Acinetobacter schindleri что это: Acinetobacter — это… Что такое Acinetobacter?

Содержание

Acinetobacter — это… Что такое Acinetobacter?

?

Acinetobacter

Acinetobacter baumannii

Научная классификация
Латинское название
Acinetobacter
Виды
  • Acinetobacter baumannii
  • Acinetobacter baylyi
  • Acinetobacter bouvetii
  • Acinetobacter calcoaceticus
  • Acinetobacter gerneri
  • Acinetobacter grimontii
  • Acinetobacter haemolyticus
  • Acinetobacter johnsonii
  • Acinetobacter junii
  • Acinetobacter lwoffii
  • Acinetobacter parvus
  • Acinetobacter radioresistens
  • Acinetobacter schindleri
  • Acinetobacter tandoii
  • Acinetobacter tjernbergiae
  • Acinetobacter towneri
  • Acinetobacter ursingii

Acinetobacter — род грамотрицательных бактерий, относящийся к семейству Moraxellaceae.

Обычно очень короткие и округлые, размеры их в логарифмической фазе роста составляют 1,0-1,5 x 1,5-2,5 мкм. В стационарной фазе роста они приобретают преимущественно форму кокков, располагающихся парами или в виде коротких цепочек. Большие непостоянной формы клетки и нити обнаруживаются в небольшом количестве во всех культурах, а иногда и преобладают. Спор не образуют, жгутиков не имеют, однако некоторые штаммы на плотной питательной поверхности демонстрируют «дергающуюся» подвижность. Капсулы и фимбрии могут быть, но могут и отсутствовать.

Бактерии рода Acinetobacter являются хемоорганотрофами с окислительным метаболизмом. Способность использовать органические соединения в качестве источников энергии и углерода непостоянна. Оксидазы не образуют, каталазопозитивны. Ацетоина, индола и сероводород не образуют. Строгие аэробы, оптимальная температура для роста 30-32°С, pH около 7,0. Обычно резистентны к пенициллину.

Являются свободно живущими сапрофитами, распространены повсеместно. Могут быть причиной многих инфекционных процессов, включая менингиты и септицемии у людей и септицемии и аборты у животных.

Ссылки

Микротерминатор – аналитический портал ПОЛИТ.РУ

Хоть я и работаю в больнице, занимающейся, в основном, плановым лечением и такими же операциями, но наша лаборатория выполняет анализы и для нескольких больниц скорой медицинской помощи. А это совсем другой формат не только лечения, но и микробных агентов. Одним из частых гостей в больницах скорой помощи является ацинетобактер, про него сегодня и поговорим.

Acinetobacter — род грамотрицательных бактерий из семейства Moraxellaceae. Главная отличительная черта этих крошек — переменчивая форма «тела». Есть бактерии, имеющие форму палочек, есть шарообразные кокки, а эти умеют менять форму, запутывая человека за микроскопом. Обычно они предстают в виде коротких и округлых, но всё-таки палочек, но в стационарной фазе роста приобретают преимущественно форму кокков, располагающихся парами или в виде коротких цепочек. Также можно обнаружить большие клетки непостоянной формы и даже нити.

Спор ацинетобактеры не образуют, жгутиков не имеют, однако некоторые штаммы на плотной питательной поверхности демонстрируют «дергающуюся» подвижность. Капсулы и фимбрии могут быть, но могут и отсутствовать. Другими словами, трудновато бывает их опознать, по всем пунктам они очень уж переменчивые. Ацинетобактеры являются хемоорганотрофами с окислительным метаболизмом. Способность использовать органические соединения в качестве источников энергии и углерода непостоянна. Строгие аэробы, оптимальная температура для роста 30–32 °С, pH около 7,0. Обычно резистентны к пенициллину.

Acinetobacter являются свободно живущими сапрофитами, распространены повсеместно. Могут быть причиной многих инфекционных процессов, включая менингиты и септицемии у людей и септицемии и аборты у животных.
В феврале 2017 года ВОЗ причислила ацинетобактеры к наиболее опасным бактериям в связи с их резистентностью к существующим антибактериальным препаратам.

Acinetobacter baumannii  — самый часто встречающийся вид из рода ацинетобактеров. Их естественная среда обитания до сих пор не известна, но в человеческой культуре они ответственны за множество случаев внутрибольничных инфекций. Вызывают менингит, пневмонию, заражение ран, инфекции кровотока и урологические инфекции. Оказывается, они являются проблемой для западных ветеранов Ирака и Афганистана, так как неоднократно приводили к осложнениям при лечении ранений. Из-за последнего обстоятельства бактерию даже иронично прозвали Iraqibacter.

Оппортунистические заболевания, вызванные Acinetobacter baumannii, могут не отличаться по симптомам от вызванных другими бактериями. Эти малыши не очень опасны для здоровых людей, но, атакуя тех, чей иммунитет снижен, приводят к более серьезным последствиям. А вы сами понимаете, длительное лечение и пребывание в больничных стенах не способствуют усилