Прием медикаментозных препаратов, которые разжижают кровь и уменьшают формирование тромбов

При сильных проявлениях признаков щели большого размера и возникновении болезненных ощущений требуется не только лечение лекарственными препаратами, но и хирургические методы.

Хирургические процедуры бывают трех видов:

  1. Наложение специальных заплаток, которые вводятся при помощи эндоваскулярного метода и способствуют заращению окна соединительной ткань. По истечении месяца данные пластыри самостоятельно рассасываются.
  2. Наложение шва, при помощи которого скрывается щель. Такой метод применяется и при других особенностях строения перегородки.
  3. Применение окклюдера, который имеет вид зонта или сеточки. Он вводится через артерию на бедре при помощи катетера и устанавливается на входе в левое предсердие. Изготавливается он из безопасного и биологического материала, через полгода он полностью срастается с сердечными тканями.

Какой специалист занимается лечением

Первоначальная консультация проводится у врача терапевта. Он проводит осмотр, сбор анамнеза и назначает общие анализы и некоторые обследования.

После возникновения подозрения на аномалию окна терапевт направляет пациента на консультацию кардиолога. Этот специалист, в свою очередь, также проводит первоначальный осмотр и назначает более детальное обследование.

Когда поставлен диагноз и определена степень и форма аномалии кардиолог назначает лечение. При больших параметрах щели требуется хирургическое лечение.

Для дальнейшего обследования и лечения пациента направляют к кардиохирургу. Данный специалист оценивает состояние окна, его размер и влияние на кровоток. Исходя из полученных данных, врач подбирает метод лечения и проводит операцию.

Какие могут быть осложнения

Если отсутствует лечении при ухудшении состояния, то возможно осложнение в виде сбоя сердечного ритма

Самостоятельно аномалия окна не может угрожать здоровью человека и способствовать развитию осложнений. Но под влиянием некоторых факторов состояние может ухудшаться.

Отсутствие необходимого лечения и профилактических мер могут вызвать такие последствия:

Данные осложнения проявляются достаточно редко. Но не стоит усугублять состояние и отказываться от лечения.

Профилактика

Отказ от вредных привычек поможет избежать осложнений данной аномалии

Особых указаний по лечению окна нет. Профилактика направлена на поддержание здоровья человека и снижение вероятности возникновения осложнений.

Меры профилактики:

  1. Исключение вредных привычек
  2. Полноценное питание, которое восполнит в организме все важные питательные вещества
  3. Достаточное время на сон и отдых
  4. Избежание чрезмерных физических нагрузок
  5. Своевременная терапия возникающих заболеваний
  6. Периодические консультации и осмотры у лечащего врача

Важную роль играет профилактика в период беременности. Женщине, которая вынашивает ребенка или еще только планирует, следует придерживаться таких рекомендаций:

  1. Избегать патологий инфекционного характера
  2. Избегать взаимодействия с химическими препаратами
  3. Принимать медикаментозные средства только по предписанию врача
  4. Правильно питаться
  5. Исключить вредные привычки

Эти меры помогут снизить риск аномалии развития сердца.

Прогноз

Чаще всего при диагностировании овального окна прогнозные обещания для пациента являются благоприятными. Своевременное лечение, развитие хирургии или соблюдение назначений врача по ведению образа жизни помогают избежать риска развития осложнений и нормализовать работу сердца.

Отсутствие своевременного диагностирования или лечения делают прогнозы, скорее всего, печальными. Большие параметры щели приводят к появлению серьезных последствий, которые могут привести к смертельному исходу.

Смотрите видео об открытом овальном окне:

Открытое овальное окно не является приговором. При своевременном диагностировании и проведении необходимого курса лечения можно полностью снизить риск возникновения осложнений. Профилактика играет большую роль в период беременности и развития плода, а также для уменьшения негативного влияния окна на кровоток.

Заметили ошибку? Выделите ее и нажмите Ctrl+Enter, чтобы сообщить нам.

Определение открытого овального окна по МКБ 10

Описание патологии

Овальное окно – это крайне специфическое образование, которое помогает сердцу плода прокачивать кровь по кровеносным сосудам его тела. Однако к концу внутриутробного развития со стороны левого предсердия формируется маленький клапан, который жизненно необходим для закрытия овального окна. В случае если процесс развития ребенка идет нормально, в момент первого крика, расправляющего легкие, увеличивается давление на левую половину сердца. Под действием повышающего давления клапан закрывается и перестает функционировать. В дальнейшем створки клапана полностью срастаются и крепко фиксируются на межпредсердную перегородку. Отверстие полностью исчезает в первые полгода жизни ребенка.

Однако в случае, если в период внутриутробного развития клапан не созревает в полной мере, после рождения ребенка он не способен полностью закрыть имеющееся отверстие. В то же время процесс заращивания даже в этом случае постепенно продолжается и на месте овального окна может остаться очень маленькое незакрытое пространство.

Как правило, подобный порок развития клапана овального окна наблюдается у детей, матери которых в период беременности:

  • неправильно питались;
  • курили;
  • принимали наркотики;
  • переживали стрессы;
  • употребляли токсичные лекарственные препараты.

Спровоцировать патологию могут врожденные пороки сердца у плода, плохая экология, а также имеющиеся хронические заболевания у матери. В некоторых случаях открытое овальное окно наблюдается у малышей, которые появились на свет значительно раньше срока. Далеко не всегда можно определить точные причины развития подобной патологии у ребенка.

Существующая классификация

По МКБ 10 существует огромное количество пороков. Одних только рубрик в этом классификаторе насчитывается более сотни. Условно их делят на “белые” и “синие”.

Белые ВПС – без смешивания артериальной и венозной крови. Есть 4 группы таких болезней:

  1. 1. Дефекты междупредсердной и межжелудочковых перегородок (обогащение малого круга).
  2. 2. Дефекты, отличающиеся “обеднением” малого круга кровообращения (например, пульмональный стеноз изолированный).
  3. 3. Обеднение большого круга кровообращение (например, стеноз аортальный или коарктация).
  4. 4. Без нарушения гемодинамики.

При “синих” ВПС наблюдается смешивание артериальной и венозной крови. Существует 2 группы пороков:

  1. 1. Обогащение малого круга кровообращения (например, транспозиция магистральных сосудов).
  2. 2. Обеднение малого круга кровообращения (например, тетрада Фалло).

Каждое заболевание имеет свой код, благодаря которому можно легко определить его.

Код по МКБ 10 врожденных пороков сердца: симптомы, диагностика, лечение

Аномалии развития сердца малые — описание, диагностика, лечение.

Исключен: эндокардиальный фиброэластоз (I42.4)

Исключены:

  • декстрокардия с локализационной инверсией (Q89.3)
  • изомерия ушка предсердия (с аспленией или полиспленией) (Q20.6)
  • зеркально отраженное расположение предсердий с локализационной инверсией (Q89.3)

https://www.youtube.com/watch?v=v4r85UdwypE

Расположение сердца в левой половине грудной клетки с верхушкой, направленной влево, но с транспозицией других внутренних органов (situs viscerum inversus) и пороками сердца, или исправленной транспозицией магистральных сосудов.

Врожденная коронарная (артериальная) аневризма

Неправильное положение сердца

Врожденная:

  • аномалия сердца БДУ
  • болезнь сердца БДУ

В России Международная классификация болезней 10-го пересмотра (МКБ-10) принята как единый нормативный документ для учета заболеваемости, причин обращений населения в медицинские учреждения всех ведомств, причин смерти.

МКБ-10 внедрена в практику здравоохранения на всей территории РФ в 1999 году приказом Минздрава России от 27.05.97г. №170

Выход в свет нового пересмотра (МКБ-11) планируется ВОЗ в 2017 2018 году.

С изменениями и дополнениями ВОЗ гг.

Малые аномалии развития сердца (МАРС) — анатомические врождённые изменения сердца и магистральных сосудов, не приводящие к грубым нарушениям функций ССС. Ряд МАРС имеет нестабильный характер и с возрастом исчезает.

Этиология

Наследственно детерминированная соединительнотканная дисплазия. Ряд МАРС имеют дизэмбриогенетический характер. Не исключается воздействие различных экологических факторов (химическое, физическое воздействие).

Код по международной классификации болезней МКБ-10:

    Q20. 9 — Врожденная аномалия сердечных камер и соединений неуточненная

Малые аномалии развития сердца (МАРС) — анатомические врождённые изменения сердца и магистральных сосудов, не приводящие к грубым нарушениям функций ССС. Ряд МАРС имеет нестабильный характер и с возрастом исчезает. Частота — 2,2–10% в популяции, у детей с различной сердечной патологией — 10–25%, увеличивается при наследственных заболеваниях соединительной ткани.

Варианты. В литературе описано около 40 вариантов МАРС. Наиболее часто наблюдают • Эктопические трабекулы • Пролапс митрального клапана • Пролапс трикуспидального клапана • Открытое овальное окно • Длинный евстахиев клапан (заслонка) — нерудиментированная складка эндокарда (элемент эмбрионального кровообращения), расположенная в устье нижней полой вены со стороны полости правого предсердия, длиной от 1 до 2 см.

Обычно случайно находят при ЭхоКГ • Аневризма межпредсердной перегородки — выпячивание межпредсердной перегородки в области овальной ямки, не вызывающее гемодинамических нарушений. Клинически при аускультации — систолические щелчки • Аневризма межжелудочковой перегородки — выбухание межжелудочковой перегородки в сторону правого желудочка.

При аускультации — систолический шум и клики слева у основания грудины • Дилатация корня аорты и синусов Вальсальвы — расширение устья аорты (у детей в норме — 1,2–2,4 см) и синусов (в норме глубина — 1,5–3 мм). Аускультативно — непостоянные систолические «щелчки», иногда шум «волчка» на сосудах шеи.

Сопутствующая патология • Синдром Марфана • Синдром Элерса–Данло–Русакова • Первичный гипогонадизм • Синдром Бехчета • Врождённые пороки сердца (ВПС) • Аритмии сердца • Инфекционный эндокардит • Клапанная регургитация.

Термин «малые аномалии развития сердца» (МАРС) был предложен Ю.М.Белозеровым (1993 г.) и С.Ф.Гнусаевым (1995 г.). Согласно данному этими авторами определению под МАРС понимают анатомические изменения архитектоники сердца и магистральных сосудов, не приводящие к грубым нарушениям функций сердечно-сосудистой системы и выраженным изменениям гемодинамики.

МАРС у детей – достаточно распространенное состояние. По данным разных авторов, МАРС встречаются от 2,2 до 10% случаев, у детей с патологией сердечно-сосудистой системы – в 10–25% случаев (до 68,9% в зависимости от контингента обследуемых). Частое выявление МАРС в последние годы связано с широким использованием эхокардиографии с хорошим разрешением. Обнаружение МАРС у ребенка ставит перед педиатром целый ряд вопросов, касающихся тактики его ведения и объема дальнейшего обследования.

Наиболее широко в настоящее время используется классификация МАРС, предложенная С.Ф.Гнусаевым (2001 г. с изменениями).

• предсердия и межпредсердная перегородка: пролабирующий клапан нижней полой вены, увеличенный евстахиев клапан (складка эндокарда, которая расположена в устье нижней полой вены, открывающемся в полость правого предсердия) более

10 мм, открытое овальное окно (без значимого сброса крови), небольшая аневризма межпредсердной перегородки, пролабирующие гребенчатые мышцы в правом предсердии;

• трикуспидальный клапан (ТК): смещение септальной створки в полость правого желудочка в пределах 10 мм, дилатация правого атриовентрикулярного отверстия, пролапс ТК;

• легочная артерия: дилатация ствола легочной артерии, пролапс створок клапана легочной артерии;

• аорта: погранично узкий и широкий корень аорты, дилатация синусов Вальсальвы, двустворчатый клапан аорты, асимметрия и пролапс створок клапана аорты;

• левый желудочек (ЛЖ): аномально расположенные трабекулы и/или хорды (поперечная, продольная, диагональная), небольшая аневризма межжелудочковой перегородки, деформация выносящего тракта желудочка с систолическим валиком в верхней трети межжелудочковой перегородки;

• митральный клапан (МК): пролапс МК, эктопическое крепление или нарушенное распределение хорд передней и (или) задней створки, дополнительные и аномально расположенные папиллярные мышцы.

2. Осложнения и сопутствующие изменения: инфекционный кардит, кальцификация, миксоматоз, фиброзирование створок клапанов, разрывы хорд, нарушения сердечного ритма.

3. Характеристика гемодинамики: регургитация, ее степень, наличие недостаточности кровообращения, легочной гипертензии.

По Международной классификации болезней 10-го пересмотра (МКБ-10) МАРС шифруют кодом Q20.9 («Врожденная аномалия сердечных камер и соединений неуточненная»). Некоторые МАРС имеют самостоятельные коды по МКБ-10, например, пролапс МК шифруют кодом I34.1.

Появление МАРС может быть связано с нарушением эмбриогенеза на различных сроках беременности. Сбор анамнеза у матерей детей с МАРС показал, что в 76,1% случаев имело место неблагоприятное течение беременности, в 79,5% случаев были указания на патологическое протекание родов, у 11,4% детей в перинатальном периоде были отмечены признаки повреждения центральной нервной системы (родовая травма, асфиксия) [2].

Ряд МАРС по мере роста ребенка претерпевает обратное развитие. Например, с возрастом может уменьшиться степень пролапса МК, уменьшиться увеличенный евстахиев клапан, нормализоваться диаметр магистральных сосудов, может закрыться овальное окно. У ряда пациентов МАРС могут прогрессировать, например, может увеличиться степень пролапса МК, может увеличиться толщина его створок [3].

Некоторые исследователи отмечают, что МАРС могут ассоциироваться с повышенным риском развития органических заболеваний сердца. В основе развития ряда кардиомиопатий лежит наследственно обусловленный ранний апоптоз кардиомиоцитов. Аналогичный процесс может являться одной из причин прогрессирующего пролабирования клапанов сердца [4].

Клиническое значение МАРС зависит от их количества и от степени их выраженности. По мнению С.Ф.Гнусаева, наличие у ребенка более 3 МАРС свидетельствует о неблагополучии его здоровья [5]. Чаще отклонения в состоянии здоровья выявляются у детей, у которых МАРС сочетаются с другими признаками ДСТ, в частности с поражением опорно-двигательного аппарата и дисплазией кожи [6].

Часто ДСТ сочетаются с вегетососудистой дистонией (ВСД), причем чем более выражены признаки ДСТ, тем сильнее проявления нарушения регуляции вегетативной нервной системы [8]. Дети с МАРС часто предъявляют жалобы на повышенную утомляемость, нарушение сна, головные боли, неприятные ощущения в области сердца, перебои в сердце, приступы сердцебиения, ощущение нехватки воздуха, обморочные состояния, плохую переносимость транспорта, желудочно-кишечный дискомфорт.

Существует точка зрения, что у больных ВСД всегда имеются какие-либо органические изменения, которые могут быть минимально выражены и в повседневной врачебной практике не диагностируются. Поэтому ряд авторов относят ВСД к функционально-структурным заболеваниям сердца. Детям с симптомами ВСД обязательно следует проводить эхокардиографическое исследование для исключения МАРС. У детей с МАРС и симптомами ВСД чаще выявляются нарушения ритма сердца, чем у детей, больных ВСД и не имеющих МАРС [9].

Считается, что желудочковые нарушения ритма и СРРЖ у пациентов с аномально расположенными хордами и трабекулами возникают из-за того, что импульс проходит по «дополнительным» проводящим путям, роль которых выполняют аномально расположенные хорды и трабекулы (при гистологическом исследовании в них были выявлены проводящие кардиомиоциты), приводит к преждевременному возбуждению прилежащей к нему части желудочка, в последующем формируется его более ранняя реполяризация [12]. По мнению E.

Порок сердца — открытое овальное окно

Открытое овальное окно в сердце (ООО) – щель в стенке, образовавшаяся между правым и левым предсердием. В норме такая открытая щель функционирует в период эмбрионального развития и полностью зарастает в течение первого года жизни ребенка. Если этого не произошло, речь начинает вестись об аномалии, которой в МКБ 10 присвоен код Q21.1.

Со стороны левого предсердия отверстие прикрывается маленьким клапаном, полностью созревающим ко времени родов. Когда происходит первый крик малыша, появившегося на свет, и раскрылись легкие, произошло значительное нарастание давления в левом предсердии, под действием которого клапан полностью закрывает овальное окно. С течением времени клапан крепко прирастает к стенке межпредсердной перегородки, так щель между предсердиями закрывается.

Чаще всего у половины детей такое прирастание клапана происходит в течение первого года жизни. Это норма. Но если размер клапана недостаточный, щель может закрыться не до конца, то есть останется какое-то отверстие, размеры которого определяется в миллиметрах. Из-за этого предсердия не изолируются друг от друга. Тогда ребенку выставляется диагноз открытого окна, который по-другому называется МАРС-синдромом.

Кардиологи классифицируют его как малую аномалию сердечного развития.

Но часто бывает так, что о такой аномалии становится известно случайно. Для взрослого человека это может оказаться неожиданностью. Они пугаются, думая, что это серьезный порок и их жизни скоро придет конец. Некоторые молодые люди считают, что из-за этого их не пустят в армию. Есть ли причины для таких беспокойств? Чтобы понять это, нужно разобраться в причинах, симптомах и других факторах, связанных с ООО.

Причины врожденных пороков сердца

Классификация врождённых пороков сердца выделяет наследственные и ненаследственные причины их возникновения.

К ненаследственным факторам относятся различные внешние отрицательные воздействия, а также факторы, напрямую относящиеся к состоянию здоровья матери.  Однако часто бывает, что в формировании ВПС участвуют обе эти группы факторов одновременно.

Кроме того, врожденные пороки могут сочетаться с другими дефектами развития – например, аномалиями лицевого скелета, внутренних органов, рук и ног, нарушениями развития и роста плода.

Дополнительным фактором риска развития врожденного порока сердца (код по МКБ-10 – Q20-Q26) является недоношенность. Так, среди новорожденных с диагностированными пороками сердца доля недоношенных детей превышает долю здоровых младенцев в два раза.

Риск ВПС гораздо выше у младенцев, появившихся на свет в результате спонтанных преждевременных родов. Этот риск высок, в первую очередь, в отношении сердечных аномалий, после исключения хромосомных патологий и множественных дефектов внутриутробного развития.

Скорее всего, это связано с воздействием различных тератогенных факторов, основную роль среди которых играют внутриутробные инфекции, которые считаются также одной из главных причин начала преждевременной родовой деятельности.  

Итак, открытое овальное окно – отверстие, измеряемое в миллиметрах, которое образуется между предсердиями. Через него кровь может поступать из одного предсердия в другое. Чаще всего она поступает из левого предсердия в правое. Это связано с тем, что давление в полости левого предсердия выше. Когда ставится диагноз, зачастую ставится такая формулировка: ООО с лево-правым сбросом.

Но ООО – это не дефект межпредсердной перегородки, хотя в соответствии с МКБ 10 код им присвоен один. Дефект – это более серьезная патология. МАРС-синдром – это не врожденный порок сердца и не дефект перегородки. И отличия не только в строении и развитии сердца, но и в причинах, симптомах, лечении и прочих факторах.

Причины такого состояния овального окна не всегда бывают точно известны. Есть мнение, что к такому состоянию может привести наследственная предрасположенность. Конечно, с этим фактором вряд ли что-то можно поделать. Но есть и другие причины, которые во многом зависят от женщины, которая носит в себе новую жизнь, особенное значение приобретает их наличие именно в период ношения в утробе ребенка:

  • курение;
  • неполноценное питание;
  • токсические отравления лекарственными препаратами;
  • алкоголизм и наркомания;
  • стрессы.

К сожалению, сегодня все больше женщин начинают вести плохой образ жизни и продолжают это делать даже в период беременности. При этом они совсем не думают о том, что пострадает их малыш. Открытое овальное окно – это лишь одно последствие, которое можно назвать не очень серьезным по сравнению с другими, которые могут быть, например, пороком сердца.

Открытое овальное окно может развиться из-за плохой экологической обстановки

ООО может развиться и по другим причинам: плохая экологическая обстановка, врожденный порок сердца, соединительная дисплазия, недоношенность ребенка. Если эти причины имеют место в то время, когда женщина забеременела, нужно быть готовыми к последствиям, которые касаются развития малыша или органов его организма.

Замечено, что МАРС-синдром часто проявляется при других пороках сердечного развития. К ним относится открытый аортальный порок, а также врожденный порок митрального и трикуспидального клапанов.

Открытию окна могут способствовать еще несколько факторов:

  • очень сильные физические нагрузки, что особенно касается спортсменов, которые занимаются тяжелой атлетикой, дайвингом, силовым спортом;
  • проявления тромбоэмболии легочной артерии тех пациентов, у которых есть тромбофлебит нижних конечностей и малого таза.

Q24.9 Врожденный порок сердца неуточненный

Несмотря на то, что аномалия часто выявляется у взрослых при обследовании по поводу других состояний, лучше всего сделать это раньше, ведь могут быть выявлены и другие проблемы с сердцем. Благодаря выявленным симптомам взрослый человек или родители ребенка могут вовремя обратиться за медицинской помощью, пройти обследование, после которого будет поставлен диагноз: ООО с лево-правым сбросом, а также будет отмечен код в соответствии с МКБ 10.

Кстати, всем детям до года назначается УЗИ сердца, которое и позволяет выявить ООО. Если же размеры дефекта более трех мм, скорее всего, будут наблюдаться некоторые признаки, позволяющие сделать определенные выводы:

  • цианоз носогубного треугольника или губ у ребенка, когда он сильно плачет, кричит;
  • частые заболевания простудного характера, бронхиты, легочные воспаления;
  • замедления психологического или физического развития, что может говорить даже о том, что овальное окно открыто даже на два или три мм;
  • приступы потери сознания;
  • быстрая утомляемость;
  • ощущение нехватки воздуха.

Последние признаки наблюдаются тогда, когда размеры аномалии превышают показатели в три мм. Если врач подозревает, что ООО присутствует у ребенка, он направляет его на обследование у опытного кардиолога, на УЗИ. Так уточняются размеры дефекта, выясняется, превышают они три мм. Все это позволяет понять, есть ли причины для беспокойства. Кстати, размер открытого окна может достигать и 19 мм.

Цианоз носогубного треугольника может свидетельствовать об открытом овальном окне размером более трех мм

Специфических симптомов у взрослых практически нет. Человек может жаловаться на сильные боли в области головы. Предварительный диагноз в соответствии с МКБ 10 можно поставить на основании практически таких же признаков, которые были перечислены выше. Также может наблюдаться нарушение подвижности частей тела, периодическое онемение конечностей.

Важно понимать, что открытое овальное окно – это не приговор! Сердце по-прежнему хорошо функционирующее, конечно, все зависит от того, какие присутствуют сопутствующие заболевания, пороки сердца и так далее, но само по себе ООО не несет очень серьезной опасности, хотя последствия могут быть очень неприятными, но об этом будет сказано позже. Чтобы поставить диагноз ООО с лево-правым сбросом, обозначить код по МКБ 10, необходимо провести обследование.

Q20.9 Врожденная аномалия сердечных камер и соединений неуточненная

Диагностические критерии:

  • Анамнестические данные (профессиональные вредности, алкоголизм матери в период беременности, заболевания соединительной ткани в семье и др.)
  • Признаки диспластического развития (внешние малые аномалии развития — короткая шея, высокое нёбо и др.)
  • Характерная аускультативная картина в зависимости от варианта МАРС
  • Изменения на ЭКГ
  • ЭхоКГ — критерии
  • Рентгенологические критерии.

Дифференциальная диагностика:

  • ВПС
  • Большие аномалии развития сердца.

Функциональная значимость:

  • Зависит от возраста пациента, варианта МАРС, наличия сопутствующих заболеваний
  • Маркёр дизэмбриогенетического развития сердца
  • Предрасполагают к развитию аритмий, клапанной регургитации, левожелудочковой дисфункции.

Лечение определяют вариант МАРС и сопутствующая патология.

Сокращение. МАРС — малые аномалии развития сердца

  • Q24.0 Декстрокардия
  • Q24.1 Левокардия
  • Q24.2 Трехпредсердное сердце
  • Q24.3 Воронкообразный стеноз клапана легочной артерии
  • Q24.4 Врожденный субаортальный стеноз

Информация размещенная на сайте носит исключительно справочный характер и не является официальной.

Классификация ВПС по классам тяжести (J. Kirklin et al. 1981) • I класс. Можно провести плановую операцию позднее 6 мес: ДМЖП, ДМПП, радикальная коррекция при тетраде Фалло • II класс. Плановую операцию можно провести в сроки 3–6 мес: радикальная коррекция при ДМЖП, открытый атриовентрикулярный канал (ОАВК), паллиативная коррекция при ТФ • III класс.

Плановую операцию можно провести в сроки до нескольких недель: радикальная коррекция при транспозиции магистральных сосудов (ТМС) • IV класс. Экстренная операция с максимальным сроком подготовки в несколько суток: радикальная коррекция при тотальном аномальном дренаже лёгочных вен (ТАДЛВ), паллиативная коррекция при ТМС, ДМЖП, ОАВК • V класс. Операцию проводят неотложно в связи с кардиогенным шоком: различные варианты пороков в стадии декомпенсации.

тетрада Фалло, болезни миокарда и др. • 3 группа. Неблагоприятный прогноз (смертность в течение первого года жизни составляет 36–52%): ТМС, коарктация и стеноз аорты, атрезия трёхстворчатого клапана, ТАДЛВ, единственный желудочек сердца, ОАВК, отхождение аорты и лёгочной артерии от правого желудочка и др. • 4 группа.

Классификация ВПС по возможности радикальной коррекции (Turley K. et al. 1980) • 1 группа. Пороки, при которых возможна только радикальная коррекция: стеноз аорты, стеноз лёгочной артерии, ТАДЛВ, трёхпредсердное сердце, коарктация аорты, открытый артериальный проток, дефект аортолёгочной перегородки, ДМПП, стеноз или недостаточность митрального клапана • 2 группа.

Сокращения • ОАВК — открытый атриовентрикулярный канал • ТМС — транспозиция магистральных сосудов • ТАДЛВ — тотальный аномальный дренаж лёгочных вен.

МКБ-10 • Q20 Врождённые аномалии [пороки развития] сердечных камер и соединений • Q21 Врождённые аномалии [пороки развития] сердечной перегородки • Q22 Врождённые аномалии [пороки развития] лёгочного и трехстворчатого клапанов • Q23 Врождённые аномалии [пороки развития] аортального и митрального клапанов • Q24 Другие врождённые аномалии [пороки развития] сердца.

Симптомы ВПС (код по МКБ-10 — Q20-Q26), которые требуют неотложного врачебного вмешательства:

  • синюшный, серый или бледный оттенок кожи;
  • отсутствие или резкое ослабление пульса;
  • снижение артериального давления на ногах на 10 мм рт.ст и больше по сравнению с правой рукой;
  • снижение сатурации или насыщение крови кислородом на правой руке выше на 5% и более по сравнению с ногой;
  • одышка – более 60 в минуту;
  • ЧСС более 180 или менее 100 ударов в минуту, сердечная аритмия;
  • гепатомегалия;
  • олигурия у новорожденных;
  • шумы в сердце (наименее специфический симптом).

Критерии оценки качества медпомощи при удвоении выхода из правого желудочка

Критерии оценки качества медицинской помощи при единственном желудочке сердца

Критерии оценки качества медицинской помощи больным с тетрадой Фалло

Оценка качества медпомощи при атрезии легочной артерии с дефектом межжелудочковой перегородки

Осложнения

Возможны следующие осложнения ВПС (код по МКБ-10 — Q20-Q26):

  1. Задержка роста и развития, трудности в учебной деятельности.
  2. Аритмии.
  3. Хроническая сердечная недостаточность.
  4. Инфаркт, инсульт.
  5. Эндокардит, миокардит – бактериальные поражения сердца.
  6. Эмоциональные проблемы, депрессивные расстройства.

Часто врожденные пороки сердца требует пожизненного наблюдения у врача-кардиолога, а также особого отношения к своему здоровью и лечению любых сопутствующих болезней.

Конечно, вероятность и формы осложнений зависит от многих факторов. Но важно понимать, что осложнения возникают редко. По сути, могут развиться такие заболевания:

  • почечный инфаркт;
  • инсульт;
  • инфаркт миокарда;
  • транзиторное нарушение кровообращения мозга.

При выявлении открытого овального окна необходимо регулярно наблюдаться у кардиолога и проводить УЗИ сердца

Это происходит из-за того, что развивается парадоксальная эмболия. Если говорить о прогнозах, то в большинстве случаев все благоприятно. Тем, у кого выявлено ООО в соответствии с МКБ 10, нужно регулярно наблюдаться у кардиолога и проводить УЗИ сердца. Необходимо отказаться от видов спорта, из-за которых организм постоянно подвергается очень сильным физическим нагрузкам.

Каждой женщине, которая планирует родить ребенка или уже забеременела, важно помнить, что она может предотвратить развитие аномалии сердца у своего будущего ребенка. Нельзя курить, пить, принимать наркотики и делать все, что может хоть как-то сказаться на здоровье плода в утробе малыша.

В итоге можно сказать, что ООО – это аномалия, которая сама по себе не несет очень серьезной опасности, если речь не идет о том, что есть сопутствующий порок или другой серьезный дефект. Все зависит от разных факторов. Но здоровье каждого человека очень часто в его руках! Каждый день нужно думать о здоровье, своем и своих близких!

Из-за отсутствия возможности выявить причины МАРС у детей специфических мер профилактики аномалий в медицинской практике не создано.

Данный нюанс не означает, что патологи нельзя предотвратить. При соблюдении некоторых правил риск их развития можно в значительной степени снизить.

Профилактические меры должны осуществляться не только в отношении ребенка, но и во время вынашивания плода, а также на этапе планирования беременности.

Неспецифическая профилактика МАРС включает в себя следующие рекомендации:

  1. На этапе планирования беременности необходимо пройти комплексное обследование и вылечить все имеющиеся заболевания.
  2. При вынашивании плода необходимо исключить воздействие негативных факторов на мать и будущего ребенка, отказаться от вредных привычек и соблюдать режим дня для беременных.
  3. Питание ребенка с первых дней его жизни должно быть полноценным и сбалансированным.
  4. При наличии подозрений на отклонения в работе сердечно-сосудистой системы, следует незамедлительно пройти обследование.
  5. Заболевания любой этиологии у ребенка должны лечиться своевременно и полноценно.

Малые аномалии развития сердца не относятся к числу смертельно опасных заболеваний, но относиться к данному виду патологии легкомысленно не стоит.

В любом случае МАРС являются нарушениями состояния сердечно-сосудистой системы.

Если вовремя не определить степень развития патологии пренебречь терапией, то осложнения могут стать причиной серьезных последствий.

Информация на сайте предоставлена исключительно в ознакомительных целях и не является руководством к действию. Не занимайтесь самолечением. Проконсультируйтесь со своим лечащим врачом.

Общие сведения

Варианты. В литературе описано около 40 вариантов МАРС. Наиболее часто наблюдают:

  • Эктопические трабекулы
  • Пролапс митрального клапана
  • Пролапс трикуспидального клапана
  • Открытое овальное окно
  • Длинный евстахиев клапан (заслонка) — нерудиментированная складка эндокарда (элемент эмбрионального кровообращения), расположенная в устье нижней полой вены со стороны полости правого предсердия, длиной от 1 до 2 см. Обычно случайно находят при ЭхоКГ
  • Аневризма межпредсердной перегородки — выпячивание межпредсердной перегородки в области овальной ямки, не вызывающее гемодинамических нарушений. Клинически при аускультации — систолические щелчки
  • Аневризма межжелудочковой перегородки — выбухание межжелудочковой перегородки в сторону правого желудочка. При аускультации — систолический шум и клики слева у основания грудины
  • Дилатация корня аорты и синусов Вальсальвы — расширение устья аорты (у детей в норме — 1,2–2,4 см) и синусов (в норме глубина — 1,5–3 мм). Аускультативно — непостоянные систолические «щелчки», иногда шум «волчка» на сосудах шеи.

https://www.youtube.com/watch?v=D2GxQqq53B8

Сопутствующая патология:

  • Синдром Марфана
  • Синдром Элерса–Данло–Русакова
  • Первичный гипогонадизм
  • Синдром Бехчета
  • Врождённые пороки сердца (ВПС)
  • Аритмии сердца
  • Инфекционный эндокардит
  • Клапанная регургитация.

Russian Journal of Forensic MedicineRussian Journal of Forensic Medicine2411-87292409-4161Association of Forensic Medical Experts33110.19048/fm331Original ArticleMidgut agenesia (clinical and forensic medical aspects): a rare case reportMaltsevAlexey E.<p>Dr. Sci. (Med.), Prof., Head of the KRBFM «Kirov Regional Bureau of Forensic Medicine»</p>[email protected]://orcid.org/0000-0001-7756-6959RazinMaxim P.<p>Dr. Sci. (Med.), Prof.</p>[email protected]://orcid.org/0000-0003-3561-3256SkobelevValentin A.<p>PhD</p>[email protected] ruhttps://orcid.org/0000-0002-9272-9055SchukhinaAnna Y.<p>Postgraduate student of the Department of Pediatric Surgery</p>[email protected]://orcid.org/0000-0002-2009-9998Kirov Regional Bureau of Forensic MedicineFederal State Budgetary Educational Institution of Higher Education «Kirov State Medical University» of the Ministry of Healthcare of the Russian Federation151220206454581510202004122020Copyright © 2021, Maltsev A.E., Razin M.P., Skobelev V.A., Schukhina A.Y.2021<p><strong>Background:</strong> Congenital obstruction of the gastrointestinal tract in the form of complete atresia occurs in newborns in 60% of all cases of obstruction of the digestive tract, while agenesis of the derivative of the midgut is a rather rare defect.</p>
<p><strong>Case presentation:</strong> After birth, the child in this case was repeatedly operated on for congenital intestinal obstruction. Most of the jejunum, ileum, cecum, ascending, right half of the transverse colon were absent in the child, and an anastomosis was performed between the jejunum and transversum. In the postoperative period, it was not possible to cope with the intestinal and protein -energy deficiency and the child exerted at home. The section has confirmed clinical diagnoses.</p>
<p><strong>Conclusion:</strong> The authors draw attention to the possibility of resorption of the extraperitoneally located intestine at the end of the first period of intrauterine rotation with a possible vascular and/or ischemic disaster.</p>midgut agenesisgastroschisisnewbornssurgeryexpert caseагенезия производных средней кишкигастрошизисноворождённыеоперативное лечениеэкспертный случай1.Morozov DA, Filippov YuV, Gorodkov SYu, et al. Surgery for congenital small bowel obstruction. Russian journal of pediatric surgery, anesthesia and intensive care. 2011;(2):21–29. (In Russ.)2.Kucherov YuI, Kulakov VI, Zhirkova YuV, et al. Family case of colon atresia. Russian journal of Pediatric surgery. 2006;(5): 50–51. (In Russ.)3.Razin MP, Zheleznov LM. To the question of teratogenesis of gastroschisis. Russian journal of Pediatric surgery. 2018;22(6): 321–322. (In Russ.) doi: 10.18821/1560-9510-2018-22-6-321-3224.Tsap NA, Besaliev BN. A modern view of gastroschisis: from the antenatal period to the outcome of treatment (literature review). литературы). Russian journal of pediatric surgery, anesthesia and intensive care. 2011;(2):45–62. (In Russ.)5.Feldkamp ML, Botto LD, Byrne JL, et al. Clinical presentation and survival in a population-based cohort of infants with gastroschisis in Utah, 1997–2011. Am J Med Gen Part A. 2016; 170(2):306.6.Kozlov YuA, Novozhilov VA, Koval’kov KA, et al. Congenital abdominal wall defects. N.I. Pirogov Journal of Surgery. 2016;(5):74–81. (In Russ.)7.Islam S. Gastroschisis. Fundamentals of Pediatric Surgery: Springer, Cham; 2017. Р. 569–574.

Многорожавшая код по МКБ 10

>Асгм код по мкб 10

Как гипертоническая болезнь классифицируется по коду мкб 10

Многие годы безуспешно боретесь с ГИПЕРТОНИЕЙ?

Глава Института: «Вы будете поражены, насколько просто можно вылечить гипертонию принимая каждый день…

Для людей, далеких от медицины, словосочетание гипертоническая болезнь код по мкб 10 ни о чем не говорит. Даже если человек сам страдает этим грозным заболеванием. Многие понимают, что речь идет о повышенном давлении, но причем тут код со странной аббревиатурой мкб и почему он с цифрой 10 для них остается загадкой.

Все довольно просто — у каждого заболевания есть свой код в особом классификаторе болезней. Для различных проявлений гипертонии в этом списке отведено сразу несколько кодов, а непонятное мкб простая и понятная вещь.

Коды заболеваний по мкб

Несмотря на различия в оказании медицинских услуг разных стран существует единая международная классификация болезней. Она содержит внушительный список различных заболеваний, принятый на международном уровне.

Процедурой создания таких классификаторов занимается Всемирная организация здравоохранения уже на протяжении многих лет. Полное название этого документа (мкб) более подробное — «Международная статистическая классификация болезней и проблем, связанных со здоровьем».

Все заболевания разделены на 21 класс в зависимости от систем организма, групп заболеваний и состояний человека. Каждый класс имеет свои буквенные и цифровые значения, соответствующие конкретному заболеванию. В одном коде содержится 1 буква и 2 цифры, указывающие на заболевание, а третья цифра носит лишь уточняющий диагноз.

ВОЗ стала курировать медицинскую классификацию болезней в 1948 году после 6 пересмотра. Сейчас действует мкб десятого пересмотра, именно поэтому она обозначена цифрой 10. Эта версия классификации появилась в результате длительного международного сотрудничества путем поиска удобных для всех компромиссов. Согласие сторон необходимо для достижения целей мкб.

Цели классификации болезней

На данный момент у единого классификатора заболеваний и проблем со здоровьем всего две цели — сбор статистики и облегчение работы с данными. Мкб обеспечивает единые методические подходы к статистическим данным по заболеваниям и дает возможность сопоставлять международные данные.

Благодаря этому нормативному документу, во всем мире стали появляться условия для сравнительного анализа статистических данных о болезнях и смертности, происходящих в различное время во множестве стран. Появление кодов существенно облегчило эту задачу, теперь нет необходимости писать полное название заболевания, а достаточно указать соответствующий ему шифр.

Международный классификатор позволяет определять эпидемиологическую ситуацию, распространенность определенных заболеваний, в том числе и частоту резко «помолодевшей» гипертонии.

Артериальная гипертония код по мкб 10 описывает не одно общее заболевание, шифр может отличаться из-за понятия органов-мишеней, повреждающихся при этом заболевании.

Органы-мишени при гипертонической болезни

Артериальная гипертензия очень распространенное сердечно-сосудистое заболевание и частота ее проявлений увеличивается с возрастом. В некоторых странах и регионах процент пожилого населения достигает 65, а у молодых людей порядка 20.

Несмотря на то, что с возрастом частота возрастает, но гипертоническая болезнь код по мкб не меняет для молодежи и пожилых лиц. Это касается всех типов заболевания — гипертензия способна выводить из строя различные органы, а уже для каждого такого вида есть собственный код.

При гипертонии часто назначают бета-блокаторы.

Применение Фозиноприла требует соблюдения инструкции.

О других таблетках от гипертонии читайте здесь.

При гипертонии часто поражаются следующие органы:

  • Глаза;
  • Почки;
  • Сердце;
  • Головной мозг.

В каждом из органов под влияние повышенного давления может происходить множество процессов — все это связано с работой сосудов, подвергающихся негативному воздействию гипертонии в первую очередь.

Место гипертонии в международной классификации болезни

По данным ВОЗ гипертензия находится в IX классе, собравшим в себе болезни системы кровообращения. Гипертоническая болезнь код мкб 10 в зависимости от вида обозначается шифром от I10 до I15, не включая I14. За исключением I10 каждый шифр имеет уточняющую третью цифру конкретного диагноза.

Хотя о конкретике говорить не совсем корректно — существует и не уточнённые виды артериальной гипертензии. Чаще всего это гипертония с преимущественным одновременным поражением почек и сердца. Также есть и вторичная неуточнённая гипертензивная болезнь.

Коды мкб 10 для различных видов артериальной гипертензии

Гипертоническая болезнь шифр мкб 10, обозначаемая I11, включающая в себя I11.0 и I11.9 обозначает заболевания с преимущественным поражением сердца. В эту подгруппу не входят сочетания поражения сердца и почек они принадлежат к кодам I13 и имеют 4 внутренних шифра — I13.0, I13.1, I13.2 и I13.9

Коды I12 предназначены для гипертонии с поражением почек. Международная классификация выделяет гипертензию с развитием почечной недостаточности на фоне повышенного давления (I12.0). Под кодом I12.9 указывается гипертония с поражение почек без развития недостаточности их функций.

За цифро-буквенными обозначениями I15.0, I15.1, I15.2, I15.8, I15.9 скрываются различные вариации вторичной гипертензивной болезни. Для первичной гипертонии отведен код I10. Гипертонические кризы обычно отмечают именно так.

Полную статью про симптомы и оказание первой помощи при гипертоническом кризе читайте здесь.

Гипертонический криз по мкб

Гипертонический криз по коду мкб 10 относится к эссенциальной гипертензии, хотя резкий скачек давления, угрожающий жизни, может произойти и при вторичной проявлениях заболевания. Код I10 иногда меняют на другие шифры гипертензивных заболеваний после уточнения диагноза. Довольно часто это происходит с гипертонией, поражающей одновременно сердце и почки.

В России еще нет законодательно закрепленного классифицирования гипертонических кризов. В США и ряде других стран криз у гипертоников делят на два типа:

  • Осложненный;
  • Неосложненный.

Первый из них требует срочной госпитализации вне зависимости от кода по мкб 10. Второй купируется на дому с последующим лечением в стационаре. И эти данные тоже можно подвергать статистической обработке.

Применение статистических данных по кодам мкб

Во многих странах существуют свои статистические центры, обрабатывающие различные данные. Благодаря наличию классификаций болезней можно определить распространенность конкретного заболевания в определенном регионе или целой стране. Это позволяет быстро собрать все данные о любой болезни — гипертония по мкб 10 занимает несколько различных кодов, а не 20-25 определений с наименованием уточненных заболеваний.

Проанализированные данные позволяют министерствам разных стран правильно реагировать на всплеск конкретного заболевания.

Создаются дополнительные обследования для выявления эпидемиологического заболевания на начальных стадиях, проводится работа с населением и медицинскими работниками. Также на основе такого анализа создаются информационные брошюры и различные материалы, посвященные профилактическим мероприятиям конкретной болезни.

Профилактика гипертензивной болезни

Гипертензивная болезнь занимает сразу несколько кодов по мкб 10. Отличают несколько видов гипертонии, в том числе и способную повреждать разные органы. Коды для гипертонии определялись во Всемирной организации здравоохранения и позже данные по ним обработают в статистических центрах. Чтобы не стать еще одной единицей в статистике желательно принять профилактические меры заранее, особенно при наличии наследственной предрасположенности.

Правильное питание с достаточным количеством минералов и витаминов, нормальная двигательная активность, оптимальный вес и умеренное потребление соли способны серьезно помочь избежать гипертонии. Если же исключить чрезмерные стрессы, злоупотребление алкоголем и курение, то вероятность появления гипертензии станет еще меньше. И тогда волноваться о том, какой код по мкб 10 у гипертонии станет совсем не нужно.

Реноваскулярная артериальная гипертензия

  • 1 Что это такое?
    • 1.1 Варианты реноваскулярной гипертензии
  • 2 Причины возникновения и патогенез развития
    • 2.1 Особенности механизма развития
  • 3 Симптомы заболевания
    • 3.1 Формы протекания
  • 4 Особенности диагностики
  • 5 Методы лечения
    • 5.1 Медикаментозное лечение
    • 5.2 Народные методы лечения
    • 5.3 Диетическое питание

Существует много видов артериальной гипертонии по происхождению. Одним из таких видов является реноваскулярная гипертензия. Этим заболеванием могут болеть дети, люди молодого и пожилого возраста. Симптомы реноваскулярной гипертензии: резкое повышение артериального давления, быстрое прогрессирование болезни, стойкость к медикаментозному лечению. При появлении первых признаков заболевания нужно обратиться в больницу, потому что очень быстро развиваются осложнения, которые могут привести к летальному исходу.

Что это такое?

Реноваскулярная гипертония (код по МКБ-10: 115.0) — это вторичная форма артериальной гипертензии, которая появляется вследствие сужения или полного закрытия просвета почечной артерии. Часто ее еще называют почечной гипертензией. Она встречается чаще, чем другие вторичные формы артериальной гипертензии. Если поражаются две почки или единственная почка, реноваскулярная гипертензия носит злокачественный характер и быстро приводит к такому осложнению, как почечная недостаточность. Прогноз заболевания будет благоприятным, если пациенту провели своевременное и адекватное лечение, и не успели появиться осложнения, такие как сердечная или почечная недостаточность, инсульт.

на

Варианты реноваскулярной гипертензии
Вариант Особенности
Фибромускулярный Встречается приблизительно у 10% всех случаев и наиболее часто у женщин молодого возраста. Прогрессирование болезни проявляется появлением новых участков со стенозом.
Ишемическая болезнь почек Регистрируется у 90% пациентов из всех случаев. Чаще встречается у людей пожилого возраста, особенно при наличии атеросклероза, сахарного диабета, ИБС, сердечной недостаточности. Снижается скорость клубочковой фильтрации.

Причины возникновения и патогенез развития

Выделяют такие причины реноваскулярной болезни:

Основные причины Редкие причины
  • атеросклеротическое поражение магистральных артерий почки;
  • развитие фибромышечной дисплазии почечной артерии.
  • тромбы в почечных артериях;
  • неспецифический аорто-артериит;
  • узелковый полиангиит;
  • аневризма брюшной аорты;
  • онкологическое заболевание почек;
  • туберкулезное поражение почек;
  • аномалии развития;
  • травмы.
Особенности механизма развития

Болезнь развивается на фоне нарушенного почечного кровоснабжения.

Развивается реноваскулярная болезнь вследствие снижения кровоснабжения почек, понижения фильтрации клубочков. Задерживается натрий и вода, происходит накапливание жидкости в пространстве между клетками и образуется отек. Большое количество натрия причиняет разбухание стенок сосудов и увеличивает восприимчивость к ангиотензину и альдостерону. Дальше активируется ренин-ангиотензин-альдостероновая система. Ренин с белком крови образует ангитензин II, под действием которого выделяется альдостерон, что стимулирует задержку натрия. Вследствие активации веществ, что повышают давление, в почках исчерпывается запас простагландинов и калликреин-кининовой системы. Это становится причиной возникновения стойкой гипертензии.

Симптомы заболевания

Формы протекания

В симптоматике реноваскулярной гипертензии присутствуют признаки артериальной гипертензии и заболеваний почек. Степень и выраженность проявления симптомов зависит от того, в какой клинической форме реноваскулярная артериальная гипертензия протекает. Выделяют доброкачественную и злокачественную форму протекания, которые имеют некие отличия в проявлении.

Симптоматика при доброкачественном варианте Симптоматика при злокачественном варианте
  • давление стабильное;
  • отсутствует тенденция к снижению;
  • повышение диастолического давления больше, чем систолического;
  • у пациентов появляются жалобы на дискомфорт в области сердца;
  • отдышка;
  • головокружение;
  • снижение трудоспособности.
  • высокое давление;
  • ухудшение зрения вследствие появления ретинопатии;
  • сильные головные боли;
  • появление тошноты и позывов на рвоту;
  • головокружение.

При повышении артериального давления больной испытывает боли в области почек.

Основная симптоматика почечной гипертензии:

  • резкое появление заболевания;
  • наличие взаимосвязи между повышением давления и болями в поясничной области;
  • начало в молодом возрасте;
  • быстрое прогрессирование симптоматики;
  • прогрессирующие отеки;
  • стойкость к препаратам, что снижают давление.

Особенности диагностики

Этапы диагностики:

  1. При возникновении первых симптомов заболевания нужно обратиться к терапевту, кардиологу и окулисту. Они соберут анамнез заболевания, проведут объективное исследование, пальпацию и перкуссию сердечно — сосудистой системы и почек. Также проведут дифференциальную диагностику с другими видами гипертензии и поставят предварительный диагноз.
  2. Общий анализ крови.
  3. Общий анализ мочи.
  4. Биохимический анализ крови.
  5. Офтальмохромоскопия.
  6. УЗИ почек.
  7. Почечная ангиография.
  8. Урография.
  9. КТ и МРТ.

Методы лечения

Своевременное обращение к доктору поможет предупредить развитие осложнений.

При появлении первых признаков заболевания нельзя пытаться лечиться самостоятельно, а нужно обязательно обратиться к специалистам. Они осмотрят, проведут дополнительные исследования и назначат эффективное лечение. В качестве терапии назначают медикаментозное лечение, народные методы, которые можно применить в домашних условиях, и специальное диетическое питание. Также в качестве лечения широко применяют рентгеноваскулярные и хирургические методы. Показаниями к таким методам являются фибромускулярные и атерослеротические стенозы. После применения этих методик снизилось количество летальных исходов и осложнений.

Медикаментозное лечение

Для лечения реноваскулярной формы повышения давления назначают такие препараты:

  1. Антиагрегантные средства — «Клопидогрель», «Аспирин», «Пентоксифиллин».
  2. Ингибиторы АПФ — «Каптоприл», «Лизиноприл» и антагонисты рецепторов к ангиотензину II — «Вальсартан», «Лозартан».
  3. Мочегонные препараты — «Фуросемид», «Гипотиазид».
  4. Антагонисты кальция — «Амлодипин».
  5. Бета-блокаторы — «Атенолол», «Метапролол».
Народные методы лечения

В качестве терапии применяют такие рецепты целителей:

  1. Народные средства принимают как вспомогательные вещества в комплексной медикаментозной терапии.

    Сухие плоды шиповника нужно тщательно перетереть. Взять 1 столовую ложку сырья и размешать в 250 миллилитров горячей воды. Данную смесь настаивать на водяной бане на протяжении 15 минут. Употреблять как чай 2 раза на день.

  2. Взять 2−3 яблока и очистить. Шкурки нужно высушить и хорошо измельчить. Взять 1 столовую ложку сырья и размешать в стакане горячей воды. Употреблять 3 раза в день по 1/3 стакана.
  3. Хорошо очищает почки тыква и тыквенные семечки. Можно готовить различные блюда из тыквы.
  4. Листья брусники хорошо измельчить, взять 2 столовых ложки сырья и размешать в 250 мл горячей воды. Все запарить на паровой бане на протяжении 30 минут. После этого полученный настой нужно процедить. Принимать по 1/3 стакана 3 раза на день.
Диетическое питание

Каждому пациенту нужно употреблять:

  • свежие фрукты и овощи с мочегонным эффектом — свекла, кабачок, огурец, тыква, дыня, арбуз и другие;
  • рыбу и мясо нежирных сортов в запеченном, отварном виде или на пару;
  • молочные продукты в небольших количествах;
  • ограничить количество жидкости;
  • зелень;
  • сухофрукты;
  • цельнозерновой хлеб;
  • разные крупы;
  • нежирные бульоны.

Исключить из рациона питания:

  • алкогольные напитки;
  • чай, кофе;
  • жареное;
  • соленое;
  • острое;
  • жирное.

Правильно подобранное диетическое питание будет способствовать эффективному лечению и приведет к хорошему результату. Для каждого пациента специалисты подбирают индивидуально режим питания и продукты, которые они могут употреблять. При этом учитывается количество соли, белка и жидкости, а также особенность протекания заболевания и состояние пациента.

на

МКБ-10

Международная статистическая классификация болезней и проблем, связанных со здоровьем. Десятый пересмотр (МКБ-10) Общая информация Автор

Всемирная организация здравоохранения

Серия

Международная классификация болезней

Предыдущая

Международная статистическая классификация болезней и проблем, связанных со здоровьем. Девятый пересмотр (МКБ-9)

Следующая

Международная статистическая классификация болезней и проблем, связанных со здоровьем. Одиннадцатый пересмотр (МКБ-11)

Тип

медицинская классификация и версия или издание

Жанр

справочник, медицина

Оригинальная версия Название

англ. The International Statistical Classification of Diseases and Related Health Problems. 10th revision (ICD-10)

Язык

английский

Место издания

Швейцария, Женева

Год издания

1992, последнее переиздание — 2016

Страниц

2174 (переиздание 2016)

ISBN Русская версия Переводчик

М. В. Максимова, С. К. Чемякина, А. Ю. Сафронова

Место издания

Москва

Издательство

Медицина

Год издания

1995—1998

Страниц

698 (Т. 1. ч. 1), 633 (Т. 1, ч. 2), 179 (Т. 2), 429 (Т. 3, ч. 2)

Носитель

бумага

ISBN

ISBN 5-225-03268-0 (т. 1), ISBN 5-225-03269-9 (т. 2), ISBN 5-225-03280-X (т. 3)

Деся́тый пересмо́тр Междунаро́дной статисти́ческой классифика́ции боле́зней и пробле́м, свя́занных со здоро́вьем (МКБ-10) проведён с 25 сентября по 2 октября 1989 года Всемирной организацией здравоохранения в Женеве. МКБ-10 была одобрена на Сорок третьей сессии Всемирной ассамблеи здравоохранения в мае 1990 года и с 1994 года начала внедряться в государствах-членах ВОЗ. На территории Российской Федерации действие МКБ-10 как единого нормативного документа для формирования системы учёта и отчётности в системе здравоохранения было введено с 1 января 1999 года приказом Министерства здравоохранения № 170 от 1997 года.

Основным нововведением Международной классификации болезней десятого пересмотра стало использование алфавитно-цифровой системы кодирования, предполагающей наличие в четырёхзначной рубрике одной буквы, за которой следуют три цифры, что позволило более чем вдвое увеличить размеры структуры кодирования. Введение в рубрики букв или групп букв позволяет закодировать в каждом классе до 100 трёхзначных категорий. Из алфавита 26 букв использовано 25. Таким образом, возможны номера кодов от A00.0 до Z99.9. Буква U оставлена вакантной (резервной). Кроме того, важным нововведением стало включение в конце некоторых классов перечня рубрик, классифицирующих нарушения, которые возникли после проведения медицинских процедур. Эти рубрики описывали состояния, которые развивались в результате различных вмешательств, например эндокринные и метаболические расстройства после удаления органа или другие патологические состояния, например демпинг-синдром, который является осложнением некоторых хирургических вмешательств на желудке.

Структура

Бумажное издание МКБ-10 состоит из трёх томов:

  • том 1 содержит основную классификацию, а также содержит раздел «Морфология новообразований», специальные перечни для сводных статистических разработок, определения и номенклатурные правила;
  • том 2 содержит инструкции по применению для пользователей МКБ;
  • том 3 представляет собой Алфавитный указатель к классификации.

Структура МКБ-10 разработана на основе классификации, предложенной Уильямом Фарром. Его схема заключалась в том, что для всех практических и эпидемиологических целей статистические данные о болезнях должны быть сгруппированы определённым образом:

  • эпидемические болезни;
  • конституциональные или общие болезни;
  • местные болезни, сгруппированные по анатомической локализации;
  • болезни, связанные с развитием;
  • травмы.

Классы I—XVII относятся к заболеваниям и другим патологическим состояниям, класс XIX — к травмам, отравлениям и некоторым другим последствиям воздействия внешних факторов. Остальные классы охватывают ряд понятий, касающихся диагностических данных.

Блоки рубрик

Классы подразделяются на однородные «блоки» трёхзначных рубрик. Например в классе I названия блоков отражают две оси классификации — пути передачи инфекции и широкую группу патогенных микроорганизмов.

В классе II первой осью является характер новообразований по локализации, хотя несколько трёхзначных рубрик предназначены для важных морфологических типов новообразований (например, лейкозы, лимфомы, меланомы, мезотелиомы, саркома Капоши). Диапазон рубрик дан в скобках после каждого названия блока.

Трёхзначные рубрики

в рамках каждого блока некоторые из трёхзначных рубрик предназначены только для одной болезни, отобранной вследствие её частоты, тяжести, восприимчивости к действиям служб здравоохранения, в то время как другие трёхзначные рубрики предназначены для групп болезней с некоторыми общими характеристиками. В блоке обычно имеются рубрики для «других» состояний, дающие возможность классифицировать большое число различных, но редко встречающихся состояний, а также «неуточнённые» состояния.

Четырёхзначные подрубрики

Большинство трёхзначных рубрик подразделены посредством четвёртого цифрового знака после десятичной точки, с тем чтобы можно было использовать ещё до 10 подрубрик. Если трёхзначная рубрика не подразделена, рекомендуется использовать букву «X» для заполнения места четвёртого знака, чтобы коды имели стандартный размер для статистической обработки данных.

Четырёхзначные подрубрики используют любым подходящим способом, определяя, например, различные локализации или разновидности одной болезни.

Четвёртый знак .8 обычно используется для обозначения «других» состояний, относящихся к данной трёхзначной рубрике, а знак .9 чаще всего используется чтобы выразить то же понятие, что и название трёхзначной рубрики без добавления какой-либо дополнительной информации.

Неиспользованные коды «U»

Коды U00—U49 следует использовать для временного обозначения новых болезней неясной этиологии. Коды U50—U99 могут быть использованы в исследовательских целях, например для апробирования альтернативной подклассификации в рамках специального проекта. Коды U00 — U89 используются для особых целей и составляют XXII класс болезней.

Перечень классов МКБ-10

Список классов

Литера Класс Заголовок
A I Некоторые инфекционные и паразитарные болезни
B
C II Новообразования
D III Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм
E IV Болезни эндокринной системы, расстройства питания и нарушения обмена веществ
F V Психические расстройства и расстройства поведения
G VI Болезни нервной системы
H VII Болезни глаза и его придаточного аппарата
VIII Болезни уха и сосцевидного отростка
I IX Болезни системы кровообращения
J X Болезни органов дыхания
K XI Болезни органов пищеварения
L XII Болезни кожи и подкожной клетчатки
M XIII Болезни костно-мышечной системы и соединительной ткани
N XIV Болезни мочеполовой системы
O XV Беременность, роды и послеродовой период
P XVI Отдельные состояния, возникающие в перинатальном периоде
Q XVII Врождённые аномалии (пороки развития), деформации и хромосомные нарушения
R XVIII Симптомы, признаки и отклонения от нормы, выявленные при клинических и лабораторных исследованиях, не классифицированные в других рубриках
S XIX Травмы, отравления и некоторые другие последствия воздействия внешних причин
T
V XX Внешние причины заболеваемости и смертности
W
X
Y
Z XXI Факторы, влияющие на состояние здоровья населения и обращения в учреждения здравоохранения
U XXII Зарезервировано

> См. также

  • Международная классификация болезней

Примечания

  1. Приказ Минздрава РФ от 27.05.97 № 170 (ред. от 12.01.98) «О переходе органов и учреждений здравоохранения Российской Федерации на Международную статистическую классификацию болезней и проблем, связанных со здоровьем X пересмотра». zakonbase.ru (1997). Дата обращения 15 апреля 2019.
  2. International Classification of Diseases 10th Revision (англ.). World Health Organization (2010). Дата обращения 12 мая 2017 года.

Ссылки

  • who.int/classifications/icd/en/ — официальный сайт МКБ-10 на сайте Всемирной организации здравоохранения (ВОЗ) (англ.)
  • МКБ-10. Том 1. Ч. 1 (рус.) на сайте ВОЗ
  • МКБ-10. Том 1. Ч. 2 (рус.) на сайте ВОЗ
  • МКБ-10. Том 2 (Сборник инструкций) (рус.) на сайте ВОЗ
  • МКБ-10. Том 3. Ч. 1 (рус.) на сайте ВОЗ
  • МКБ-10. Том 3. Ч. 2 (рус.) на сайте ВОЗ
  • Класс V МКБ-10 (Психические расстройства и расстройства поведения) (рус. ) на сайте Российского общества психиатров
  • ICD-10 — онлайн-версия (ВОЗ) (англ.)
  • ICD-10 online training direct access (WHO) (англ.)
  • ICD-10-CM МКБ-10-КМ — Клиническая модификация (американская версия) (англ.)

В настоящее время медицинским работникам скорой помощи необходимо в картах вызовов указывать код заболевания по МКБ-10. За несколько лет практики каждый, желая того или нет, запомнит наизусть часто применяемые коды, но все же не откажется иметь в кармане шпаргалку по кодам. Это может быть приложение в телефоне, а можно и распечатать небольшую брошюру формата А3. Как говорится, на вкус и цвет товарища нет. Мне предпочтительней иметь бумажный вариант, хотя есть и приложение, которым пользуюсь очень редко. Именно поэтому я решил изготовить для себя такую шпаргалку, коей теперь делюсь с вами.

В представленной здесь брошюре содержатся наиболее часто применяемые коды МКБ-10 в практике скорой помощи. Для удобства поиска они сортированы по диагнозам в алфавитном порядке. В большинстве своем приведенные коды в брошюре подразумевают диагноз как «неуточненный». Например, «ИБС. Другие формы хронической ИБС (неуточненная) — I25.9». Эта довольно полезная и удобная «шпаргалка» содержит порядка 700 диагнозов для фельдшеров и врачей СМП. Не смотря на такой большой объем в брошюре довольно таки легко ориентироваться, к ней быстро привыкаешь, она компактна, занимает мало места и очень легкая. В конце брошюры имеется несколько десятков пустых строк для собственных заметок медицинского работника. При печати файла надо открыть свойства принтера и выбрать режим «печать брошюры (буклета)» (ВНИМАНИЕ: название функции или способ печати может отличаться от указанного здесь в зависимости от программного обеспечения вашего принтера) и далее следовать подсказкам системы во время печати. Печать производить на листах А4, которые затем складываются вдвое и прошиваются нитками или скрепляются степлером. Для обложки лучше использовать более плотную бумагу для долговечности. Брошюра выполнена в формате docx и содержит 29 страниц.

Если кого-то интересует, то вот здесь можете посмотреть в режиме онлайн коды глазных болезней по МКБ-10. Надеюсь, что авторы этого ресурса последуют моему примеру и сделают подобную брошюрку для своих пользователей и гостей сайта.

>Определение открытого овального окна по МКБ 10

3 Диагностика и лечение

Для большинства родителей, которые узнают, что у их ребенка имеется подобная патология, это становится настоящим шоком. В действительности же данная патология не является приговором. Открытое овальное окно не несет серьезной угрозы жизни, но при этом обязательно проводить его направленное лечение, ведь последствия могут быть крайне неблагоприятными. При появлении признаков открытого отверстия ребенку требуется консультация у кардиолога и проведение обследования.

В первую очередь врачом осуществляется аускультация тонов сердца, сбор анамнеза и жалоб больного. Это позволяет выявить дополнительные осложнения. Также требуется измерение артериального давление, проведение общего и биохимического анализов крови.

Для того чтобы определить размеры отверстия, необходимо проведение рентгена грудной клетки, УЗИ сердца, эхокардиографии.

Метод терапии зависит от имеющихся особенностей течения патологии у конкретного больного. В случае если заболевание выявляется у младенцев в возрасте до 2 лет, врачами может быть прописана консервативная терапия, предполагающая прием специальных витаминов для сердца и антикоагулянтов для снижения риска образования тромбов. Здесь имеется вероятность, что отверстие закроется к двум годам ребенка самостоятельно.

Если открытое овальное окно имеет слишком большие размеры, а ребенку уже более 2 лет, требуется проведение хирургического вмешательства. Оперативное лечение, как правило, проводится посредством эндоваскулярной методики, то есть через катетер вводится специальный пластырь, которым закрывают окно.

В дальнейшем данный элемент создает идеальный каркас для роста нормальный тканей. Таким образом, открытое овальное окно достаточно быстро зарастает. После проведения подобного вмешательства больному необходимо определенное время принимать антибиотики, которые будут препятствовать развитию инфекционного эндокардита. Кроме того, могут быть назначены антикоагулянты для предотвращения образования тромбов. При правильном лечении человек может вернуться к полноценной жизни и не испытывать в дальнейшем никаких проблем с сердцем.

Аномалия открытое овальное окно

Любой вопрос, который касается здоровья ребенка, чрезвычайно волнует молодых родителей.

Особенно если речь идет о развитии его сердечно-сосудистой системы.

Практически у 70% новорожденных наблюдается такая проблема, как ООО.

В чем же особенности диагноза открытое овальное окно, код по международной классификации болезней (МКБ 10) которого Q21.1?

Суть аномалии

В период внутриутробного развития плода его сердце начинает формироваться уже в начале 3 недели, а на УЗИ его можно увидеть на сроке 5–6 недель. Пусть оно еще не до конца развито, но уже принимает участие в перекачивании крови.

Особенность кровообращения плода заключается в том, что в нем не принимают участия легкие малыша, что вызывает необходимость участия организма мамы в обеспечении жизнедеятельности плода.

На этом этапе развития круг кровообращения включает в себя Боталлов проток (направляет поток крови от сердца к аорте) и овальное окно (направляет кровь из ПП в левое предсердие).

После того как ребенок появляется на свет, его легкие открываются и сразу приступают к перекачиванию крови. Это приводит к изменению строения СК: овальное окно и Боталлов проток теряют свою актуальность и становятся ненужными для функционирования организма новорожденного.

На протяжении первого месяца овальное окно постепенно закрывается специальным клапаном, створки которого плотно срастаются со стенками окна.

К концу первого года жизни на месте этого клапана формируется межпредсердная перегородка. В некоторых случаях этот процесс может затянуться до 5–6 лет, а иногда открытое овальное окно остается открытым на протяжении всей жизни.

Это является патологией развития сердца человека.

Причины и признаки

К сожалению, несмотря на высокий уровень развития современной медицины, точно установить причины этой болезни так и не удалось. Специалисты считают, что причины заключаются в следующем:

  • недоношенность рожденного малыша;
  • развитие порока сердца, связанного с нарушением его структуры;
  • употребление женщиной в период вынашивания ребенка алкогольных напитков, курение;
  • влияние отрицательных факторов окружающей среды;
  • прием некоторых медицинских препаратов;
  • наследственность.

Если патология не приобрела обширного развития, ребенок не ощущает никакого дискомфорта или боли. В противном же случае у малыша могут проявляться такие симптомы:

  • изменение цвета кожных покровов в области носа или губ, которые особенно четко заметны во время его плача или при увеличении активности ребенка;
  • малыш часто болеет простудными или вирусными заболеваниями;
  • торможение физического или психологического развития;
  • при аускультации специалисты прослушивают шумы в сердце;
  • частые обмороки;
  • кровообращение головного мозга нарушено;
  • одышка, которая проявляется при увеличении физических нагрузок.

Диагностировать ООО можно при плановом проведении ультразвукового обследования новорожденного. В некоторых случаях специалисты могут обнаружить патологию на первом году жизни.

В любом случае, особенно при обнаружении признаков болезни, стоит обязательно обратиться к специалистам и пройти комплексное обследование. Это поможет избежать развития более сложных сопутствующих заболеваний, а возможно, и спасти жизнь ребенку.

Клинические рекомендации

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ

КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ

ЧАСТИЧНЫЙ АНОМАЛЬНЫЙ ДРЕНАЖ ЛЕГОЧНЫХ ВЕН (ЧАДЛВ)

МКБ 10: Q26.3

Год утверждения (частота пересмотра): 2018 (не реже 1 раза в 3 года)

ID: КР45

URL

Профессиональные ассоциации

— Ассоциация сердечно-сосудистых хирургов России

Ключевые слова

— синдром ятагана

— одышка

— сердцебиение

— цианоз

— кардиомегалия

— недостаточность кровообращения

— аритмии

— парадоксальная эмболия

— посткардиотомный синдром

— тампонада сердца

Список сокращений

ВПС — врожденные пороки сердца

ДМПП — дефект межпредсердной перегородки

ИБС — ишемическая болезнь сердца

КТ — компьютерная томография

МРТ — магнитно-резонансная томография

ОЛС — общелегочное сосудистое сопротивление

ОРИТ — отделение реанимации и интенсивной терапии

ПЖ — правый желудочек

ПП — правое предсердие

ЭКГ — электрокардиография

ЭхоКГ — эхокардиография

Qp/Qs — соотношение объемов кровотока по малому и большому кругам кровообращения

Термины и определения

Кардиомегалия — увеличение сердца, вызванное гипертрофией объема сердечной мышцы или дилатацией камер сердца.

Катетеризация сердца — инвазивная процедура, проводимая с лечебными или диагностическими целями при патологии сердечно-сосудистой системы.

Посткардиотомный синдром — осложнение раннего послеоперационного периода в хирургии врожденных пороков сердца, проявляющееся наличием выпота в перикардиальной полости.

Синдром ятагана — инфракардиальная форма частичного аномального впадения правых легочных вен в нижнюю полую вену.

Эхокардиография — метод ультразвукового исследования, направленный на исследование морфологических и функциональных изменений сердца и его клапанного аппарата.

1. Краткая информация

1.1 Определение

Частичный аномальный дренаж легочных вен (ЧАДЛВ) — аномалия развития сердца, характеризующаяся отсутствием соединения одной или нескольких (но не всех) легочных вен с левым предсердием. При этом они могут дренироваться в правое предсердие, коронарный синус, бассейны верхней или нижней полых вен.

1.2 Этиология и патогенез

К нарушению органогенеза и формированию врожденного порока сердца приводят генетические, физические, экологические и инфекционные факторы. Риск развития порока у будущего ребенка существенно выше в тех семьях, где есть родственники с ВПС. Кроме наследственной обусловленности, к возникновению порока могут приводить вирусные заболевания беременной (краснуха, ветряная оспа и др.), эндокринопатии, прием некоторых медикаментов и алкоголя во время беременности, производственные вредности, гестационные осложнения (токсикозы, угроза выкидыша и др.).

1.3 Эпидемиология

Частичный аномальный дренаж легочных вен обычно сочетается с наличием межпредсердного сообщения (ДМПП, открытое овальное окно). Реже — межпредсердная перегородка интактна. Для каждого типа ЧАДЛВ имеются преимущественные локализации ДМПП, однако сочетания вариантов ЧАДЛВ с ДМПП нельзя считать абсолютными. Частота частичного аномального дренажа легочных вен колеблется от 0,3% от всех ВПС по клиническим данным до 0,6% — по аутопсийным [1 — 3]. Синдром ятагана составляет 3 — 6% случаев всех ЧАДЛВ [3, 4]. Половина пациентов с изолированным ЧАДЛВ способны дожить до 30 — 40 лет. Медиана выживаемости пациентов с синдромом ятагана находится в диапазоне от 20 до 30 лет [5, 6].

1.4 Кодирование по МКБ 10

Врожденные аномалии крупных вен (Q26):

Q26.3 — Частичный аномальный дренаж легочных вен.

1.5 Классификация

Классификация ЧАДЛВ [2, 3]:

— супракардиальный;

— интракардиальный;

— инфракардиальный;

— смешанный.

1.6 Клиническая картина

Пороки этого типа имеют скудную клиническую картину и часто протекают бессимптомно. Они могут манифестировать сниженной толерантностью к физической нагрузке, частыми инфекционными заболеваниями легких. Явления недостаточности кровообращения незначительны и могут ограничиваться умеренно выраженной слабостью, потливостью ребенка, цианозом носо-губного треугольника. Изолированный ЧАДЛВ может проявлять себя кровохарканьем. Дети с пороками типа ДМПП нередко имеют астеническое телосложение с заметной бледностью кожных покровов. Диффузный цианоз может отмечаться в случаях вено-артериального сброса.

При физикальном осмотре могут отмечаться расщепление II тона (следствие большей продолжительности систолы правого желудочка) и/или систолический шум функционального стеноза над легочной артерией. В случаях больших дефектов возможно наличие диастолических шумов над трехстворчатым клапаном (функциональный стеноз) и легочной артерией (недостаточность клапана легочной артерии, шум Грехема-Стилла).

2. Диагностика

2.1 Жалобы и анамнез

— При сборе анамнеза рекомендуется уточнить у всех пациентов с подозрением на ЧАДЛВ наличие ВПС в семье и у родственников, течение беременности матери ребенка (как протекала, имели ли место инфекционные заболевания беременной, осложнения во время вынашивания плода и др.) для верификации диагноза [2, 3, 7 — 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— При сборе жалоб рекомендуется уточнить у всех пациентов с подозрением на ЧАДЛВ наличие одышки, сердцебиения, утомляемости, возникающих после физических нагрузках; кровохарканье (проявляющееся при изолированном ЧАДЛВ), частых инфекционных заболеваний легких для верификации диагноза [2, 3, 7 — 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Как правило, данный ВПС имеет скудную клиническую картину и часто протекает бессимптомно. Явления недостаточности кровообращения незначительны и могут ограничиваться умеренно выраженной слабостью, потливостью ребенка, цианозом носогубного треугольника.

2.2 Физикальное обследование

— Рекомендуется выполнить физикальное обследование всем пациентам с подозрением на ЧАДЛВ для верификации диагноза [2, 3, 7 — 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Аускультация сердца выявляет систолический шум с его максимальной интенсивностью во втором — третьем межреберье слева от грудины. При больших сбросах крови у части пациентов над трехстворчатым клапаном прослушивается нежный диастолический шум; II тон над легочной артерией широко расщеплен независимо от фаз дыхания. При наличии легочной гипертензии легочный компонент II тона усилен. Дети нередко имеют астеническое телосложение с заметной бледностью кожных покровов.

2.3 Лабораторная диагностика

— Если пациент с ЧАДЛВ поступил в профильный стационар для оперативного лечения порока рекомендуется определить его группу крови и резус-фактор для подбора крови [2].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Рекомендуется всем пациентам выполнять общий анализ крови для определения исходного уровня гемоглобина и тромбоцитов перед оперативным вмешательством [2].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

2.4 Инструментальная диагностика

Диагноз ЧАДЛВ ставится при помощи визуализирующих методов исследования.

— Рекомендуется всем пациентам с подозрением на ЧАДЛВ выполнение трансторакальной эхокардиографии (ЭхоКГ) с применением режима цветного допплеровского картирования для верификации диагноза [2, 3, 7 — 11].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 3)

Комментарии: Заподозрить ЧАДЛВ возможно при отсутствии визуализации при трансторакальном исследовании в проекции 4-х камер в режиме цветного допплеровского картирования потока в левом предсердии из правых или левых легочных вен. При ЧАДЛВ в верхнюю полую вену отмечается ее расширение и ускоренный поток в ней (в режиме непрерывно-волнового допплера). В высокой правой парастернальной позиции в проекции по длинной оси или при субкостальном доступе в проекции по короткой оси визуализируется место впадения ЧАДЛВ в верхнюю или нижнюю полые вены. Трудности могут возникать при эхокардиографической диагностике ЧАДЛВ левых легочных вен в коронарный синус при наличии верхней левой полой вены, смешанной формы ЧАДЛВ. При оценке потока в легочной вене в допплеровском режиме возможно определение стеноза вены/коллектора в месте впадения в правое предсердие, полые вены. ЭхоКГ проводится также и перед выпиской из стационара.

— Выполнение МРТ грудной клетки пациентам с подозрением на ЧАДЛВ рекомендуется для оценки анатомии легочных вен, характеристики потока в них, а также в том случае, если результаты ЭхоКГ неубедительны [2, 3].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Пациентам с неясной перегрузкой объемом ПЖ рекомендуется госпитализация в специализированное учреждение с целью проведения дальнейших диагностических исследований и выявления ВПС [2, 3, 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Катетеризация сердца с ангиографией рекомендуется пациентам для выявления сопутствующих аномалий сердца, а также у пациентов с подозрением на легочную гипертензию [2, 3, 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Безусловным признаком аномального дренажа легочных вен, выявляемого при катетеризации правых отделов сердца, служит прохождение зонда в легочные вены непосредственно из полых вен или правого предсердия.

— Выполнение рентгенографии органов грудной клетки рекомендуется всем пациентам с подозрением на ЧАДЛВ для определения конфигурации сердца и оценки сосудистого рисунка легких [2, 3, 7 — 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: При обычном рентгенологическом исследовании удается выявить признаки усиления артериального сосудистого рисунка в легких и увеличение камер правого сердца и легочной артерии различной степени выраженности. При синдроме ятагана в прямой проекции визуализируется аномально дренирующаяся легочная вена.

— Рекомендуется всем пациентам с подозрением на ЧАДЛВ выполнить электрокардиографию для определения электрической оси сердца, перегрузки правых отделов, оценки сердечного ритма и проводимости [2, 3, 7 — 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Электрокардиографическая картина неспецифична и отражает гипертрофию правого предсердия и желудочка, а также перегрузку последнего. Степень этих изменений зависит от величины сброса крови и длительности существования порока.

2.5 Иная диагностика

— Рекомендуется проводить пациентам с подозрением на ЧАДЛВ дифференциальную диагностику с ДМПП и другими пороками, протекающими с усилением легочного кровотока [2, 3, 7 — 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

3. Лечение

3.1 Консервативное лечение

— Рекомендуется назначение диуретиков в возрастных дозировках пациентам, у которых течение порока сопровождается явлениями недостаточности кровообращения [2, 7, 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Начальная разовая доза фуросемида** у детей определяется из расчета 1 — 2 мг/кг массы тела/сутки с возможным увеличением дозы до максимальной 6 мг/кг/сутки, при условии приема препарата не чаще, чем через 6 ч (противопоказано применение таблетированной лекарственной формы у детей до 3-х лет). Начальная доза фуросемида** для взрослых составляет 20 — 80 мг/сутки. Рекомендуется делить суточную дозу на 2 — 3 приема.

— Рекомендуется взрослым пациентам с ЧАДЛВ проводить лечение суправентрикулярных аритмий назначением антиаритмических препаратов в возрастных дозировках (см. клинические рекомендации по аритмии) [12 — 16].

Уровень убедительности рекомендаций B (уровень достоверности доказательств — 3)

— Рекомендуется пациентам в случае фибрилляции предсердий как антиаритмическая, так и антикоагулянтная терапия с индивидуальным подбором дозировки (см. клинические рекомендации по фибрилляции предсердий) [12, 13].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Медикаментозная терапия легочной гипертензии рекомендуется только тем пациентам, у которых наблюдается необратимая легочная гипертензия (см. клинические рекомендации по легочной гипертензии) [3, 17 — 19].

Уровень убедительности рекомендаций B (уровень достоверности доказательств — 3)

3.2 Хирургическое лечение

— Оперативное лечение ЧАДЛВ рекомендуется пациентам при соотношении объемов кровотока по малому и большому кругам кровообращения (Qp:Qs) более 1,5. При изолированном ЧАДЛВ (без ДМПП) части одного легкого оперативное лечение проводится при Qp:Qs более 1,8 [2, 3, 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Изолированный аномальный дренаж всех легочных вен одного легкого требует коррекции для предупреждения возможной гипоксемии при возникновении повреждения здорового легкого. Оптимальный возраст выполнения вмешательства — 1 — 2 год жизни. Коррекция синдрома ятагана с гипоплазией легкого целесообразна для предупреждения секвестрации легкого в объеме резекции легкого независимо от величины сброса. Методы коррекции ЧАДЛВ могут быть разделены на методики разобщения, перемещениия и реимплантации. В некоторых случаях элементы каждой из этих техник могут сочетаться друг с другом.

3.3 Иное лечение

Обезболивающая терапия у детей

— Рекомендуется пациентам для премедикации, с целью седации и обеспечения эмоциональной стабильности перед транспортировкой в операционную, применять опиаты и/или бензодиазепины в возрастных дозировках [20 — 22].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Дети до 6 месяцев в премедикации не нуждаются. Дети от 6 месяцев до 3 лет: мидазолам** или диазепам** в/м, либо в/в в возрастных дозировках. Дети старше 3 лет: тримепередин** и/или мидазолам**, либо диазепам** в/м, в/в в возрастных дозировках.

— Рекомендуется пациентам для индукции в наркоз и поддержания анестезии использовать: фентанил**, пропофол**, бензоадиазепины, натрия оксибутират**, фторсодержащие газовые анестетики в возрастных дозировках. Предпочтительным является проведение комбинированной анестезии с применением галогенсодержащих газовых анестетиков на всех этапах хирургического вмешательства, включая искусственное кровообращение [20 — 22].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для индукции и поддержания анестезии у детей:

Индукция: Дети до 1 месяца: мидазолам**/натрия оксибутират** и фентанил** в/в в возрастных дозировках. Дети старше 1 месяца: мидазолам**/натрия оксибутират**/пропофол** и фентанил** — в/в в возрастных дозировках. Во всех возрастных группах возможно проведение индукции севофлураном** (как моноиндукции, так и в комбинации с в/в введением фентанила**).

Поддержание анестезии: Дети до 1 месяца: мидазолам**/натрия оксибутират** и фентанил** в/в в возрастных дозировках. Дети старше 1 месяца: мидазолам**/натрия оксибутират**/пропофол** и фентанил** в/в в возрастных дозировках. Во всех возрастных группах возможно применение галогенсодержащих газовых анестетиков в комбинации с фентанилом**. При превышении дозировок (применении дозировок, превышающих указанные в инструкции к препарату) необходимо решение врачебной комиссии.

— Рекомендуется пациентам для обезболивания в раннем послеоперационном периоде использовать опиаты и нестероидные противовоспалительные препараты в возрастных дозировках [20 — 22].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для обезболивания в послеоперационном периоде:

Первые сутки после операции — тримепередин** в/м каждые 6 — 8 часов, либо в/в инфузия морфина** в возрастных дозировках, далее НПВП. При сохранении выраженного болевого синдрома тримеперидин**/морфин** в возрастных дозировках по показаниям. При превышении дозировок (применении дозировок, превышающих указанные в инструкции к препарату) необходимо решение врачебной комиссии.

При сохранении выраженного болевого синдрома тримеперидин**/морфин** в возрастных дозировках по показаниям.

Обезболивающая терапия у взрослых

— Рекомендуется пациентам для премедикации с целью седации и обеспечения эмоциональной стабильности вечером накануне операции с целью уменьшения эмоционального стресса назначить транквилизаторы и нейролептики. Для премедикации перед подачей пациента в операционную с целью седации и обеспечения эмоциональной стабильности применяются опиаты и/или бензодиазепины [21, 22].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Вечером накануне операции: бензодиазепины (Бромдигидрохлорфенилбензодиазепин**, лоразепам), атипичные нейролептики (тиоридазин**, сульпирид**) в индивидуальных дозировках. Перед подачей в операционную в/м тримепередин** и/или диазепам**/мидазолам**.

— Рекомендуется пациентам для индукции в наркоз использовать: фентанил**, пропофол**, бензодиазепины, для поддержания анестезии — фентанил**, пропофол**, бензодиазепины, фторсодержащие газовые анестетики. Предпочтение необходимо отдавать проведению комбинированной анестезии с применением галогенсодержащих газовых анестетиков на всех этапах хирургического вмешательства, включая искусственное кровообращение [21, 22].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для индукции и поддержания анестезии:

Индукция: мидазолам**/диазепам**/пропофол** и фентанил** в/в в расчетных дозировках.

Поддержание анестезии: мидазолам**/диазепам**/пропофол** и фентанил** — в/в в расчетных дозировках. Возможно применение галогенсодержащих газовых анестетиков в комбинации с фентанилом**. При превышении дозировок (применении дозировок, превышающих указанные в инструкции к препарату) необходимо решение врачебной комиссии.

— Рекомендуется пациентам для обезболивания в раннем послеоперационном периоде использовать опиаты и НПВП в возрастных дозировках [21, 22].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: препараты, используемые для обезболивания в послеоперационном периоде:

Первые сутки после операции — тримепередин**, либо морфин** в/м каждые 4 — 8 часов, далее НПВП. При наличии специальных дозаторов эффективно применение пациент-контролируемой анальгезии фентанилом**. При сохранении выраженного болевого синдрома тримепередин**/морфин**/фентанил** по показаниям.

4. Реабилитация

— В течение 3 месяцев после операции пациенту рекомендуется пройти восстановительное лечение в условиях санатория кардиологического профиля или реабилитационного центра [23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

— Рекомендуется ограничить физическую нагрузку пациентам в течение полугода с момента выписки из стационара [23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Большинство программ кардиологической реабилитации длятся от трех до шести месяцев.

— Ранние послеоперационные симптомы, такие как повышение температуры, утомляемость, рвота, боль в груди или абдоминальная боль, могут означать посткардиотомный синдром с тампонадой сердца, в данном случае рекомендуется немедленное выполнение ЭхоКГ с целью исключения этого осложнения [2, 3, 9].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Посткардиотомный синдром и тампонада сердца могут возникнуть через несколько недель после хирургического коррекции ЧАДЛВ, и их необходимо оценить клинически и с помощью ЭхоКГ до выписки и в течение месяца после выписки пациента. Пациенты, их родители и врачи первичного звена должны быть проинструктированы о том, что необходимо сообщать о температуре или необычных симптомах (грудной или абдоминальной боли, рвоте, непривычной утомляемости) в первые недели после операции, так как эти симптомы могут представлять ранние признаки сердечной тампонады.

5. Профилактика

— Рекомендуется всем пациентам регулярное наблюдение врача-кардиолога [23].

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Дети первого года жизни наблюдаются у кардиолога в первом полугодии 2 раза в месяц, во втором — ежемесячно. На втором году жизни 2 раза в год, далее ребенок наблюдается не реже 1 раза в 2 года. Один раз в квартал необходимо снимать показания ЭКГ, два раза в год проводится ЭхоКГ и один раз в год — рентгенография грудной клетки (во фронтальной и боковой проекциях).

— Ежегодный клинический осмотр у кардиолога рекомендуется пациентам после операции, если остались или появились следующие состояния [2, 3, 9]:

1. Легочная артериальная гипертензия.

2. Суправентрикулярная аритмия.

3. Правожелудочковая или левожелудочковая дисфункция.

4. Сопутствующие пороки или другие заболевания сердца.

Уровень убедительности рекомендаций C (уровень достоверности доказательств — 4)

Комментарии: Клиническое обследование и ЭКГ по поводу рецидивирующей или вновь появившейся аритмии является важной частью послеоперационного обследования.

6. Дополнительная информация, влияющая на течение и исход заболевания

Нет.

7. Организация медицинской помощи

Показания для плановой госпитализации:

1. наличие симптомов недостаточности кровообращения;

2. наличие легочной гипертензии;

3. наличие суправентрикулярных нарушений ритма сердца;

4. плановое хирургическое вмешательство.

Показания для экстренной госпитализации:

1. ухудшение функционального статуса пациента в связи с прогрессированием симптомов недостаточности кровообращения;

2. наличие парадоксальной эмболии системных сосудов, в том числе мозга.

Показания к выписке пациента из стационара:

1. отсутствие сброса на межпредсердной перегородке, градиента на легочных венах после хирургической коррекции порока;

2. снижение давления в системе легочной артерии;

3. отсутствие симптомов недостаточности кровообращения.

Критерии оценки качества медицинской помощи

N

Критерии качества

Уровень достоверности доказательств

Уровень убедительности рекомендаций

Этап постановки диагноза

1

Выполнен сбор анамнеза и жалоб пациента

4

C

2

Выполнен физикальный осмотр пациента

4

C

3

Выполнена эхокардиография с применением режима цветного допплеровского картирования

3

C

4

Выполнена катетеризация сердца с ангиографией

4

C

Этап консервативного и хирургического лечения

1

Назначена диуретическая терапия

4

C

2

Выполнена операция по устранению частичного аномального дренажа легочных вен

4

C

Этап послеоперационного контроля

1

Выполнена эхокардиография перед выпиской из стационара

4

C

2

Пациент направлен на реабилитационное долечивание

4

C

Список литературы

1. Hoffman JIE, Kaplan S. The incidence of congenital heart disease. J Am CollCardiol. 2002; 39: 1890 — 900.

2. Kouchoukos N.T., Blackstone E.H., Hanley F.L., Kirklin J.K. Kirklin/Barratt-Boyes cardiac surgery: morphology, diagnostic criteria, natural history, techniques, results, and indications. — 4th ed. Philadelphia: Elsevier; 2013.

3. Купряшов А.А. Дефект межпредсердной перегородки. Частичный аномальный дренаж легочных вен. В кн.: Бокерия Л.А., Шаталов К.В. (ред.). Детская кардиохирургия. Руководство для врачей. ФГБУ «НМИЦССХ им. А.Н. Бакулева» МЗ РФ, 2016, с. 294 — 312.

4. Alsoufi B, Cai S, Van Arsdell GS, Williams WG, Caldarone CA, Coles JG. Outcomes after surgical treatment of children with partial anomalous pulmonary venous connection. Ann Thorac Surg. 2007; 84: 2020 — 6.

5. Dupuis C., Charaf L.A., Breviere G.M., Abou P., Remy-Jardin M., Helmius G. The «adult» form of the scimitar syndrome. Am J Cardiol. 1992; 70: 502 — 7.

6. Kittle C.F., Crockett J. E. Vena cava bronchovascular syndrome — a triad of anomalies involving the right lung: anomalous pulmonary vein, abnormal bronchi and systemic pulmonary arteries. Ann Surg. 1962; 156: 222 — 33.

7. Шарыкин А.С. Врожденные пороки сердца. Руководство для педиатров, кардиологов, неонатологов. М.: Теремок; 2005.

8. Бураковский В.И., Бокерия Л.А.//Сердечно-сосудистая хирургия//М., 1996.

9. Зиньковский М.Ф. Врожденные пороки сердца. К.: Книга плюс; 2008.

10. Notomi Y., Srinath G., Shiota T., Martin-Miklovic M.G., Beachler L., Howell K. et al. Maturational and adaptive modulation of left ventricular torsional biomechanics: Doppler tissue imaging observation from infancy to adulthood. Circulation. 2006; 113: 2534 — 41.

11. Pascotto M., Caso P., Santoro G., Caso I., Cerrato F., Pisacane C. et al. Analysis of right ventricular Doppler tissue imaging and load dependence in patients undergoing percutaneous closure of atrial septal defect. Am J Cardiol. 2004; 94(9): 1202 — 5.

12. Клинические рекомендации: Наджелудочковые нарушения ритма сердца у взрослых. http://cr.rosminzdrav.ru/#!/schema/242#doc_abbreviation (дата обращения 18.06.2019 г.).

13. Клинические рекомендации: Фибрилляция и трепетание предсердий у взрослых. http://cr.rosminzdrav.ru/#!/schema/888#doc_a1 (дата обращения 18.06.2019 г.).

14. Oliver JM, Gallego P, Gonzalez A, Benito F, Mesa JM, Sobrino JA. Predisposing conditions for atrial fibrillation in atrial septal defect with and without operative closure. Am J Cardiol. 2002; 89: 39 — 43.

15. Clark EB, Kugler JD. Preoperative secundum atrial septal defect with coexisting sinus node and atrioventricular node dysfunction. Circulation. 1982; 65: 976 — 80.

16. Bolens M, Friedli B. Sinus node function and conduction system before and after surgery for secundum atrial septal defect: an electrophysiologic study. Am J Cardiol. 1984; 53: 1415 — 20.

17. Dupuis C, Charaf LA, Breviere GM, Abou P. «Infantile» form of the scimitar syndrome with pulmonary hypertension. Am J Cardiol. 1993; 71: 1326 — 30.

18. Mordue BC. A case series of five infants with scimitar syndrome. Adv Neonatal Care. 2003; 3: 121 — 32.

19. Beitzke A, Zobel G, Rigler B, Stein JI, Suppan C. Scimitar syndrome with absence of the right pulmonary artery: a case with volumeinduced, reversible, left-sided pulmonary hypertension. PediatrCardiol. 1992; 13: 119 — 21.

20. Рыбка М.М., Хинчагов Д.Я., Мумладзе К.В., Лобачева Г.В., Ведерникова Л.В. Под ред. Л.А. Бокерия. Протоколы анестезиологического обеспечения кардиохирургических операций, выполняемых у новорожденных и детей. Методические рекомендации. М.: НЦССХ им. А.Н. Бакулева РАМН; 2014.

21. Рыбка М.М., Хинчагов Д.Я. Под ред. Л.А. Бокерия. Протоколы анестезиологического обеспечения кардиохирургических операций, выполняемых при ишемической болезни сердца, патологии клапанного аппарата, нарушениях ритма, гипертрофической кардиомиопатии, аневризмах восходящего отдела аорты у пациентов различных возрастных групп. Методические рекомендации. М.: НЦССХ им. А.Н. Бакулева РАМН; 2015.

22. Рыбка М.М., Хинчагов Д.Я., Мумладзе К.В., Никулкина Е.С. Под ред. Л.А. Бокерия. Протоколы анестезиологического обеспечения рентгенэндоваскулярных и диагностических процедур, выполняемых у кардиохирургических пациентов различных возрастных групп. Методические рекомендации. М.: НЦССХ им. А.Н. Бакулева РАМН; 2018.

23. Подзолков В.П., Кассирский Г.И. (ред.). Реабилитация больных после хирургического лечения врожденных пороков сердца. М.: НЦССХ им. А.Н. Бакулева; 2015.

24. Фальковский Г.Э., Крупянко С.М. Сердце ребенка: книга для родителей о врожденных пороках сердца. — М.: Никея, 2011.

Приложение А1

СОСТАВ РАБОЧЕЙ ГРУППЫ

1. Бокерия Л.А., академик РАН (Москва), Ассоциация сердечно-сосудистых хирургов России

2. Свободов А.А., д.м.н. (Москва)

3. Арнаутова И.В., д.м.н. (Москва)

4. Белов В.Н., д.м.н. (Калининград)

5. Борисков М.В., д.м.н. (Краснодар)

6. Волков С.С., к.м.н. (Москва)

7. Горбатиков К.В., д.м.н. (Тюмень)

8. Горбатых Ю.Н., д.м.н. (Новосибирск)

9. Горбачевский С.В., проф. (Москва)

10. Гущин Д.К. (Москва)

11. Ермоленко М.Л., д.м.н. (Москва)

12. Зеленикин М.А., проф. (Москва), Ассоциация сердечно-сосудистых хирургов России

13. Зеленикин М.М., проф. (Москва), Ассоциация сердечно-сосудистых хирургов России

14. Ким А.И., проф. (Москва)

15. Кокшенев И.В., проф. (Москва)

16. Кривощеков Е.В., д.м.н. (Томск)

17. Крупянко С.М., д.м.н. (Москва)

18. Купряшов А.А., д.м.н (Москва)

19. Мовсесян Р.Р., д.м.н. (С-Петербург), Ассоциация сердечно-сосудистых хирургов России

20. Никифоров А.Б. (Москва)

21. Петрушенко А.В., к.м.н. (Казань)

22. Плотников М.В., к.м.н. (Астрахань)

23. Подзолков В.П. академик РАН (Москва)

24. Сабиров Б.Н., д.м.н. (Москва)

25. Синельников Ю.А., д.м.н. (Пермь)

26. Сокольская Н.О. д. м.н., (Москва)

27. Туманян М.Р., проф. (Москва)

28. Шаталов К.В., д.м.н. (Москва)

29. Шмальц А.А., д.м.н. (Москва)

30. Черногривов А.Е., д.м.н. (Пенза), Ассоциация сердечно-сосудистых хирургов России

Конфликт интересов отсутствует. Все члены Рабочей группы подтвердили отсутствие финансовой поддержки/конфликта интересов, о которых необходимо сообщить.

Приложение А2

МЕТОДОЛОГИЯ РАЗРАБОТКИ КЛИНИЧЕСКИХ РЕКОМЕНДАЦИЙ

Целевая аудитория разработанных клинических рекомендаций:

1. Врач-педиатр

2. Врач-кардиолог

3. Врач — детский кардиолог

4. Врач — сердечно-сосудистый хирург

5. Врач-хирург

6. Врач ультразвуковой диагностики

Таблица П1. Уровни убедительности рекомендаций

Уровень убедительности

Основание рекомендации

A

Основана на клинических исследованиях хорошего качества, по своей тематике непосредственно применимых к данной специфической рекомендации, включающих по меньшей мере одно РКИ

B

Основана на результатах клинических исследований хорошего дизайна, но без рандомизации

C

Составлена при отсутствии клинических исследований хорошего качества, непосредственно применимых к данной рекомендации

Таблица П2. Уровни достоверности доказательности

Уровень достоверности

Тип данных

1a

Мета-анализ рандомизированных контролируемых исследований (РКИ)

1b

Хотя бы одно РКИ

2a

Хотя бы одно хорошо выполненное контролируемое исследование без рандомизации

2b

Хотя бы одно хорошо выполненное квазиэкспериментальное исследование

3

Хорошо выполненные не экспериментальные исследования: сравнительные, корреляционные или «случай-контроль»

4

Экспертное консенсусное мнение либо клинический опыт признанного авторитета

Порядок обновления клинических рекомендаций

Механизм обновления клинических рекомендаций предусматривает их систематическую актуализацию — не реже чем один раз в три года или при появлении новой информации о тактике ведения пациентов с данным заболеванием. Решение об обновлении принимает МЗ РФ на основе предложений, представленных медицинскими некоммерческими профессиональными организациями. Сформированные предложения должны учитывать результаты комплексной оценки лекарственных препаратов, медицинских изделий, а также результаты клинической апробации.

Приложение А3

СВЯЗАННЫЕ ДОКУМЕНТЫ

1. Об основах охраны здоровья граждан в Российской Федерации (ФЗ от 21.11.2011 N 323-ФЗ)

2. Порядок оказания медицинской помощи больным с сердечно-сосудистыми заболеваниями (Приказ Минздрава России от 15.11.2012 N 918н)

3. Приказ Министерства здравоохранения и социального развития Российской Федерации от 17 декабря 2015 г. N 1024н «О классификации и критериях, используемых при осуществлении медико-социальной экспертизы граждан федеральными государственными учреждениями медико-социальной экспертизы».

Ведение пациентов с ЧАДЛВ

Частичный аномальный дренаж легочных вен обычно сочетается с наличием межпредсердного сообщения (дефект межпредсердной перегородки, открытое овальное окно) и неправильным аномальным впадением одной или двух легочных вен в правое предсердие вместо левого. При существовании отверстия в перегородке возникает шунт со сбросом крови слева направо. При ДМПП кровь из левого предсердия частично уходит в правое при каждом сокращении. Соответственно правые камеры сердца переполняются, т.к. им приходится пропускать через себя, лишний объем крови, да еще один раз прошедший через легкие. Поэтому легочные сосуды переполнены кровью. Отсюда склонность к пневмониям. Давление, однако, в предсердиях низкое, а правое предсердие — самая «растяжимая» камера сердца. Поэтому оно, увеличиваясь в размерах, справляется с нагрузкой до поры до времени достаточно легко.

Новорожденные и грудные дети, да и дети раннего возраста в подавляющем большинстве растут и развиваются абсолютно нормально. Родители могут замечать их склонность к частым простудам, иногда заканчивающихся воспалением легких, что должно насторожить. Часто эти дети растут бледными, худенькими и несколько отличаются от своих здоровых сверстников.

Жалобы на сердце могут и, как правило, появляются в отроческом возрасте. Обычно это жалобы на «перебои» сердечного ритма, который человек ощущает. Со временем они становятся чаще, а иногда приводят к тому, что больной становится уже неспособным к нормальным, обычным физическим нагрузкам. Чтобы избежать подобного «естественного» течения порока, рекомендуют отверстие закрывать хирургическим путем, а аномально дренирующие легочные вены перемещать в левое предсердие. Операцию это не усложняет: просто заплата — больше и делается в виде тоннеля в полости правого предсердия, направляющего окисленную в легких кровь в левые отделы сердца. В любом случае вмешательство носит не срочный характер. Но нужно делать его в раннем детстве, если частота простуд, и особенно пневмоний, становится устрашающей и угрожает бронхиальной астмой, а размеры сердца увеличиваются. Вообще, чем раньше будет сделана операция, тем быстрее ребенок и вы о ней забудете.

Нет.

Изменяющийся транскриптом эмбриона мыши во всей ткани и разрешении отдельных клеток

Никаких статистических методов не использовалось для предварительного определения размера выборки. Эксперименты не были рандомизированы, и исследователи не были закрыты для распределения во время экспериментов и оценки результатов.

Объемная последовательность РНК из тканей эмбриона мыши

Репликация измельченной объединенной ткани эмбриона мыши из временных точек E10.5, E11.5, E12.5, E13.5 E15.5 и E16.5 были получены из лаборатории Ren. который поставлял эти ткани для всего проекта разработки мышей 50 .Ткани E14.5 и P0 были препарированы у отдельных животных в Калтехе. Повторные образцы тканей лизировали и экстрагировали с использованием протокола Ambion mirVana (AM1560). Остаточную геномную ДНК удаляли с помощью набора Ambion Turbo DNA-free (AM1907). Суммарную РНК определяли количественно с помощью Qubit, а значения RIN собирали с помощью набора BioAnalyzer Pico RNA (5067-1513). Среднее значение RIN составило 9,7 (CV = 4,4%). Каждая библиотека кДНК была построена с использованием 10 нг тотальной РНК с добавлением шипов ERCC (AM4456740), разведенных 1: 5000 в UltraPure H 2 O (InVitrogen 10977023), содержащем тРНК-носитель (AM7119) в концентрации 100 нг / мкл, ингибитор РНКаз (Clontech 2313A). 1 ед. / мкл и DTT (Promega P1171) при 1 мМ.кДНК подвергали обратной транскрипции и амплифицировали в соответствии с протоколом набора SMARTer UltraLow ​​RNA для Illumina (634935) с использованием обратной транскриптазы Clontech SMARTScribe (639536) и праймеров TSO, прайминга и амплификации dT из протокола 5 Smart-seq2. нить продукта очищали на шариках Ampure XP, а затем амплифицировали с использованием набора для ПЦР Clontech Advantage 2 (639207) с 13 циклами ПЦР и временем продления 12 мин. После второго раунда очистки Ampure XP амплифицированная кДНК была количественно определена на Qubit, а распределение по размерам проверено с помощью набора HS DNA BioAnalyzer (5067-4626).Затем библиотеки кДНК были помечены с использованием набора для подготовки ДНК Illumina / Nextera (FC 121-1030) индексными метками от Illumina (FC 121-1031), очищены гранулами Ampure XP, количественно определены на Qubit и измерены с помощью набора Agilent HS DNA. Библиотеки были секвенированы на Illumina HiSeq 2500 как односторонние чтения 100 пар оснований до глубины выровненного чтения 30M. Включение для представления ENCODE требовало повторных оценок соответствия по корреляции Спирмена значений FPKM> 0,9.

Измерения транскриптома отдельных клеток с использованием Fluidigm C1 и 10x Genomics v2

В каждый момент времени использовалась одна пара эмбриональных передних конечностей одной мыши (E10.5, E11.0, E11.5, E12.0, E13.0, E13.5, E14.0, E15.0). После отделения от туши конечности инкубировали в капле 50 мкл 10% раствора коллагеназы (Worthington LS004202) в течение 5 минут при 37 ° C. Затем конечности визуализировали под диссекционным микроскопом, и эктодерму удаляли вручную с помощью пары щипцов Дюмона № 5, что привело к снижению репрезентативности эпителиальных клеток в данных с высоким разрешением. Затем мезенхимальное ядро ​​зачатка конечности переносили в каплю 200 мкл Accumax (AM105), и чашку повторно инкубировали в течение 15 минут при комнатной температуре.Затем клетки один раз растирали вручную с помощью наконечника P200, чтобы суспендировать их, и пипетировали в 500 мкл DMEM + 10% FBS. Клетки конечностей центрифугировали при 500– г в течение 5 мин при 4 ° C, ресуспендировали в 500 мкл свежей среды DMEM + 10% FBS и пропускали через сито 20 мкм (Miltenyi 130-101-812). Затем их подсчитывали и разводили в DMEM + 10% FBS для достижения конечной концентрации 250 000 клеток / мл. Двенадцать микролитров этой суспензии добавляли к 8 мкл реагента для суспензии клеток Fluidigm для загрузки в Fluidigm IFC (размер 10-17 мкм).Затем клетки визуально обследовали на наличие дублетов и пустых камер и возвращали в С1 для лизиса, обратной транскрипции и амплификации с использованием протокола SMART-Seq v4. Буфер для лизиса: 8,6 мкл воды, 1 мкл загрузочного буфера C1, 2,4 мкл праймера Smart-seq2 oligo dT (10 мМ), 2,4 мкл Clontech 10 мМ dNTP, 2 мкл шипов ERCC (AM4456740) (разведенных 1: 40 000 в UltraPure H 2). O (InVitrogen 10977023), содержащий тРНК-носитель (AM7119) в концентрации 200 пг / мкл, ингибитор РНКазы (Clontech 2313A) в концентрации 1 ед. / Мкл и DTT (Promega P1171) в концентрации 1 мМ), 0.5 мкл 100 мМ DTT, 2,6 мкл одноклеточного реакционного буфера Clontech. Реакция обратной транскрипции: 5,6 мкл буфера транскрипции Clontech 10x, 0,6 мкл буфера для загрузки C1, 5,6 мкл Smart-seq2 TSO (10 мМ), 0,4 мкл ингибитора РНКазы Clontech, 2,8 мкл Clontech SMARTScribe. Реакция ПЦР: 4,4 мкл воды, 4,5 мкл загрузочного буфера C1, 75,2 мкл буфера Clontech SeqAmp, 3 мкл праймеров для амплификации Smart-seq2 (10 мМ) и 2,9 мкл полимеразы Clontech SeqAmp.

Образцы амплифицированной кДНК разводили в 10 мкл реагента для разведения ДНК C1, и аликвоту по 1 мкл каждого количественно определяли на Qubit.Одиннадцать образцов из IFC были отобраны для определения размера BioAnalyzer на основе урожайности и занятости камеры. Аликвоту библиотек кДНК разводили до 0,1–0,3 нг / мкл с использованием реагента C1 Harvest, а затем библиотеки метили с использованием набора для подготовки образцов ДНК Nextera XT (FC 131-1096) и индексов Nextera XT (FC 131-1002). . После мечения и амплификации библиотеки объединяли, дважды очищали гранулами Ampure XP (0,9 × объем), определяли количественно на Qubit и определяли размер на BioAnalyzer с использованием набора HS DNA.

Затем библиотеки секвенировали как 50-парные единичные считывания на глубину примерно 1М выровненных считываний на Illumina Hi-Seq 2500.

10х одноклеточные библиотеки Genomics получали из суспензий одноклеточных, описанных выше, нацеленных на 10000 клеток на библиотеку, как описано в протоколе производителя. Они были секвенированы в виде парных концевых библиотек размером 150 пар оснований на глубину 400 млн считываний каждой на Illumina Hi-Seq 4000.

Картирование считывания и количественная оценка

Все последовательности РНК всей ткани и последовательность одноклеточной РНК C1 данные обрабатывались через стандартный конвейер ENCODE (https: // www.encodeproject.org/pipelines/ENCPL002LSE/), который использует STAR для сопоставления необработанных считываний с геномом mm10 с пиками и количественно оценивает распространенность транскриптов с помощью RSEM, который предоставляет значения FPKM, TPM и count. Последующий анализ в основном проводился с использованием скриптов MATLAB (https://github.com/brianpenghe/Matlab-genomics). Данные 10x одноклеточных последовательностей РНК были обработаны с использованием CellRanger с совместимой аннотацией GTF и «—expect-cells 10000».

Целотканная РНК-seq PCA, CCA и иерархическая кластеризация

гена тРНК и гены, охваченные менее чем 10 прочтениями во всех тканях, были удалены.PCA выполняли по log 2 -трансформированным значениям FPKM, с добавлением 0,1 в качестве псевдосчетов, чтобы демаскировать относительно низко экспрессируемые транскрипты, чтобы обеспечить высокую чувствительность анализов RNA-seq для всей ткани. Z -оценки собственных значений из PCA использовались для визуализации «оценок ПК», в то время как коэффициенты собственных векторов из PCA использовались для визуализации «загрузок ПК». Гены с самыми высокими положительными значениями и самыми низкими отрицательными значениями были использованы для интерпретации биологических значений для каждого ПК.

Канонический корреляционный анализ (CCA) был проведен на 20 основных компьютерах и булевых переменных для идентификации тканей, стадий, пола и метаданных рассечения. Стандартизованные оценки канонических переменных были визуализированы с использованием тепловой карты на рис. 6c с расширенными данными, тогда как баллы z выборочных канонических коэффициентов были визуализированы с использованием тепловой карты на рис. 6b, d с расширенными данными. Коэффициенты загрузки гена канонической корреляции вычисляли путем умножения матрицы коэффициентов загрузки гена PC (из PCA) и коэффициентов загрузки PC с канонической корреляцией (из CCA).Гены с наивысшими положительными значениями и наименьшими отрицательными значениями использовали для интерпретации биологических значений для каждого CC (дополнительные данные 3).

Динамические гены были определены как гены с не менее чем десятикратной разницей в значениях FPKM между наиболее и наименее многочисленными образцами РНК; гены с менее чем десятикратным различием были определены как плоские или повсеместные. Динамические гены и вездесущие гены были разделены на разные классы (кодирующие белки и т. Д.) На основе типов генов, аннотированных GENCODE M4.Односторонняя и двусторонняя иерархическая кластеризация выполнялась с использованием коэффициента корреляции Пирсона и среднего сцепления для динамических генов. Кластеры определялись путем прохождения от корня дерева к листьям и разделения клад с различными доминирующими тканями и терминами GO, распознаваемыми вручную, до тех пор, пока больше не могло быть разделено больше основных кластеров. Клады, содержащие не менее 30 узлов, были определены как основные кластеры. Чтобы проверить надежность результатов, мы провели независимый анализ с удаленными передним мозгом, задним мозгом и нервной трубкой, чтобы уменьшить представление ЦНС, используя ту же методологию.Другой независимый анализ был выполнен с использованием значений TPM для всех тканей с использованием той же методологии. Основные выводы во многом остались такими же.

Анализ транскрипционного фактора последовательности РНК-seq всей ткани

Экспрессионных векторов TF использовали для создания t -SNE и карт кластеризации с использованием тех же параметров, что и при анализе полного транскриптома. Семейства факторов транскрипции сравнивали с идентичностями кластера. Для оценки обогащения был проведен гипергеометрический тест.

Определение пола эмбриона

Для образцов, которые были сделаны из одиночных эмбрионов, мы вывели их пол, сравнив уровни экспрессии генов Xist (женский маркер) и Ddx3y (мужской маркер). Эмбрионы, экспрессирующие только Xist , являются женскими, в то время как те, которые экспрессируют только Ddx3y , являются мужскими. В смешанных пулах эмбрионов были обнаружены оба гена.

Анализ повсеместных генов

Среди генов, определяемых как повсеместные с помощью анализа РНК-секвенирования всей ткани, гены с log 2 (FPKM + 0.1) значения не выше 2 были удалены. 3000 генов с наименьшей дисперсией выборки были одинаково разделены на группы с высоким, средним и низким уровнем на основе их средних значений FPKM.

Считывания GRO-seq и Bru-seq были сопоставлены и количественно оценены с использованием стандартного конвейера ENCODE для согласованности вычислений. Средние длины 3 ‘UTR для каждого гена были извлечены из аннотации GENCODE M4. Значения log 2 (FPKM + 0,1) и log 2 (длина 3 ′ UTR) использовались для сравнений и линейной регрессии.

Анализ модификации гистона

Данные модификации гистона ChIP – seq были обработаны с использованием конвейера ENCODE ChIP – seq (https://www.encodeproject.org/pipelines/ENCPL220NBH/), и зарегистрировать 2 -кратное изменение для ChIP – seq образцы по входным элементам управления были рассчитаны и построены с использованием deepTools2.4.1 (https://github.com/fidelram/deepTools/tree/2.4.1). Чтобы суммировать кратное уменьшение сигналов модификации гистонов в конкретном образце среди определенного кластера генов, было использовано окно размером 4 т.п.н., охватывающее TSS в центре, и были рассчитаны и визуализированы средние log 2 -кратные изменения по сравнению с входными образцами с использованием 3D-участок с подогревом.Снижение кратности представляет собой разницу между кратным изменением самого раннего и последнего момента времени. Перекрытие цели отдыха P Значение было рассчитано на основе гипергеометрического теста с использованием списка целей iQNP Rest ChIP – seq, опубликованного ранее 24 .

Анализ онтологии генов

FuncAssociate 3.0 (http://llama.mshri.on.ca/funcassociate/) использовался с настройками по умолчанию для вызова термина.

Кластеризация скРНК C1 и визуализация

t -SNE

Значения FPKM гена спайка и тРНК были удалены, чтобы изменить масштаб значений FPKM.Библиотеки без клеток или более одной клетки в соответствующих камерах C1, обнаруженные под микроскопом, были удалены. Все библиотеки из одного и того же чипа C1 Fluidigm, которые имели систематическое смещение покрытия 3 ‘, были удалены. Клетки с менее чем 100000 считываний, сопоставленных с транскриптомом, или менее 4000 генов с пороговым значением 10 FPKM были удалены. Гены, которые были экспрессированы менее чем в 5 клетках (0,5%) или при уровне ниже 10 FPKM во всех клетках, или которые были покрыты менее чем 100 картированными считываниями во всех клетках, были отфильтрованы.Затем мы использовали log 2 -преобразованных значений псевдосчета FPKM + 1 для следующих анализов. Гены были ранжированы на основе их оценок дисперсии (определяемых дисперсией выборки над средним значением выборки). Были отобраны 1500 лучших генов, из которых были отфильтрованы некодирующие гены и гены митохондрий, в результате чего осталось 1269 генов. t Проекция -SNE была сделана на основе этих генов с использованием 30 лучших ПК и 30 в качестве параметра недоумения (по умолчанию для исходного сценария MATLAB Лоренса ван дер Маатена) 56 .Затем была выполнена двусторонняя иерархическая кластеризация значений FPKM, преобразованных в журнал 2 , с использованием полной связи с коэффициентом ранговой корреляции Спирмена для кластеризации ячеек. Типы клеток аннотированы вручную.

10-кратная кластеризация scRNA-seq и визуализация

t -SNE

подсчетов UMI из CellRanger были отфильтрованы в первую очередь, где были удалены клетки с менее чем 1000 обнаруженных генов и гены, обнаруженные менее чем в 0,1% клеток. В каждой ячейке подсчеты были разделены на сумму, умножены на 10 000, добавлены к 1 и преобразованы в логарифмический формат.Были определены первые 4000 генов с высокой дисперсией. Чтобы удалить шум (https://github.com/brianpenghe/python-genomics), мы сначала выполнили иерархическую кластеризацию для этих генов, а затем извлекли гены, которые попали в « плотные » кластеры (те, которые имеют более двух членов после разрезания дендрограммы на 0,8), удалив большое количество спорадических генов, которые имели высокие показатели дисперсии, но едва коэкспрессировались с другими генами. Эти гены были использованы вместо «генов с высокой степенью вариабельности» для конвейера Сёра.С помощью конвейера Сёра были удалены клетки с более чем 20% прочитанных митохондрий или обнаруженными более 8000 генов. Гены регрессировали по количеству UMI на клетку и процент митохондрий и масштабировали. Полученная матрица, управляемая вышеупомянутыми генами признаков, была использована для выполнения PCA. Затем был проведен Jackstraw с использованием настроек Сера по умолчанию, в результате чего было получено 42 значимых ПК. Эти ПК, в свою очередь, использовались для кластеризации ячеек Лувена и визуализации t -SNE. Кластеры 3, 4, 5, 6, 8, 12 и 13 были дополнительно повторно кластеризованы с использованием того же метода, в результате чего были получены кластеры 17–24.

Идентификация гена-маркера для данных C1 и 10x scRNA-seq

Гены-маркеры (дополнительные данные 4) были рассчитаны с использованием функции FindMarkers Сера () как для данных C1, так и для одноклеточных данных 10x с min.pct = 0,25 и суммой рангов Вилкоксона по умолчанию тест с min.diff.pct, установленным на 0,2 или 0,4. Для визуализации маркеров выборка каждого типа ячеек была понижена до не более 100 ячеек для данных 10x и не более 30 ячеек для данных C1. Min.diff.pct был установлен равным 0,2, и были визуализированы 15 верхних маркеров для каждого типа клеток.

Сравнение типов ячеек C1 и 10x

Для сравнения аннотаций типов ячеек для данных C1 и 10x использовались два метода. На основе метода Seurat3 «перенос метки» привязки передачи были рассчитаны на основе данных 10x и использовались для прогнозирования типов ячеек для данных C1. Независимо, масштабированная 10-кратная матрица данных использовалась для обучения модели полиномиальной логистической регрессии с использованием пакета scikit-learn. Обученная модель использовалась для прогнозирования типов ячеек для данных C1.

Интеграция данных C1 и 10x для визуализации UMAP

Seurat3 использовался для расчета привязок интеграции и интеграции двух разных типов наборов данных.Совместный набор был масштабирован и визуализирован в UMAP на основе произвольных 50 лучших компьютеров.

Анализ траектории происхождения

Перед выводом происхождения дублеты были удалены с использованием схемы подкластеризации 57,58 на основе Скрублета. Затем для анализа траектории 10-кратных данных, содержащих большое количество ячеек, использовали Monocle3 alpha (2.99.3). Функция plot_pc_variance_explained () использовалась для выбора значимых ПК выше порогового значения. Применена визуализация UMAP и метод SimplePPT.Корневой узел для каждого дерева родословной был определен как узел, который соединяется с наибольшим количеством клеток с самого раннего момента времени развития (E10.5).

Анализ дифференциальных факторов транскрипции

Факторы транскрипции, зарегистрированные в TFDB (http://bioinfo.life.hust.edu.cn/AnimalTFDB/), были выбраны из маркерных генов, полученных с пороговым значением 0,2 (описано выше), чтобы сделать вывод на основе доказательств. сети взаимодействия с использованием STRING 59 (https://string-db.org/). Интерфейс Python для STRING использовался для прямого запроса базы данных и визуализации результирующего графика с помощью Graphviz 60 .Были использованы грани типа «база данных» и «экспериментальный», отфильтрованные для соответствия значению достоверности более 0,400. Узлы были окрашены с использованием нормализованных значений, полученных из Scanpy 61 . График был построен с использованием программного обеспечения для верстки, входящего в пакет Graphviz. Используемый алгоритм — SFDP. Полная база кода, а также рецепты контейнеров Docker и Singularity доступны в репозитории GitHub: https://github.com/hamrhein/mouse_embryo.

IDEAS состояния

Эпигенетические состояния IDEAS на данных развития мыши ENCODE3 были сгенерированы с помощью программного обеспечения IDEAS 13,14 с использованием десяти эпигенетических меток: h4K27ac, h4K27me3, h4K36me3, h4K4me1, h4K4me3, h4K4me3, h4K4me3, h4K4me3, h4K4me3, h4K4me3, h4K4me3 seq и данные метилирования ДНКазы.Сначала мы преобразовали необработанные данные в каждой выборке в значения –log 10 P , используя отрицательную биномиальную модель. Среднее значение и параметры дисперсии модели для каждой выборки были рассчитаны с использованием нижних 99% данных. Затем мы скорректировали средние параметры в каждой позиции генома из входных данных, чтобы учесть локальные геномные вариации. В частности, мы загрузили входные данные для каждой ткани (см. Список наборов данных) и вычислили скользящие средние на геномную позицию, используя окно размером 20 kb с центром в позиции, как для сигналов, так и для входных.Отношение между двумя средними в каждой позиции было умножено на общую среднюю оценку выборки, и мы нормализовали отношения по геному, получив среднее значение 1. Мы обработали –log 10 (значение P ) в качестве входных данных. для IDEAS — 16, и мы запустили программу с настройками по умолчанию. Результатом IDEAS является набор геномных треков для отображения в браузере генома, где каждому эпигенетическому состоянию назначается цвет в виде взвешенной смеси цветов, предварительно назначенных программой для каждой эпигенетической метки.Доступ к сегментации IDEAS можно получить по ссылке Hub по адресу http://woldlab.caltech.edu/ENCODE3_Mouse_RNA_paper_yuzhang_me66n/.

Идентификация маркерного гена, специфичного к типу клеток и клону, и присвоение cCRE

Гены, экспрессируемые исключительно в одном типе или клоне клеток, рассматривались как «маркерные гены» для этой серии анализов. Используя данные высокого разрешения C1 Fluidigm, гены-маркеры с отсечкой 0,2 или 0,4 были перекрестно пересечены для получения исключительно экспрессируемых маркеров типов клеток или групп родственных типов клеток (мышцы 1 + мышцы 2, мышцы 2 + мышцы 3, мышцы 1-3. , Хондроцит + перихондрий, EMP + макрофаг и т. Д.). Кандидат cis — регулирующие элементы (cCRE) были определены путем слияния всех пиков DHS, вызываемых конвейером ENCODE HOTSPOT2. Эти слитые области были отнесены к ближайшим сайтам начала транскрипции генов, которые экспрессируются (FPKM выше 0,1 в по крайней мере в одном объеме ткани конечности или обнаруживается более чем в четырех клетках в одноклеточных данных конечностей). Эти объединенные области затем сравнивали с состояниями хроматина IDEAS, полученными из данных о ходе развития мыши ENCODE3 (см. Ниже).Только пики, которые перекрывались с активным (состояние 14, 19, 20, 21, 23, 24, 25, 27, 28, 30–32), сбалансированным (8 и 13) или двухвалентным (26 и 29) состояниями ИДЕЙ, считались «IDEAS active DHS» (cCREs). Наконец, эти cCRE, отнесенные к TSS вышеупомянутых маркерных генов, были расценены как cCRE, специфичные для клеточного типа или линии. На основе расстояния между каждым cCRE и назначенным ему геном cCRE были дополнительно разделены на три категории: проксимальные (расстояние не более 200 п.н. в любом направлении), средние (расстояние больше 200 п.н. и не больше 2000 п.н. в любом направлении) и дистально (расстояние больше 2000 п.н. в любом направлении).

Анализ мотивов

Для анализа промоторных мотивов РНК-seq целых тканей вышестоящие последовательности 500 п.н. каждого кластера коэкспрессии были извлечены и объединены. Для анализа промотора гена, ассоциированного с типом клеток конечностей, были извлечены и объединены вышестоящие последовательности из 500 п.н. маркерных генов каждого типа клеток (полученные из 10x данных с использованием Seurat, min.diff.pct = 0,4). Для анализа cCRE, ассоциированного с типом клеток конечностей, последовательности ДНК проксимальных, средних или дистальных cCRE для маркерных генов каждого типа клеток были извлечены и объединены.Эти пулы последовательностей использовали для открытия мотивов. Подробную блок-схему можно найти на рис. 11 в расширенных данных.

Анализ мотивов распознавания транскрипционных факторов был проведен с использованием версии 4.11.2 пакета MEME-SUITE 62 . Мотивы, аннотированные в базе данных CIS-BP 55 (http://cisbp.ccbr.utoronto.ca/), использовали для оценки обогащения мотивов в пулах последовательностей, упомянутых выше; Обогащение оценивали по программе AME в MEME-SUITE 63 . Анализ проводился дважды на основе UCSC mm10 refFlat и GENCODE M4 отдельно и только для мотивов с исправленными значениями P меньше 0.01 в обоих анализах были названы значимыми.

Сравнение цельнотканевой RNA-seq и одноклеточной RNA-seq

10-кратные одноклеточные данные (без логарифмической трансформации или гауссовского масштабирования) и вышеупомянутые 10-кратные функциональные гены были использованы в качестве входных данных для CIBERSORT 27 (https: / /cibersort.stanford.edu/) для сравнения с данными РНК-seq для всей конечности (без логарифмического преобразования или гауссовского масштабирования). Чтобы сравнить сигнатуры генов, ассоциированных с типом клеток, с кластерами последовательностей РНК целых тканей ENCODE, были получены маркерные гены, ассоциированные с типом клеток ref. 11 (таблица S4 для названий генов и таблица S3 для названий типов ячеек из ссылки 11 ) и отфильтрованных (p_val <0,05 и q_val <0,05). Отметив, что CIBERSORT очень чувствителен к выбору набора входных генов, эти сигнатурные гены были сопоставлены с упорядоченной тепловой картой кластерограммы объемной ткани (рис. 1d). Для лучшей визуализации мы дрожали отдельные точки, чтобы создать измененный график роя, чтобы показать распределение местоположений (вместо количества) сигнатурных генов для каждой ячейки.

Иммуноцитохимическое обнаружение в тканевых срезах

Стадийные эмбрионы фиксировали в 4% PFA в PBS, криозащищали 30% сахарозой в PBS и замораживали в ОКТ на сухом льду. Криосрезы размером 10 микрометров блокировали с помощью реагента, блокирующего мышь на мышь от Vector (номер по каталогу MKB-2213), а затем окрашивали антителами к OSR1 (мышиный моноклональный образец Santa Cruz, каталожный номер 376545 при 1:40) и миогенином (Abcam RabMab cat. # ab124800 в 1:40). Вторичное обнаружение было выполнено с помощью InVitrogen donkey anti-rabbit Alexa 594 cat.# A21207, и InVitrogen козлиная антимышь Alexa 488 cat. # A11029, оба в разведении 1: 300. Срезы сначала просматривали на Zeiss Axio Observer Z.1, а затем отображали для микроскопии деконволюции с использованием Leica DMI6000 с иммерсионным объективом 63x и программного обеспечения деконволюции Huygens Professional от SVI.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этим документом.

Введение

Введение

В кортиевом органе млекопитающих (ОС) слуховые сенсорные волосковые клетки не регенерируют после повреждения, в отличие от слухового сенсорного эпителия других позвоночных [1].Основным механизмом, лежащим в основе этой регенеративной недостаточности, является отсутствие клеточной пролиферации в ответ на повреждение [2, 3]. Однако, когда клетки ОК диссоциируют и культивируют, они пролиферируют и генерируют мультипотентные отосферы [4]. Важно отметить, что клетки OC обычно находятся в состоянии покоя in vivo [5], но способны повторно входить в клеточный цикл после диссоциации и культивирования. Такое поведение предполагает, что клетки ОК обладают внутренним пролиферативным потенциалом, который ингибируется в условиях in situ.Таким образом, идентификация факторов, регулирующих выход из клеточного цикла in situ и повторный вход в клеточный цикл in vitro, может дать подсказки для индукции регенерации волосковых клеток.

Гомолог области 1 вставки Mo-MLV лимфомы белка B (Bmi1) является членом группы белков polycomb, которые образуют репрессивные комплексы, которые подавляют экспрессию генов за счет модуляции хроматина [6]. Предыдущие исследования показали, что Bmi1 поддерживает пролиферацию и развитие клеточного цикла нескольких популяций стволовых клеток (обзор в [7]), таких как нервные стволовые клетки [8] и гемопоэтические стволовые клетки [9].Bmi1-дефицитные мыши страдают от неврологического и гематопоэтического дефицита, предположительно из-за дефектов нервных и гематопоэтических стволовых клеток [10]. Ранее было показано, что Bmi1 способствует пролиферации клеток в нескольких типах клеток за счет репрессии локуса ink4a / arf, который кодирует два известных ингибитора клеточного цикла, а именно p16 ink4a и p19 arf [11, 12]. Интересно, что p16 ink4a и p19 arf проявляют свои антипролиферативные функции посредством различных механизмов.Супрессор опухолей p16 ink4a ингибирует циклин D-зависимые киназы CDK4 и CDK6 [13]. В отсутствие комплексов CDK4 / CDK6-циклин D белки ретинобластомы (Rb) остаются в неактивном гипофосфорилированном состоянии [13]. Гипофосфорилированный Rb, в свою очередь, связывается с факторами транскрипции фактора элонгации 2 (E2F), препятствуя их способности активировать гены, необходимые для вступления в S-фазу клеточного цикла [14]. Другой продукт локуса ink4a / arf, p19 arf , ингибирует пролиферацию, блокируя деградацию белка-супрессора опухолей p53 [15].В настоящем исследовании мы сосредоточились на p16 ink4a в качестве потенциальной нижестоящей мишени для Bmi1 из-за растущих доказательств того, что p16 ink4a участвует в возрастном снижении пролиферативной способности мозга [16], гемопоэтических стволовых клеток [16]. 17], островки поджелудочной железы [18] и скелетные мышцы [19].

Экспрессия

Bmi1 была показана в эмбриональной улитке [20], а также в постнатальных и зрелых OC [21]. Недавние исследования показали, что хотя неонатальные Bmi1-дефицитные OC обнаруживают нормальное морфологическое развитие, потеря Bmi1 приводит к снижению сферообразующей способности OC [21, 22].Однако неизвестно, связана ли эта пониженная способность к формированию сфер с изменениями экспрессии гена ink4a / arf в Bmi1-дефицитных сферах. Что еще более важно, остается неясным, почему потеря Bmi1 влияет на пролиферацию клеток в сферах, происходящих из OC in vitro, способом, который не наблюдается в развивающейся улитке in vivo.

Чтобы изучить функцию Bmi1 в ОК, мы использовали гомозиготную репортерную мышь Bmi1 GFP / GFP [23], которая использовалась в качестве модели потери функции Bmi1 в предыдущих исследованиях [24, 25].Отосферный анализ использовали в качестве инструмента для исследования пролиферативного потенциала Bmi1-дефицитных ОК. Наши данные показывают, что Bmi1 поддерживает пролиферативную способность отических предшественников in vitro в ассоциации с репрессией p16 ink4a .

Материалы и методы. Животные и генотипирование.

Эксперименты на животных были одобрены региональным советом Тюбингена (Regierungspräsidium) (разрешение экспериментов на животных HN4 / 14 и разрешение на использование животных для эксплантации органов от 27 июня 2012 г. и 27 июля 2015 г.).Все животные получили уход в соответствии с Директивой 2010/63 / ЕС о защите животных, используемых в научных целях.

Все животные были размещены в помещении для содержания животных в Тюбингенском университете. Мышей C57Bl / 6 покупали в Charles River Laboratories (Зульцфельд, Германия) (инвентарный номер Jax 005304). Мыши Bmi1-GFP [23] (инвентарный номер Jax 017351) были предоставлены Ирвингом Вайсманом (Стэнфордский университет). Генотипирование мышей Bmi1-GFP проводили с использованием образцов геномной ДНК.Выделение геномной ДНК выполняли с использованием реагента DirectPCR-EAR (Peqlab, Erlangen, Германия) и протеиназы K (Qiagen, Hilden, Германия). Праймеры для генотипирования были приобретены у Eurofins MWG Operon (Ebersberg, Германия). Отдельные протоколы ПЦР были выполнены для аллелей дикого типа и мутантных аллелей. Использовали следующие последовательности праймеров: 1) Обычный: GAGAATCCAGCTGTCCAGTGT; 2) Мутант Rev: GACACGCTGAACTTGTGGCCGTTTA; и 3) Дикого типа Rev: TACCCTCCACACAGGACACA.

ПЦР проводили с использованием шариков для ПЦР PuReTaq Ready-To-Go (GE Healthcare Europe GmbH, Фрайбург, Германия) в соответствии с протоколом производителя.

Сбор и фиксация ткани

Для определения паттерна экспрессии Bmi1 в улитке мыши мышей умерщвляли в следующие моменты времени: 1) эмбриональный день (E) 13,5: приблизительное время терминального митоза предшественников OC у мышей [5]; 2) постнатальный день (p) 0: когда ОК подвергается дифференцировке, но является незрелым; и 3) p28: когда ОК является функционально зрелым (n ≥ 4 животных для всех временных точек). Было начато спаривание по времени, и на следующее утро самок осмотрели на наличие вагинальной пробки; этот день тогда рассматривался как эмбриональный день 0.5 (E0.5). Цельные головки отдельных эмбрионов фиксировали в 2% растворе параформальдегида (PFA, Carl Roth GmbH, Карлсруэ, Германия) в течение 2 часов при 4 ° C. У мышей в раннем постнатальном периоде полуголовы фиксировали в 2% PFA в течение 2 часов при 4 ° C. Перед умерщвлением мышей в возрасте p14 и старше анестезировали CO 2 . Для фиксации улитки все внутреннее ухо вырезали из височной кости и фиксировали путем перфузии перилимфатических жидких пространств 4% PFA через открытые круглые и овальные окна с помощью шприца с иглой 30-го размера (Microlance ® , BD Biosciences. , Сан-Хосе, Калифорния, США).Затем улитки инкубировали в 4% PFA в течение 2 часов при 4 ° C.

Декальцификация, криозакрепление и криосекция

Для мышей в возрасте p7 и старше фиксированные улитки декальцинировали в 2 мМ этилендиаминтетрауксусной кислоте (EDTA, Sigma-Aldrich, St. Louis, MO, USA) в течение 24 часов при 4 ° C. Для криозащиты головы или изолированные улитки инкубировали в 5%, 10%, 15%, а затем 20% сахарозе (Merck-Millipore) в 1x PBS в течение 1 часа на разведение. Образцы хранили при 4 ° C в течение ночи в 30% сахарозе в 1x PBS.На следующий день головки или изолированные улитки были перенесены в цилиндрический сосуд из алюминиевой фольги, который затем был заполнен Tissue-Tek ® OCT Compound (Sakura Finetek, Zoeterwoude, Нидерланды) и хранился в — 80 ° С. Криосрезы получали толщиной 12 мкм с использованием криостата (Leica CM3050, Leica Biosystems, Wetzlar, Германия). Срезы помещали на предметные стекла SuperFrost ® Plus (Langenbrinck, Emmendingen, Germany), оставляли сушиться на 60 минут при комнатной температуре, а затем хранили при -80 ° C.

Иммуномечение и микроскопия

Характер экспрессии Bmi1 исследовали с помощью иммуногистохимии Bmi1 и с использованием репортерной линии мышей Bmi1-GFP, в которой экзон 2 нативной последовательности Bmi1 был заменен на GFP, что привело к нулевому аллелю [23]. Для иммуногистохимии Bmi1 срезы Bmi1 WT / WT (дикого типа, WT) метили моноклональным анти-Bmi1 антителом, срезы сетчатки использовали в качестве положительного контроля (данные не показаны), как описано ранее [26]. Для репортерной линии мышей Bmi1-GFP срезы Bmi1 GFP / WT (гетерозиготный, Het) были помечены анти-GFP-антителом, срезы двенадцатиперстной кишки использовались в качестве положительного контроля (данные не показаны), как описано ранее [27] .Bmi1 GFP / GFP животные не проявляют экспрессии Bmi1 [23], их считали нокаутом Bmi1 (KO) и использовали в качестве отрицательного контроля для иммуногистохимии. Извлечение антигена выполняли путем нагревания предметных стекол в натрий-цитратном буфере (pH 6,0) в течение 5 минут с использованием пароварки (только для иммуногистохимии Bmi1). Слайдам давали остыть в течение 5 минут, затем их пермеабилизировали 0,1% Triton X 100 (Sigma-Aldrich, Сент-Луис, Миссури, США) в 1x PBS и затем инкубировали с 5% нормальной ослиной сывороткой (NDS, Sigma- Aldrich) в 1 × PBS в течение 30 минут, чтобы заблокировать неспецифическое связывание.Когда использовали первичное антитело мыши, дополнительную стадию блокирования выполняли с помощью блокирующего реагента «мышь на мыши» (MOM ) (MKB-2213, Vector Laboratories, Burlingame, CA, USA) в течение 1 часа при комнатной температуре для блокирования флуоресценции. вызвано нативным мышиным IgG. Первичные антитела инкубировали в течение ночи при 4 ° C, а вторичные антитела инкубировали в течение 1 часа при комнатной температуре. Контр-окрашивание проводили с использованием ядерного красителя 4 ‘, 6-диамидино-2-фенилиндола (DAPI, Molecular Probes – Thermo Fisher Scientific, Waltham, MA, USA).Наконец, слайды закрывали покровными стеклами (R. Langenbrinck) с использованием монтажной среды FluorSave (Calbiochem-Merck, Дармштадт, Германия) и хранили в темноте при 4 ° C до микроскопического анализа. Список первичных и вторичных антител представлен в таблице S1. Флуоресцентную микроскопию выполняли с использованием Axio Imager M2 с блоком ApoTome.2 (Zeiss AG, Геттинген, Германия).

Выделение РНК, синтез кДНК и количественная ПЦР в реальном времени (qRT-PCR)

Bmi1 и p16 ink4a Уровни мРНК в ОК были количественно определены в образцах сенсорного эпителия улитки мышей C57Bl / 6 в семи точках времени развития: E13.5, p0, p4, p7, p14, p21 и p28. На каждой стадии развития анализировали 2 независимых образца (каждый образец содержал 4 объединенных образца OC). Для анализа отдельных образцов ОК различных генотипов образцы ОК WT, Het и KO собирали при p0 и анализировали независимо (каждый образец содержал два объединенных образца ОК от одной мыши). Для сфер, полученных из OC, образцы WT, Het и KO OC культивировали с использованием анализа отосферы в течение 5 дней in vitro (DIV) (см. Ниже), после чего сгенерированные сферы собирали и анализировали независимо (каждый образец содержал 2000–3000 сферы, полученные из двух ушей одной мыши).После микродиссекции ткани образцы сразу же помещали в буфер для лизиса набора RNA Water ® -Micro Kit (AM1931) (Ambion, Остин, Техас, США). Выделение РНК проводили с использованием того же набора. Синтез комплементарной ДНК (кДНК) выполняли с использованием набора Transcriptor High Fidelity cDNA Synthesis Kit (05081955001, Roche Diagnostics, Mannheim, Germany) в соответствии с протоколом производителя. Уровни транскриптов измеряли с помощью анализа Quant-iT на платформе количественного анализа Qubit (Thermo Fisher Scientific).Уровни мРНК измеряли с помощью qRT-PCR. Для каждой реакции qRT-PCR уровень кДНК доводили до 5 нг в общем объеме 20 мкл, и реакцию проводили с использованием LightCycler ® 480 Probes Master Mix (04707494001, Roche Diagnostics) в соответствии с протоколом производителя. Hprt, Tbp, Ubc и Gapdh использовались в качестве генов домашнего хозяйства. Зонды Bmi1, Hprt, Tbp, Ubc, Gapdh, Caspase-3 и Caspase-9 были разработаны RealTime Ready Single Assays (Roche Applied Science) со следующими идентификаторами анализа: Bmi1 (311828), Hprt (307879), Tbp (300314) , Ubc (311816), Gapdh (307884), каспаза-3 (300362) и каспаза-9 (300366).Для обнаружения мРНК p16 ink4a зонд TaqMan, конъюгированный с FAM, был приобретен у TIB Molbiol GmbH (Берлин, Германия) и использовался в комбинации со следующими праймерами: p16-Forward, GGTCGTACCCCGATTCAGGT и p16-Reverse, TCGAATCTGCACCAGTAGTTGG. Значения C T были определены с использованием программного обеспечения LightCycler ® 480 версии 1.5.0 SP4 (Roche Diagnostics), а относительное количественное определение было рассчитано по формуле 2 -ΔΔC T [28]. Для каждого образца измерения проводили трижды.

Otosphere assay

ОК однопометных пометов p0 Bmi1 WT / WT (WT), Bmi1 GFP / WT (Het) и Bmi1 GFP / GFP (KO) подвергали микродиссекции и культивировали, как описано ранее [4, 20]. Два ОК от каждого животного были сгруппированы вместе и считались одним образцом. Вкратце, образцы ОС инкубировали с 0,25% трипсином / ЭДТА (Sigma-Aldrich) в течение 15 минут при 37 ° C. Ферментативное расщепление трипсином останавливали добавлением ингибитора трипсина (Serva, Гейдельберг, Германия) и ДНКазы I (Уортингтон, Лейквуд, Нью-Джерси, США), и клетки механически диссоциировали путем растирания.Клетки подсчитывали с помощью камеры Нойбауэра и высевали в чашки Петри объемом 10 мл (Greiner Bio-one GmbH, Frickenhausen, Германия), содержащие среду, дополненную факторами роста, как описано ранее [20]. Культуральная среда состояла из среды Игла, модифицированной Дульбекко (DMEM) / среды F12 (смешанной 1: 1), с добавками N2 и B-27 (Gibco ® , Thermo Fisher Scientific) и ампициллином (100 мкг / мл, Sigma- Aldrich), в дополнение к факторам роста bFGF (10 нг / мл, R&D Systems, Миннеаполис, Миннесота, США) и IGF-1 (50 нг / мл, R&D Systems).Через 5 дней in vitro (5DIV) сферы визуально подсчитывали под инвертированным микроскопом с объективом 20x (Zeiss AG). После подсчета сфер к культуральной среде добавляли 10 мкМ 5-этинил-2′-дезоксиуридина (EdU) (Thermo Fisher Scientific) на дополнительные 24 часа. EdU представляет собой синтетический аналог тимидина, который включается во время синтеза ДНК в пролиферирующих клетках и, таким образом, используется в качестве маркера S-фазы клеточного цикла. На 6DIV суспензию сфер переносили на 8-луночные предметные стекла (BD Biosciences), которые были предварительно покрыты 10% Matrigel ® (с уменьшенным фактором роста, BD Biosciences).Затем сферы фиксировали 2% PFA в течение 15 минут при 4 ° C. Иммуномечение было проведено для Ki67, который маркирует все активные фазы клеточного цикла [29], и фосфогистона h4 (pHh4), маркера М-фазы [30]. Маркировка EdU проводилась в соответствии с инструкциями производителя. Число клеток на сферу определяли путем подсчета ядер, меченных DAPI. EdU-, Ki67- или pHh4-положительные клетки подсчитывали в сферах каждого генотипа. Для каждого маркера анализировали 100 сфер (50 сфер x 2 животных) на группу.

Вирусная трансдукция культур отосферы

Образцы ОС мышей C57Bl / 6 собирали при p0 – p2. Образцы ОС были диссоциированы, и суспензия клеток культивировалась в среде, дополненной факторами роста, как описано выше. Два вирусных вектора (Vector BioLabs, Малверн, Пенсильвания, США) использовали для трансдукции клеток в культурах отосферы. Оба вектора представляют собой рекомбинантные аденовирусы с делециями в областях E1 и E3 (тип 5 dE1 / E3), что делает их дефектными по репликации.Для сверхэкспрессии p16 ink4a использовали аденовирус для экспрессии как p16 ink4a , так и GFP, каждый под отдельным промотором цитомегаловируса (CMV) (Ad-p16-GFP). Совместная экспрессия p16 ink4a и GFP позволила маркировать трансдуцированные клетки, которые сверхэкспрессируют p16 ink4a , путем визуализации флуоресценции GFP. В качестве контроля клетки инкубировали с другим аденовирусным вектором, который экспрессирует GFP под промотором CMV (Ad-GFP).

Для экспериментов по вирусной трансдукции клетки инкубировали для 6DIV в 6-луночных многолуночных планшетах с поверхностью, отпугивающей клетки (CELLSTAR ® , Greiner Bio-one GmbH), либо с Ad-GFP, либо с Ad-p16-GFP. векторов.Каждая лунка содержала 1 мл среды, засеянную 50000 клетками, происходящими от ОС. Оба вектора добавляли при значении множественности заражения (MOI) 100. После 5DIV сферы подсчитывали путем визуального осмотра под инвертированным микроскопом с объективом 20x (Zeiss AG). На 5DIV в культуральную среду добавляли EdU (конечная концентрация 10 мкМ) в течение последних 24 часов культивирования. На 6DIV сферы были зафиксированы и помечены как DAPI и EdU. Флуоресценцию GFP наблюдали непосредственно под флуоресцентным микроскопом (ApoTome.2, Zeiss AG), а процентное содержание GFP-положительных клеток рассматривали как эффективность трансдукции обоих векторов. В наших условиях культивирования средняя эффективность трансдукции в сферах составляла 28% для вектора Ad-GFP и 32% для вектора Ad-p16-GFP.

Статистический анализ.

данных qRT-PCR и результаты анализа отосферы были оценены с помощью JMP (версия 9; SAS Institute, Кэри, Северная Каролина, США). Статистические сравнения проводились относительно биологической контрольной группы. Для всех экспериментов различия между экспериментальными группами считались статистически значимыми при p <0.05. Обычно распределенные данные анализировали с использованием t-критерия Стьюдента для сравнения двух групп или однофакторного дисперсионного анализа с последующим апостериорным критерием Тьюки для множественных сравнений. Для количественной оценки маркеров клеточного цикла в отосфере часто получали нулевые значения, что делало распределение данных ненормальным. Для этих экспериментов было выполнено непараметрическое статистическое тестирование (тест Двасса-Стила для множественных сравнений).

Результаты Bmi1 экспрессируется во внутреннем ухе мыши.

Экспрессия Bmi1 была проанализирована в улитке мышей Bmi1 WT / WT (WT) с помощью иммуногистохимии Bmi1 (рис. 1A и 1B) и в ОС Bmi1 GFP / WT (Het). мышей посредством иммуномечения GFP (рис. 1E).Экспрессию Bmi1 исследовали на E13.5, p0 и p28. Для характеристики клеток, экспрессирующих Bmi1, Myosin7a использовали в качестве маркера волосковых клеток [31] (рис. 1A – 1C, 1E и 1F; показаны белым), а Sox2 использовали в качестве маркера для поддерживающих клеток [32] (рис. 1A). –1C, 1E и 1F, показаны красным). На E13.5 экспрессия Bmi1 выявлялась в эпителии протока улитки и спиральном ганглии с более слабой экспрессией в окружающей отической мезенхиме (данные не показаны). Специфическое ядерное окрашивание Bmi1 было обнаружено в волосковых клетках и поддерживающих клетках в точках p0 (рис. 1A) и p28 (рис. 1B).В качестве отрицательного контроля не было обнаружено никакого специфического сигнала Bmi1 в Bmi1 GFP / GFP (Knockout; KO) OC (показано на p0, фиг. 1C). Экспрессия Bmi1 также была обнаружена в спиральном ганглии (показано на p0, Fig 1D). Совместное мечение с нейронным маркером NeuN и глиальным маркером Sox10 показало, что Bmi1-положительные клетки были нейронами спирального ганглия (рис. 1D). Экспрессия Bmi1-GFP выявила паттерн, подобный таковому для нативного белка Bmi1 во все моменты времени (рис. 1E и 1G; данные не показаны). На p28 экспрессия Bmi1-GFP наблюдалась в волосковых клетках и поддерживающих клетках ОС (рис. 1E).Экспрессия Bmi1-GFP не наблюдалась в улитках WT отрицательного контроля (рис. 1F).

10.1371 / journal.pone.0164579.g001 Рис.

Экспрессия Bmi1 в сенсорном эпителии улитки.

(A, B и D) Иммуногистохимическое окрашивание проводили с использованием антитела против Bmi1 на мышах дикого типа (Bmi1 WT / WT , обозначаемых как WT). (E и G) Альтернативно, иммуномечение проводили с использованием антитела против GFP на гетерозиготных мышах Bmi1-GFP (Bmi1 GFP / WT , обозначаемых Het). Срезы ОС (A-C, E и F) совместно окрашивали на Sox2 (красный) и Myosin7a (белый) в качестве маркеров поддерживающих клеток и волосковых клеток, соответственно.Волосковые клетки отмечены полыми белыми стрелками, а опорные клетки — сплошными белыми стрелками. Срезы спиральных ганглиев (D и G) были совместно помечены Sox10 (красный) и NeuN (белый), чтобы служить маркерами глиальных и нейрональных клеток, соответственно. Нейроны спирального ганглия помечены полыми белыми наконечниками стрелок, а глиальные клетки отмечены сплошными белыми наконечниками стрелок. (A) Bmi1 выражается в незрелом ОК в точке p0. И волосковые клетки, и поддерживающие клетки были помечены как Bmi1. (B) Экспрессия Bmi1 была обнаружена в волосах и поддерживающих клетках функционально зрелого ОС на p28.(C) Улитки гомозиготных мышей Bmi1-GFP (Bmi1 GFP / GFP , обозначаемые как KO) служили отрицательным контролем для иммуногистохимии Bmi1. (D и G) Экспрессия Bmi1 совмещена с нейрональным маркером NeuN в нейронах спирального ганглия. Sox10-позитивные глиальные клетки не проявляли экспрессии Bmi1. (E) Сигнал Bmi1-GFP наблюдался в волосах и поддерживающих клетках ОС на p28. (F) Cochleae мышей WT служили отрицательным контролем для сигнала Bmi1-GFP. Ядра были помечены DAPI во всех срезах.Сплошные белые стрелки указывают на поддерживающие клетки, а полые стрелки указывают на внутренние и внешние волосковые клетки. IHC: внутренние волосковые клетки, OHC: внешние волосковые клетки, SC: поддерживающие клетки, SG: спиральный ганглий, SGN: нейроны спирального ганглия. WT: дикий тип, Het: гетерозиготный, KO: нокаут. Масштаб: 20 мкм.

Экспрессия белка

Bmi1 также наблюдалась в волосковых клетках и поддерживающих клетках матки, ампулы и мешочка новорожденных (S1 фиг.) При p0. С помощью qRT-PCR мРНК Bmi1 была обнаружена в эпителии улитки на E13.5, p0, p4, p7, p14, p21 и p28 (n = 2 независимых образца каждый) (рис. 2). Уровни мРНК Bmi1 были значительно повышены между E13.5 и p0 (односторонний дисперсионный анализ с последующим апостериорным тестом Тьюки, p <0,001), а затем были значительно снижены между p0 и p7 (односторонний ANOVA с последующим апостериорным тестом Тьюки. , p <0,05) (рис.2). Уровни мРНК Bmi1 были одинаковыми на p7 и p14. За этим последовало статистически значимое повышение уровня функционально зрелых ОК на p21 и p28 (p <0,001) (рис. 2).

10.1371 / journal.pone.0164579.g002 Рис.

Количественный анализ временного паттерна экспрессии Bmi1 в сенсорном эпителии улитки во время развития. Уровни мРНК

Bmi1 в сенсорном эпителии улитки на семи стадиях развития: E13.5, p0, p4, p7, p14, p21 и p28. Транскрипты Bmi1 выявлялись в сенсорном эпителии на всех стадиях. Все значения были нормализованы до уровня p0. Уровни мРНК Bmi1 значительно повысились между E13.5 и p0. Впоследствии мРНК Bmi1 значительно подавлялась между p0 и p7, за чем следовало статистически значимое усиление на p21 и p28.n.s .: не имеет значения. * p <0,05, *** p <0,001.

Таким образом, мы подтвердили предыдущие сообщения об экспрессии Bmi1 в эмбриональном [20] и постнатальном [21] сенсорном эпителии улитки. Кроме того, мы описали временной паттерн экспрессии мРНК Bmi1 и выявили новую экспрессию белка Bmi1 в нейронах спиральных ганглиев и вестибулярном сенсорном эпителии.

Bmi1 способствует пролиферации отических клеток-предшественников in vitro

Чтобы определить, влияет ли Bmi1 на пролиферацию отических клеток-предшественников in vitro, ОК животных WT, Het и KO p0 культивировали с использованием анализа отосферы, как описано в разделе «Методы».Через 5 дней in vitro (5DIV) сферы подсчитывали и выявляли пролиферирующие клетки с помощью мечения Ki67, EdU или фосфогистона h4 (pHh4) и подсчета вручную. Среднее количество клеток на ОК составляло 130 833 (± 20 766) для животных WT (n = 9), 127 828 (± 14 941) для животных Het (n = 19) и 112 500 (± 20 493) для животных KO (n = 6). Статистически значимой разницы в количестве клеток на ОК между группами не было (однофакторный дисперсионный анализ). На 5DIV среднее количество сфер на ОС было 1599.61 (± 415,47) для животных WT, 1368,92 (± 149,02) для гетерозиготных животных и 1233,41 (± 215,53) для животных KO. Чтобы учесть межэкспериментальную изменчивость числа сфер и частот генотипов, все значения из одного эксперимента были нормализованы к среднему контролю WT соответствующего эксперимента. При нормализации к контролю WT мыши Het (n = 19) дали 97,3% (± 10%), а мыши KO (n = 6) дали рост 78,89% (± 21%), последние из которых значительно ниже, чем контроль дикого типа (n = 9) (однофакторный дисперсионный анализ с последующим апостериорным тестом Тьюки, p <0.05) (Рис. 3A). Чтобы определить, связано ли это снижение способности к формированию сфер со снижением пролиферации клеток, сферы всех генотипов фиксировали и метили с использованием маркеров Ki67, EdU и pHh4. Как определено с помощью сигнала DAPI, среднее количество клеток на сферу составляло 19,78 (± 11,3) для сфер KO, что было значительно ниже, чем средние числа для сфер WT (23,96 ± 11,01) и Het (22,75 ± 10,2) ( p <0,001, тест Dwass-Steel; n = 300 сфер, проанализированных на группу) (рис. 3B).KO-сферы содержали в среднем 24,71% (± 16,23%) Ki67-положительных клеток, что было значительно ниже, чем среднее значение для сфер WT (33,63% ± 18,77%) (p <0,01, тест Двасса-Стила), но существенно не отличалось. из сфер Het (28,94% ± 16,28%) (p> 0,05, тест Dwass-Steel; n = 100 сфер, проанализированных на группу) (рис. 3C и 3D). Кроме того, процент клеток, включающих EdU, был значительно снижен в сферах KO (22,17% ± 17,65%) по сравнению со сферами WT (35,99% ± 17,22%) и сферами Het (38.51% ± 15,82%) (p <0,001, тест Dwass-Steel; n = 100 сфер, проанализированных на группу) (рис. 3E и 3F). Мы наблюдали статистически значимое снижение процента pHh4-положительных клеток в сферах KO (0,18% ± 1,50%) по сравнению с сферами WT (0,51% ± 1,1%) и Het (0,71% ± 2%) (p <0,05). , Dwass-Steel; n = 100 проанализированных сфер на группу) (рис. 3G и 3H). Статистически значимой разницы между сферами WT и Het по любому из вышеупомянутых параметров не было.

10.1371 / журнал.pone.0164579.g003 Рис.

Сферообразующая способность кортиевого нокаутирующего органа Bmi1 новорожденных.

(A) Среднее количество сфер на ОК, выраженное как процент от контроля дикого типа (среднее значение ± стандартное отклонение). Данные представляют собой результаты для 9 мышей WT, 19 Het и 6 KO p0, объединенных в 4 независимых экспериментах. Культуры мышей KO генерировали значительно меньше сфер по сравнению с их однопометниками WT (однофакторный дисперсионный анализ с последующим апостериорным тестом Тьюки, p <0,05). Разница между мышами WT и Het незначительна.(B, D, F и H) Количественное определение DAPI, Ki67, EdU и pHh4. Каждая точка данных представляет одну сферу. Значения среднего и стандартного отклонения показаны на точечных графиках. (B) Количество клеток с меткой DAPI на сферу. Число ячеек на сферу значительно снижено для сфер Bmi1 KO по сравнению со сферами WT (p <0,001, тест Dwass-Steel; n = 300 сфер на группу). Разница между мышами WT и Het статистически не значима. (C, E и G) Типичные изображения сфер WT и KO, помеченных для Ki67 (C), EdU (E) и pHh4 (G).(D) Процент Ki67-положительных клеток в сферах: сферы KO содержат значительно более низкий процент Ki67-положительных клеток по сравнению со сферами WT (p <0,01, Dwass-Steel; n = 100 сфер на группу). Не было существенной разницы между мышами WT и Het или между мышами Het и KO. (F) Процент EdU-включающих клеток в сферах: сферы KO содержат значительно более низкий процент EdU-положительных клеток по сравнению со сферами WT и Het сферами (p <0,001, тест Dwass-Steel; n = 100 сфер на группу ).Разница между мышами WT и Het незначительна. (H) Процент pHh4-положительных клеток в сферах: процент pHh4-экспрессирующих клеток значительно ниже в сферах KO по сравнению со сферами WT (p <0,05, тест Dwass-Steel; n = 100 сфер на группу). Статистически значимой разницы между сферами WT и Het не было. WT: дикий тип, Het: гетерозиготный, KO: нокаут. * p <0,05, ** p <0,01, *** p <0,001.

Эти находки подтверждают, что Bmi1 вносит вклад в способность OC формировать сферы и в пролиферацию отических клеток-предшественников.

Bmi1 не важен для морфологического развития OC in vivo

Чтобы определить, влияет ли потеря Bmi1 на морфологическое развитие OC, мы выполнили иммуномаркирование срезов улитки и целых препаратов на p0 и p7. Не было обнаружено каких-либо серьезных аномалий в архитектуре ОК ни на p0, ни на p7 (на каждой стадии было проанализировано три животных с нокаутом) (рис. 4A – 4D). В p0 Myosin7a наблюдался в волосковых клетках, а Sox2 наблюдался в поддерживающих клетках, оба по паттернам, подобным таковым в WT OC (Fig. 4A and 4B).Анализ KO средне-модиолярных срезов улитки в точке p0 показал, что все витки улитки сформированы нормально и идентичны таковым в улитке WT (S2, рис.). На p7 KO OC отображал три ряда внешних волосковых клеток и один ряд внутренних волосковых клеток, аналогично WT OC (рис. 4C и 4D). В Bmi1 KO OC волосковые клетки характеризовались интактными стереоцилиями, которые не обнаруживали признаков дезорганизации (рис. 4C и 4D).

10.1371 / journal.pone.0164579.g004 Рис.

Фенотип раннего постнатального нокаутирующего Bmi1 органа Кортиева.

(A и B) Срезы улиток мышей WT (A) и KO (B) в точке p0, иммуномеченные Myosin7a (зеленый) и Sox2 (красный) и окрашенные DAPI (синий). Полые белые стрелки отмечают внутренние и внешние волосковые клетки. Сплошные белые стрелки обозначают поддерживающие клетки. Иммуногистохимический анализ показывает нормальное развитие ОС Bmi1 KO, что определяется экспрессией маркера волосковых клеток Myosin7a и маркера поддерживающих клеток Sox2. (C и D) Виды поверхности ОК мышей WT (C) и KO (D) на p7, окрашенных фаллоидином, который маркирует стереоцилии, и Myosin7a, маркером волосковых клеток.Ядра были помечены DAPI. Иммуногистохимический анализ показывает нормальное развитие ОК Bmi1 KO. Мыши WT и KO обладают тремя рядами наружных волосковых клеток (O1, O2 и O3) и одним рядом внутренних волосковых клеток. Ни WT, ни KO OC не обнаруживают неорганизованной структуры или аномалий стереоцилий на p7. WT: дикий тип, KO: нокаут, IHC: внутренние волосковые клетки, OHC: внешние волосковые клетки, SC: поддерживающие клетки. Масштаб: 20 мкм.

Эти находки подтверждают, что Bmi1 не важен для эмбрионального и раннего постнатального развития OC.

Потеря Bmi1 связана с активацией p16 ink4a в отических клетках-предшественниках in vitro

Чтобы лучше понять молекулярные изменения, которые происходят при потере Bmi1 в ОС и отосфере, мы исследовали изменения экспрессии генов Bmi1 и p16 ink4a в неонатальном ОК и отосферы разных генотипов с помощью иммуногистохимии и qRT-PCR.

Экспрессия белка

Bmi1 была обнаружена иммуногистохимически в сферах WT после 5DIV, но не в сферах KO (фиг. 5A).Анализ qRT-PCR показал, что уровни мРНК Bmi1 в сферах Het (n = 3 образца) были в 0,59 раза выше уровня WT (n = 3 образца) (рис. 5B). В сферах KO (n = 2 образца) уровень обнаруженной мРНК был в 0,07 раза выше уровня экспрессии WT (рис. 5B). Когда неонатальные ОК собирали при p0, уровни мРНК Bmi1 были в 0,67 раза в ОК Het (n = 3) и 0,06 раза в ОК ОК (n = 4) по сравнению с контролем WT (n = 3) (рис. 5С).

10.1371 / journal.pone.0164579.g005 Рис.

Изменения экспрессии генов в кортиевом органе и отосфере, нокаутирующем Bmi1.

(A) Типичные изображения с большим увеличением сфер Bmi1 WT и KO после 5DIV, окрашенных на Bmi1 (зеленый) и контрастированных с помощью DAPI (синий). Ядерный сигнал Bmi1 был обнаружен в сферах WT, но не в KO. (B) Количественный анализ уровней мРНК Bmi1 в сферах WT, Het и KO с помощью qRT-PCR. Сферы Het показали уровни мРНК Bmi1, которые в 0,59 раза превышают уровни сфер WT. Ограниченные количества мРНК были обнаружены в сферах КО, что составляет 0,07 раза по сравнению с контролем дикого типа.(C) Количественный анализ уровней транскрипта Bmi1 в неонатальных WT, Het и KO OC с помощью qRT-PCR. При нормировании к контролю WT уровни мРНК Bmi1 в ОС Het были в 0,67 раза выше уровня WT. В KO OC уровень обнаруженной мРНК был в 0,06 раза выше уровня экспрессии WT. (D) Количественный анализ уровней транскрипта p16 ink4a в сферах WT, Het и KO с помощью qRT-PCR. В сферах Het p16 ink4a имеет повышенную регуляцию в 1,82 раза относительно сфер WT. Сферы KO показывают 18.38-кратное усиление p16 ink4a по сравнению со сферами WT. В неонатальном KO OC были обнаружены только скудные количества мРНК p16 ink4a , что составляет 0,05 раза по сравнению со сферами WT. WT: дикий тип, Het: гетерозиготный, KO: нокаут. n.s .: не имеет значения. *** р <0,001.

Затем мы спросили, экспрессируется ли мРНК p16 ink4a в ОК во время развития улитки. МРНК P16 ink4a не была обнаружена в OC WT в любой момент времени с E13.5 до p28, нашей последней временной точки (n = 2 независимых выборки на временную точку, данные не показаны). Селезенка взрослой мыши служила положительным контролем для экспрессии p16 ink4a . Чтобы определить, связана ли экспрессия p16 ink4a с уровнем экспрессии Bmi1 в отосферах, с помощью qRT-PCR измерили уровни мРНК p16 ink4a в WT (n = 3 образца), Het (n = 3 образца) и КО сферы (n = 2 образца). При нормализации к контролю WT сферы Het показали 1,8-кратную активацию p16 ink4a , что не было статистически значимой разницей, но показало тенденцию к значимости (рис. 5D) (односторонний дисперсионный анализ ANOVA с последующим апостериорным методом Тьюки). тест, p = 0.087). KO-сферы показали 18,3-кратную активацию мРНК p16 ink4a , что было статистически значимым по сравнению с сферами WT и Het (рис. 5D) (односторонний дисперсионный анализ с последующим апостериорным тестом Тьюки, p <0,001). Что касается экспрессии мРНК p16 ink4a в неонатальном ОК, мРНК p16 ink4a не была обнаружена в WT (n = 3) или Het OC (n = 3) при p0 и была обнаружена только в KO OC ( n = 4), хотя и в небольшом количестве, что составляет 0,05-кратный уровень мРНК в сферах WT (рис. 5D).

Эти данные показывают, что мРНК p16 ink4a не экспрессируется в развивающемся WT OC, но экспрессируется в дефицитных количествах в KO OC. Напротив, позитивная регуляция p16 ink4a наблюдалась в отических предшественниках WT in vitro и, в большей степени, в отических предшественниках KO. Это несоответствие может указывать на то, что экспрессия p16 ink4a в клетках OC более жестко подавляется in vivo, чем in vitro.

Сверхэкспрессия P16 ink4a приводит к снижению сферообразующей способности органа Corti

. Чтобы определить, является ли избыточная экспрессия p16 ink4a в клетках, происходящих от ОС, достаточной для подавления их способности к формированию сфер, были собраны образцы ОК от мышей WT, диссоциировали и культивировали с использованием анализа отосферы.Клетки инкубировали с одним из двух вирусных векторов: i) аденовирусом, экспрессирующим GFP под промотором цитомегаловируса (CMV) (Ad-GFP), или ii) аденовирусом, экспрессирующим p16 ink4a и GFP, каждый под отдельным промотором CMV ( Ad-p16-GFP). После 5DIV в обеих группах подсчитывали сферы, созданные in vitro. Чтобы подтвердить сверхэкспрессию p16 ink4a вектором Ad-p16-GFP, использовали qRT-PCR для количественного определения уровней мРНК p16 ink4a в сферах, инкубированных с любым вектором.Сферы, которые инкубировали с вектором Ad-p16-GFP, показали значительное 765-кратное увеличение уровней мРНК p16 ink4a по сравнению со сферами, инкубированными с Ad-GFP (рис. 6A) (n = 2 независимых образца, измеренных в трижды для обоих векторов, t-критерий Стьюдента, p <0,001). Эти данные показывают, что отические клетки-предшественники могут быть успешно трансдуцированы с помощью Ad-p16-GFP и что трансдукция клеток этим вектором приводит к значительному усилению регуляции p16 ink4a .Затем мы исследовали влияние сверхэкспрессии p16 ink4a на количество отосфер, генерируемых in vitro. В DIV5 среднее количество сфер, генерируемых на 50000 клеток, составляло 252 ± 60,5 сфер для вектора Ad-p16-GFP, что было значительно ниже, чем для вектора Ad-GFP (437,3 ± 93,6 сфер) (рис. 6B) (N = 3 независимых эксперимента, n = 5 повторов на эксперимент, t-критерий Стьюдента, p <0,001). Чтобы получить представление о механизме опосредованного p16 ink4a ингибирования образования сфер, мы добавили EdU в культуральную среду в течение последних 24 часов культивирования и выполнили мечение EdU для обеих групп.Мы не смогли обнаружить существенной разницы в процентном содержании EdU-инкорпорирующих клеток в обеих группах, что может быть связано с обнаружением того факта, что сам контрольный вектор (Ad-GFP) уменьшал включение EdU и приводил к значительному усилению активности p16 ink4a в этих экспериментах (данные не показаны). Соответственно, мы проверили, может ли сверхэкспрессия p16 ink4a вызывать апоптоз сфер. Не было обнаружено различий между обеими группами в отношении уровней транскриптов связанных с апоптозом генов каспазы-3 и каспазы-9, как было проанализировано с помощью qRT-PCR (S3 Фиг.).Этот результат может указывать на то, что снижение числа сфер, наблюдаемое при сверхэкспрессии p16 ink4a , не связано с повышенным апоптозом.

10.1371 / journal.pone.0164579.g006 Рис.

Влияние сверхэкспрессии p16 ink4a , опосредованной вирусным вектором, на способность кортиевого органа формировать сферы.

(A) Количественный анализ уровней мРНК p16 ink4a в отосферах, полученных из кортиевских образцов дикого типа через 5 дней in vitro. Орган клеток, полученных из кортиевских клеток, инкубировали с любым из двух вирусных векторов: i) Ad-GFP для индукции экспрессии GFP или Ad-p16-GFP для индукции экспрессии как GFP, так и p16 ink4a .Сферы, инкубированные с Ad-p16-GFP, показали 765-кратное увеличение уровней мРНК p16 ink4a по сравнению со сферами, инкубированными с Ad-GFP (n = 2 независимых образца, измеренных в трех экземплярах для обеих групп). Разница в уровнях мРНК p16 ink4a между группами Ad-GFP и Ad-p16-GFP была статистически значимой (t-критерий Стьюдента, p <0,001). (B) Среднее количество сфер, образованных через 5 дней in vitro на 50000 клеток (среднее ± стандартное отклонение). Клетки, инкубированные с Ad-p16-GFP, образовывали значительно меньше сфер через 5 дней in vitro по сравнению с клетками, инкубированными с Ad-GFP (N = 3 независимых эксперимента, n = 5 повторов на эксперимент, t-критерий Стьюдента, p <0 .001). *** р <0,001.

Эти данные показывают, что опосредованная вирусным вектором сверхэкспрессия p16 ink4a приводит к снижению сферообразующей способности ОК. В то время как выяснение механизма подавления образования сфер, опосредованного p16 ink4a , требует дальнейших подробных исследований, полученные данные подтверждают связь между повышением регуляции p16 ink4a в сферах Bmi1 KO и сниженной сферообразующей способностью Bmi1 KO. OC.

Обсуждение

В настоящем исследовании экспрессия Bmi1 была показана в постнатальном и зрелом ОК. Утрата Bmi1 не привела к явному фенотипу или уродству органа к концу первой постнатальной недели. Напротив, потеря Bmi1 приводит к уменьшению генерации отосфер и снижению экспрессии маркеров пролиферации в сферах. Этот фенотип был связан с активацией p16 ink4a . Эти находки подтверждают, что Bmi1 вносит вклад в поддержание пролиферации отических клеток-предшественников, роль, которая может быть связана с репрессией p16 ink4a in vitro.

Bmi1 экспрессируется во внутреннем ухе мыши.

Экспрессия Bmi1 широко изучена в нескольких тканях. Известные примеры включают мозг [26, 33, 34], сетчатку [26, 33, 35] и улитку [20, 21]. В настоящем исследовании мы показали экспрессию Bmi1 как в развивающихся, так и в функционально зрелых ОК с помощью иммуногистохимии Bmi1 и репортерной линии мышей Bmi1-GFP (рис. 1). Экспрессия Bmi1 наблюдалась как в волосах, так и в опорных клетках ОК. Мы дополнительно наблюдали экспрессию Bmi1 в неонатальной матке, crista ampullaris и мешочке (S1 Fig).Это открытие потенциально интересно, так как вестибулярный сенсорный эпителий обладает сферообразующей способностью, которая сохраняется у мышей во взрослом возрасте [4, 36].

Анализ временной экспрессии Bmi1 выявил флуктуации уровней мРНК Bmi1 во время развития улитки, хотя кратные изменения были скромными, так что возможно, что эти изменения не имеют функционального значения (Fig 2). Эти результаты согласуются с недавними данными по RNA-Seq, представленными в анализе экспрессии генов ОК [37].Открытие, что Bmi1 не подавляется между E13.5 и p28, указывает на то, что Bmi1 играет роли в функционально зрелых OC, отличных от способствующих пролиферации, таких как описанная антиапоптотическая роль Bmi1 в OC [21]. В самом деле, экспрессия Bmi1 не является уникальной для пролиферирующих клеток, но также обнаруживается в постмитотических клетках, особенно в нейронах [26, 33]. Одна из функций Bmi1 в нейронах — репрессия p19arf и защита от p53-зависимого апоптоза [26]. В настоящем исследовании мы также продемонстрировали экспрессию Bmi1 в нейронах спирального ганглия (рис. 1D и 1G).

Bmi1 вносит вклад в пролиферацию отических клеток-предшественников in vitro

. Наши находки показывают, что в отсутствие Bmi1 сферообразующая способность OC снижается (Fig 3A). Bmi1 KO-сферы состояли из меньшего количества клеток по сравнению со сферами WT (рис. 3B). Этот фенотип был связан с более низким процентом клеток, экспрессирующих маркеры клеточного цикла in vitro (рис. 3C – 3H). Lu и его коллеги [22] описали снижение включения EdU в поддерживающие клетки культивируемых Bmi1 KO OC в ответ на индуцированное неомицином повреждение.Авторы этого исследования также сообщили о снижении сферообразующей способности Bmi1 KO OC, хотя они не характеризовали статус клеточного цикла клеток в сферах [22]. В этом отношении наши собственные выводы как дополняют, так и подтверждают результаты их исследования. Наши результаты показали снижение экспрессии Ki67 в сферах KO, что указывает на уменьшение количества циклических клеток (рис. 3C и 3D). Сходным образом снижение численности EdU- и pHh4-положительных клеток указывает на более низкую долю клеток, вступающих в S- и M-фазы, соответственно (рис. 3E-3H).Среди трех маркеров наибольшее снижение наблюдалось для включения EdU, что может указывать на то, что первичным клеточным событием является снижение входа в S-фазу. Это объяснение согласуется с влиянием Bmi1 на путь p16 ink4a / Rb, который регулирует прогрессирование от G1- к S-фазе [38]. В соответствии с этим представлением, заметная активация p16 ink4a была обнаружена в сферах KO (рис. 5D).

Bmi1 не важен для морфологического развития OC in vivo

Предыдущие исследования показали, что Bmi1 оказывает более глубокое влияние на пролиферацию клеток в культуре, чем in vivo [8, 39].В настоящем исследовании, несмотря на сниженную сферообразующую способность образцов ОК Bmi1 KO, мы не обнаружили морфологических аномалий в раннем постнатальном ОК Bmi1 KO (рис. 4 и рис. S2), что позволяет предположить, что способность к пролиферации у предшественников улитки не была существенно снижается во время эмбрионального развития in vivo. Взятые вместе, эти находки подтверждают результаты двух недавних исследований функции Bmi1 в ОК [21, 22]. Однако эти исследования не касались вопроса о том, почему потеря Bmi1 влияет на пролиферацию отических клеток-предшественников в сферах, происходящих от OC in vitro, но не в развивающейся улитке in vivo.В нашем исследовании мы попытались ответить на этот вопрос, сравнив экспрессию p16 ink4a in vitro с in vivo. Молофски и его коллеги [8] описали снижение сферообразующей способности неонатального мозга Bmi1 KO, несмотря на относительно нормальное развитие мозга при рождении. Сходным образом, избыточная экспрессия Bmi1 в центральной нервной системе (ЦНС) усиливает пролиферацию клеток и формирование нейросфер in vitro, но оказывает лишь незначительное влияние на пролиферацию и частоту стволовых клеток in vivo [39]. В этих исследованиях авторы объясняют эти расхождения тем фактом, что p16 ink4a и p19 arf , нижестоящие мишени Bmi1, экспрессируются в культуре, но не in vivo.P16 ink4a не экспрессируется в мозге развивающихся и молодых взрослых мышей in vivo [8, 34, 39–41], но индуцируется в культурах нейросферы [8, 39, 41] как стрессовая реакция на нефизиологическую культуральную среду [ 42, 43]. Наши открытия распространяют этот феномен на отические клетки-предшественники. В нашем исследовании мРНК p16 ink4a не была обнаружена в развивающихся ОК in vivo. Этот вывод согласуется с недавними исследованиями, в которых сообщается о неспособности обнаружить мРНК p16 ink4a на раннем постнатальном РЯ с помощью RNA-Seq [37] или одноклеточной qRT-PCR [44].Интересно, что индукция p16 ink4a происходила при диссоциации и культивировании клеток OC с использованием анализа отосферы (фиг. 5D). Мы предполагаем, что индукция p16 ink4a в культуре делает клетки более зависимыми от Bmi1-опосредованной репрессии in vitro. Следовательно, потеря Bmi1 влияет на пролиферативную способность in vitro способом, который остается нераспознанным in vivo. Кроме того, отсутствие экспрессии p16 ink4a в OC in vivo делает маловероятным, что p16 ink4a участвует в истощении отических предшественников, которое имеет место во время развития улитки.

Потеря Bmi1 связана с активацией p16 ink4a в отических клетках-предшественниках in vitro

. Наши результаты не показали эффекта гапло-недостаточности Bmi1 в отношении потенциала образования сфер (Рис. 3A). Сферы Bmi1 Het показали пониженные уровни мРНК Bmi1, которые были в 0,59 раза по сравнению с уровнем дикого типа (фиг. 5B). Этот пониженный уровень экспрессии Bmi1 сопровождался повышением регуляции p16 ink4a в 1,8 раза по сравнению с WT (фиг. 5D). Этот профиль экспрессии p16 ink4a был связан с нормальной сферообразующей способностью и нормальной экспрессией маркеров пролиферации в сферах Het (фиг. 3).Напротив, сферы Bmi1 KO обнаруживают значительную 18-кратную активацию p16 ink4a (фиг. 5D), что коррелирует со снижением образования сфер и пролиферации клеток в сферах KO (фиг. 3). Таким образом, пролиферативная способность отических предшественников, по-видимому, связана с уровнями мРНК p16 ink4a . Bruggeman et al. [40] описали эффект дозировки гена ink4a / arf у Bmi1-нулевых предшественников и пришли к выводу, что существует порог для этих двух белков, который, когда превышается, ведет к ингибированию пролиферации клеток.Наши результаты согласуются с этой гипотезой и могут объяснить отсутствие дефекта пролиферации в нашем исследовании при потере одного аллеля Bmi1.

Хотя потеря Bmi1 приводила к заметной активации p16 ink4a в отосферах, это приводило только к скудной экспрессии мРНК p16 ink4a в неонатальных KO OC (Рис. 5D). Это несоответствие может указывать на то, что экспрессия p16 ink4a более жестко подавляется in vivo, возможно, другими факторами помимо Bmi1.Мы предполагаем, что низкая экспрессия мРНК p16 ink4a в неонатальном Bmi1 KO OC представляет собой подпороговый уровень, который не является функционально значимым. Это предположение основано на пороге экспрессии p16 ink4a и эффекте дозировки гена, как описано Bruggeman и соавторами [40]. Взятые вместе, полученные данные дополнительно подтверждают представление о том, что несоответствие между эффектами Bmi1 на отосферы по сравнению с OC частично объясняется дифференциальной экспрессией p16 ink4a в культуре по сравнению с in vivo.Таким образом, идентификация дополнительных регуляторов p16 ink4a в будущих исследованиях может иметь важные последствия для регуляции клеточного цикла в OC.

Сверхэкспрессия P16 ink4a приводит к снижению сферообразующей способности органа Corti

. Сверхэкспрессия P16 ink4a , как ранее было показано, ингибирует пролиферацию в некоторых типах мышиных клеток [18, 45, 46]. В настоящем исследовании аденовирусный вектор (Ad-p16-GFP) был использован для сверхэкспрессии p16 ink4a в клетках, происходящих от ОК, более чем в 750 раз.При сверхэкспрессии p16 ink4a сферообразующая способность снижалась на 42% по сравнению с контрольными клетками, которые инкубировали с Ad-GFP. Этот результат был подобен эффекту потери Bmi1 на способность OC формировать сферы, хотя снижение было более выраженным при принудительной сверхэкспрессии p16 ink4a с Ad-p16-GFP, чем наблюдаемое в сферах Bmi1 KO. Более сильное снижение образования отосферы может быть связано с более высокой активацией p16 ink4a , которая может быть достигнута с использованием вирусного вектора, по сравнению с таковой, обнаруженной у мышей Bmi1 KO.Взятые вместе, настоящие находки согласуются с предыдущими исследованиями нервных стволовых клеток, которые сообщили, что Bmi1 способствует формированию нейросферы частично посредством репрессии p16 ink4a [8, 47]. В этих исследованиях совместная делеция p16 ink4a привела к частичному восстановлению сферообразующей способности Bmi1-дефицитных нервных стволовых клеток [8, 47]. В заключение, наши данные подтверждают мнение о том, что сниженная пролиферация, обнаруженная в отосферах Bmi1 KO, вызвана, по крайней мере частично, накоплением p16 ink4a в культуре.

Bmi1-опосредованная регуляция клеточного цикла в отических клетках-предшественниках

. культивируемые отические предшественники после потери Bmi1 (фиг. 7). Bmi1-опосредованная репрессия p16 ink4a позволяет активировать cyclin D-зависимые киназы 4 и 6, которые удерживают белки ретинобластомы (Rb) в их активной гиперфосфорилированной форме [13].Факторы транскрипции фактора элонгации 2 (E2F) высвобождения гиперфосфорилированного Rb, способствующие их способности активировать гены, необходимые для продвижения через точку рестрикции в S-фазу клеточного цикла [14].

10.1371 / journal.pone.0164579.g007 Рис.

Механизм регуляции клеточного цикла через путь Bmi1 / p16 ink4a .

Bmi1 репрессирует p16ink4a, который, в свою очередь, ингибирует связывание циклин-зависимых киназ 4/6 (CDK4 / 6) с циклином D. Комплексы CDK4 / 6-циклин D необходимы для фосфорилирования белков семейства ретинобластомы (Rb).В отсутствие комплексов CDK4 / 6-циклин D Rb остается в неактивной гипофосфорилированной форме. После фосфорилирования Rb высвобождает группу факторов транскрипции фактора элонгации 2 (E2F). E2F активирует транскрипцию различных генов, которые необходимы для перехода от G1-фазы клеточного цикла через точку рестрикции в S-фазу. После прохождения точки рестрикции клетка становится коммитированной в клеточный цикл даже в отсутствие внешних стимулов пролиферации.Рисунок адаптирован из [48].

В настоящем исследовании сферы Bmi1 KO показали только незначительное снижение пролиферации клеток, несмотря на заметную активацию p16 ink4a . Это открытие указывает на то, что путь Bmi1 / p16 ink4a не единственный путь регуляции клеточного цикла, активный в отических клетках-предшественниках. Например, ингибитор циклин-зависимой киназы (CKI) p27 kip1 , который экспрессируется в поддерживающих клетках ОК, по-видимому, подавляется при диссоциации и культивировании ОК [20, 49], что позволяет пролиферации клеток происходить в vitro [49].In vivo ранее было показано, что CKIs, p19 ink4d и p27 kip1 , вносят вклад в активное поддержание покоя в волосковых и поддерживающих клетках улитки, соответственно [50-53]. Делеция p19 ink4d приводила к повторному входу в клеточный цикл волосковых клеток улитки, но не поддерживающих клеток [52, 53]. Напротив, мыши p27 kip1 -null проявляли признаки клеточной пролиферации в поддерживающих клетках постнатальных и взрослых ОК in vivo [50, 51]. Однако количество пролиферирующих клеток в p27 kip1 -null OC снижается с возрастом [50].Это зависимое от возраста снижение может указывать на то, что другие CKIs компенсируют отсутствие p27 kip1 и ингибируют пролиферацию клеток в OC взрослых. Одним из этих кандидатов CKI потенциально может быть p16 ink4a , который не выражается в OC во время разработки (настоящее исследование). Поскольку мы не исследовали экспрессию мРНК p16 ink4a на стадиях старше p28, остается возможным, что экспрессия мРНК p16 ink4a в ОК начинается в зрелом возрасте. Это предположение подтверждается несколькими сообщениями, описывающими возрастание экспрессии мРНК p16 ink4a в различных тканях с возрастом [16, 54, 55].

В заключение, наши находки подтверждают роль Bmi1 в качестве промотора клеточной пролиферации в культуре отических клеток-предшественников, возможно, за счет репрессии ингибитора клеточного цикла p16 ink4a . Напротив, Bmi1 не требуется для морфологического развития OC in vivo. Хотя мРНК p16 ink4a не экспрессировалась в интактном OC WT, мРНК p16 ink4a была обнаружена в культуре. Эта индукция p16 ink4a сделала клетки OC более зависимыми от Bmi1-опосредованной репрессии в культуре, феномена, который ранее был описан в нейросферах мозга.Взятые вместе, наши данные дополняют текущее понимание регуляции клеточного цикла в OC и происходящих из OC предшественниках, которые могут иметь значение для регенерации волосковых клеток.

достижений в выявлении рака груди

Об этом производстве

Ключевые слова

Скрининг рака Рентгеновская биопсия опухоли рак груди рак диагностика карциномы визуализация методы визуализации маммография смертность лучевой скрининг ультразвук

Редакторы и филиалы

  • Сэм Брюннер
  • Бент Лангфельдт
  1. 1.Отделение диагностической радиологии Больница Гентофте, Университет Копенгагена Хеллеруп / Копенгаген, Дания
  2. 2. Отделение диагностической радиологии Окружная больница, Университет Орхус Орхуса, Дания

Библиографическая информация

  • DOI
    https://doi.org/10.1007/978-3-642-84065-4
  • Информация об авторских правах
    Springer-Verlag Берлин Гейдельберг 1990
  • Имя издателя
    Шпрингер, Берлин, Гейдельберг
  • электронные книги

    Архив книг Springer

  • Печатать ISBN
    978-3-642-84067-8
  • Интернет ISBN
    978-3-642-84065-4
  • Серия Печать ISSN
    0080-0015
  • Купить эту книгу на сайте издателя

RAF Church Fenton, Йоркшир

RAF Church Fenton, Йоркшир

RAF Church Fenton, Йоркшир

4 января 2014

Информация

RAF Church Fenton, Йоркшир

Детали

Церковь Королевских ВВС Фентон находится к югу от Йорка и к востоку от Селби.От Тадкастера сверните на юг по A162 и поверните налево на Сакстоне. Проезжайте через железную дорогу и через деревню, аэродром будет слева от вас.

RAF Church Fenton, Йоркшир

2014

Информация

RAF Church Fenton.

Детали

Очень хорошее фото, спасибо Крису Уилсону и Джону Кеннингу. Также AIX.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

RAF Church Fenton, Йоркшир

Детали

RAF Church Fenton, Йоркшир

4 января 2014

Информация

RAF Church Fenton, Йоркшир

Детали

История: RAF Church Fenton открылась в 1937 году как совершенно новая истребительная станция RAF с « Standard Function », каюты летчиков, столовая сержантов и офицеров, большой главный магазин, мастерские, ангары, топливо для использования примерно в течение недели парашютный магазин и др.Все из красивого красного кирпича ручной работы в грузинском стиле.
2 — ангара типа «С» и место для третьего.

1 — ангар Т2 построен в 1950-х гг.

1 — Ангар Bellman военного времени (теперь удален).
Несколько загонов для истребителей.
10 — ангары Extra Over Blister военного времени (теперь удалены).
1 x Watch Office Fort Type 1959/34 г. довоенный (снесен).

1 х Дежурный офис для станций ночных истребителей 12096/41 и CFN 45/4.
Удален блок Операции. Офицерская столовая, Оружейная палата, Главная мастерская, Гимназия, дистанция 25 ярдов, Тренажер Купола и многие другие вспомогательные здания..

Герб Королевских ВВС в церкви Фентон, представленный в 1953 году. «Со скоростью к метке».

Вахта станций ночных истребителей с видеомагнитофоном.

Удален Беллман, отмеченный синим.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Резервный дом из монолитного кирпича [PB] 974/35.

Детали

Первое здание, которое я обнаружил, — это довоенный дежурный дом. Если электричество отключается по какой-либо причине, резервный двигатель / двигатели включаются и посылают энергию в определенные здания в порядке важности.
Обратите внимание на взорванные стены вокруг здания.

Резервные двигатели.

Amp Eater.

Красный — дежурный дом.
Синий — главные ворота.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Дом резервный [ПБ] 974/35.

Детали

Выхлопная труба, идущая вверх по стене дома, и деревянные двери предназначены для водяного бака для охлаждения двигателя / ей.

Участок дежурного дома ..

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Главные ворота.

Детали

История: часть довоенной схемы расширения Королевских ВВС, Church Fenton была открыта в 1937 году с другими станциями « Standard Function », изгибающимися на юг с Waddington, Marham, Feltwell, Stradishall, Cranfield и Harwell. Черч Фентон имел травяной аэродром с двумя ангарами типа «C» и дежурным офисом (тип форта), третий ангар «C» должен был быть построен, но вместо него использовался T2 (после войны).Аэродром планировался как истребительная база.
№72 Sqn были первыми, кто прибыл со своими новейшими истребителями Gloster Gladiators на довольно грязное и незавершенное состояние.

Главные ворота ..

No72 р-н РАФ.

Глостер Гладиатор.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Главные ворота 2010 с комнатой охраны и штаб-квартирой.

Детали

Главный офис станции [PB] 3051/34.
Справа — Пост охраны и пожарный отряд [PB] 3136/34.

История: аэродром был построен как истребительная станция для прикрытия промышленного региона Йоркшир, но не был полностью завершен, когда прибыла первая эскадрилья. К 1940 году он стал домом для No71 (Eagle) Sqn, полностью американской эскадрильи RAF.

История: до того, как США вступили в войну, большое количество американских добровольцев предлагали свои услуги. Они будут участвовать в битве за Британию.Позже они были объединены в «Эскадрильи Орла», и № 71 был первым, кто сформировал в Королевских ВВС Черч Фентон 19 сентября 1940 года из Brewster Buffaloes, а затем Hawker Hurricanes.

История: No.71Sqn получил 6 Brewster Buffaloes, к тому времени они были очень устаревшими, и американские пилоты были весьма недовольны. К счастью, Buffaloes сломались очень легко, и их быстро заменили Hurricanes.

История: Hawker Hurricanes, XP было кодом 71Sqn на их бортах.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Пост охраны и пожарный отряд [ПБ] 3136/34.

Детали

RAF Church Fenton закрылась в 2013 году, и бизнесмен должен начать коммерческие полеты с бывшей базы RAF в Северном Йоркшире после покупки ее у Министерства обороны.

Крис Макин говорит, что его планы относительно RAF Church Fenton, которые также включают открытие школы летной подготовки, должны создать 100 рабочих мест в течение следующих пяти лет.» The Yorkshire Press »
4 января была дата его первого « Fly In », но из-за плохой погоды он был отложен до 5-го числа, когда эти фотографии были сделаны Джоном Кеннингом, и я благодарю его за возможность используйте фотографии здесь, так как я никак не мог туда добраться, живя на юге.

Плакат RAF Church Fenton Fly In.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Станция центрального отопления [ПБ] 383/35.

Детали

Центральное отопление.

Штабная машина.

Штабная машина.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Левый Блок казармы Airmens для блочного типа 92 [PB] 9965/38 H .
Правый Блок казармы Airmens для конструкции 64 «B» [PB] 2267/34 «половина» конструкции H .

Детали

Два разных типа бараков: один — H , а другой — «половинный» H .У них может быть железобетонная крыша и бомбоубежище под зданием.

Блок казармы навсегда.

Постоянная казарма.

H блок [PB] 9965/38.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Блок казарм летчиков [ПБ] 2267/34.

Детали

Они могут иметь железобетонную крышу и бомбоубежище под зданием и «половину» конструкции H .

«Не перевозить в самолетах. », Справочник для всех, касающийся мер предосторожности, чтобы предотвратить попадание любых предметов в руки врага.

Казармы летчиков.

План казармы летчиков на 3 унтер-офицера и 52 летчика [PB] 2267/34. Он также может быть использован для одноместного размещения офицеров «половина» конструкции H .

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Происходящая деградация.

Детали

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Станция центрального отопления [ПБ] 383/35 ..

Детали

В период расширения РАФ появилось много новых строительных конструкций и планировок, наиболее разработанных в грузинском стиле и ар-деко.
В лагерях была нужна вода и много воды, поэтому были построены большие водонапорные башни. Другим нововведением того периода было центральное отопление.Эти заводы производили горячую воду и распределяли ее по постоянному лагерю.

План.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Пост охраны и пожарный отряд [ПБ] 3136/34.

Детали

Вид сзади.

Пост охраны и пожарный отряд.

Полиция РАФ.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Станция больничных палат и гараж скорой помощи [PB] 1363,2752 / 34.

Детали

Станции лечебно-стоматологический корпус.

Это официальное фото Министерства авиации этого типа SSQ.

Операция RAF.

Медсестры РАФ.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Гараж для цистерн с пятью отсеками 2773/34 и 1225/39.

Детали

Построен как гараж на два отсека, но после 1939 года был расширен до пяти отсеков.

Танкер «Ураган и Альбион».

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Сарай для самолетов Сарай типа «С» с большими окнами, пропускающими много света.

Детали

Офисы по всей длине, это задняя сторона ангара, а офисы на низком уровне, я думаю, они предназначались для инженеров, а другая сторона — для эскадрилий и лётных отделений.

Офисы, расположенные вдоль боковой части навеса для Королевских ВВС Литтл-Риссингтон, с двойной дверью в центре, ведущей прямо в середину ангара. Там должны были быть стальные противовзрывные двери, чтобы защитить вход от бомбежек.

Конец 1930-х гг.

Фасад.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Деревья.

Детали

RAF в период расширения использовали питомник для поставки деревьев для посадки вокруг своих аэродромов.Эти деревья теперь вступают в свои права.

Прекрасные деревья на медном пляже в Королевских ВВС Литтл Риссингтон.

Крытый сарай RAF Netheravon «А», скрытый деревьями.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Платформа обслуживания самолетов.

Детали

Бленхейм, 242 кв.

Спитфайр 1 из 72кв.

Ураган 1 306,85,71кв.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Двухъярусный защищенный гараж для бензовозов 2773/37.

Детали

У них оригинальные рольставни, они были построены в 1939 году.

Топливозаправщик «Альбион».

Бедфорд Танкер емкостью 950 галлонов.

Альбион, разжигающий ранний ураган.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Внутри самолетного навеса Сарай типа «С» №3.

Детали

Теперь частный самолет, на котором жили бипланы до сверхзвуковых истребителей.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Самолетный навес типа «С» Сарай №1.

Детали

Боевой 245кв.

Калибровочный полет тигровой бабочки.

Мастер 54 ОТУ.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Рейс

Детали

Тайфун 183кв.

Мустанг 26кв.

Auster 141 Airfield Wing.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Диспетчерская 12096/41 и CFN 45/4.

Детали

Построен в 1948 году, а диспетчерская добавлена ​​в 1985 году. Эта башня была построена здесь, когда взлетно-посадочные полосы были расширены за пределы вида на старый часовой офис.

12096/41 в RAF Charmy Down.

Еще 12096/41.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Диспетчерская 12096/41 и CFN 45/4.

Детали

Хороший урожай птиц.

Охотник.

Явлин.

Молния.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Диспетчерская 12096/41 и CFN 45/4.

Детали

Внутри со всем снятым оборудованием RAF.

Английское электрическое освещение.

Хоукер Хантер.

DH Вампир.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Диспетчерская 12096/41 и CFN 45/4.

Детали

Внутри со всем снятым оборудованием RAF.

Фолландские комары.

Метеор.

Jet Provost.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Диспетчерская 12096/41 и CFN 45/4.

Детали

Главный дорожный светофор управляет при посадке или взлете самолета над дорогой.

Светофор в конце взлетно-посадочной полосы.

Светофор.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Диспетчерская 12096/41 и CFN 45/4.

Детали

Concord взлетает, я очень надеюсь, что кто-то переключил светофор на RED .

Интересно, использовал ли вулканец взлетно-посадочные полосы?

Тукано.

Преподаватель авиационной эскадрильи Йоркширского университета Гроб.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Наливной топливный склад.

Детали

Овальная проезжая часть — это довоенный склад топлива, обычно их было два, по обе стороны от ангарной линии.Поскольку Черч Фентон был боевой станцией, горючего хватило только на одну неделю боевых действий, и тогда им потребовалось бы пополнение запасов. Позади находится еще один объем топлива, который был добавлен из-за необходимости в большем количестве топлива, чтобы самолеты летали в соответствии со стандартами НАТО.

Старые топливные баки РАФ.

Датчик топливного насоса.

Автоцистерна для перевозки бензина Scammell OY.

RAF Church Fenton, Йоркшир

Снято Джоном Кеннингом 4 января 2014 г.

Информация

Улетающий.

Детали

Спасибо, Джон, за разрешение использовать внутренние фотографии CF.

Джон Кеннинг.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Главный сайт.

Детали

История: В соответствии с довоенной схемой расширения аэродромов ангары располагались полукругом, лагерь был позади, а жилые помещения снова позади. До начала войны не было попыток разогнать здания от бомбардировок.Затем по периметру трассы построили несколько загонов для истребителей типа «Е» для защиты самолетов-истребителей.

Blue на месте ангара Bellman.

Довоенная истребительная ручка типа «Е».

Ручка типа E в ВВС Великобритании Кенли под атакой Люфтваффе.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Ангары.

Детали

Остались два типа ангаров: 2 кирпичных сарая типа «C» (шатровые), 8 отсеков, около 200 футов x 150 футов x 35 футов.
Переносная железная рама T2 с гофрированной железной обшивкой 23bay 135 футов x 239 футов x 25 футов.
Был также Bellman 14bay 175ft x 87ft x 25ft, Bellman обычно использовался на аэродромах истребителей, поскольку они были слишком низкими, чтобы принимать бомбардировщики.

Сарай «C» строился в 1937 году. Довоенные ангары на языке ВВС назывались сараями.

В Книге рекордов РАФ указано 2 х С типа и 1 навес Беллмана. Некоторое время назад Bellman был снесен, а в какое-то время был добавлен Т2.

10 блистерных ангаров.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Отстойники для сточных вод?

Детали

Я обнаружил эти конструкции на многих аэродромах RAF .

Отстойник для сточных вод?

RAF Church Fenton Crest.

Диспетчерская вышка и сигнальная площадь. Башня управления до видеомагнитофона ..

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Нижний конец траектории аэродрома и периметра.

Детали

Вид на конец взлетно-посадочной полосы.
История: Эскадрильи приходили и уходили, как и в военное время, через которые прошли многие национальности. Затем Черч Фентон был преобразован в 4 OTU (Operational Training Unit), перейдя в 54 OTU в качестве учебного подразделения ночных истребителей с Blenheims и Defiance.

План.

Болтон и Пол Дефайант.

Болтон и Пол Дефайант.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

M&E Plinth & a Pillbox последняя из 11.

Детали

Постамент более позднего типа для M&E, вероятно, использует энергию от электрического столба для преобразования энергии для работы посадочных фонарей.

Похоже на Type24? с противовзрывной стеной у входа.

План.

Ополчение обороны.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Как это могло выглядеть во время Второй мировой войны.

Детали

История: 54 OTU отправились в Чартерный зал в 1942 году, и туда прибыли две эскадрильи ночных истребителей.Еще несколько эскадрилий снова пришли и ушли, а затем война закончилась, и было решено сохранить аэродром для будущего использования и две бетонные и гудронированные взлетно-посадочные полосы, где они были проложены.

А как это замаскировано выглядит на войне.

Истребитель Спитфайр.

Истребитель-бомбардировщик Blenheim, ночной истребитель.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Сарай 1.

Детали

В 1937 году построено

навесов типа «С».Довоенные ангары на языке британских ВВС назывались сараями.

Сарай строился в 1937 году. Довоенные ангары на языке британских ВВС назывались ангарами.

Один из типовых самолетов РАФ «Упавон».

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Т2 Ангар.

Детали

T2 был стандартным ангаром для Второй мировой войны и мог вместить любые типы самолетов RAF того периода и был намного дешевле в постройке.За навесом N3 «C» был еще один Т2, но его сняли к концу войны, а этот был построен в 1950-х годах. За ангаром находится башня водоснабжения лагеря, теперь посчитайте в ней кирпичи.

Внутри ангара Т2

Строится.

Сарай строился в 1937 году. Довоенные ангары на языке британских ВВС назывались ангарами.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Сарай «С» 3.

Детали

Это второй ангар категории «С».

Ручка открывания двери.

Стойки крыши

Дверь представляет собой стальную дверь двойной толщины, которая должна была быть засыпана гравием, что делало ее полу бронированной дверью. Хотя они были очень тяжелыми, их открывала и закрывала небольшая дверная ручка.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Вахтенная служба станций ночных истребителей.

Детали

Двухэтажный диспетчерский пункт времен Второй мировой войны, теперь модернизированный с помощью видеомагнитофона нового типа, размещенного наверху.

Вахтенная служба станций ночных истребителей на Королевских ВВС Шарми Даун.

Вот как это могло выглядеть до того, как VCR (Visual Control Room) был помещен наверху.

До того, как в 1960 г. был установлен видеомагнитофон?

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Вахтенная служба станций ночных истребителей.

Детали

Лучше вид на видеомагнитофон.

Стальная лестница на крышу.

Вид из диспетчерской через аэродром.

Тот же самый вид через видеомагнитофон, как вы видите намного лучше.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Перо истребителя.

Детали

Одна из 12 загонов «Е», шесть для 12-й истребительной эскадрильи, что делает этот аэродром, возможно, двухэскадрильным.Я пока нашел 7.

Загон для истребителей «E» с местом для двух истребителей и бомбоубежищем в задней стене.

‘E’ Pen в RAF Kenley под атакой люфтваффе.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Вторая ручка E и Windsock.

Детали

Летчики все летали.

Erks сделал весь ремонт.

Их лидеры все руководили.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

NS ВПП 16/34.

Детали

История: с появлением жестких взлетно-посадочных полос это был один из первых аэродромов, на котором была эскадрилья реактивных самолетов с 263Sqn и Meteors.

Взлет ночных истребителей Mosquito.

Метеор.

Ночной истребитель Beaufighter.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Аэродром.

Детали

История: в течение следующих 30 лет он вернулся к тренировкам и теперь является домом для одной из университетских учебных эскадрилий и местом посадки для Тукано из 1FTS (школы летной подготовки). 2013 год и все в балансе, закрытие в списке и потеря прекрасной реликвии 1930-х годов.
Продана частному владельцу.

План.

Площадка аэродрома.

RAF Church Fenton, Йоркшир

06 апреля 2010

Информация

Nissen Hut.

Детали

На южной стороне аэродрома сейчас в саду.

Хижина Ниссена военного времени и велосипедист.

Схема расширения закамуфлированное фото около 1942 года.

RAF Church Fenton, Йоркшир

2014

Информация

Бардак с офицерами RAF Dishforths был очень похож на тот, что был здесь.

Детали

Офицерская столовая и одноместные спальные помещения для офицеров, проект B [PB] 2948/36 Еще от 36 до 45 офицеров размещались в дополнительных хижинах «B», «Y» и «X».Хижина X&Y была 18 футов x 70 футов.

RAF Church Fenton

06 апреля 2010

Информация

Детали

RAF Church Fenton, Йоркшир

Чаз Гизби

Информация

RAF Church Fenton, Йоркшир
Стражи ворот Meteor & Spitfire

Детали

Gloster Meteor NF14 WS739, сделанный в 1975 году. Мне сказали, что он был окрашен в эти цвета после сварки из-за удара молнии, выбившего заклепки и т. Д. (Чаз Гизби) .

Подробная информация о Spitfire 5B.
Этот самолет символизирует роль дневного истребителя этой станции с 1937 по 1941 год, включая период битвы за Британию.
Он был построен в Касл Бромвич в апреле / ​​мае 1942 года, летал в составе 315 эскадрилий и 317 (польских) эскадрилий и 58 оперативного учебного подразделения, а в мае 1963 года был передан Черч Фентон.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *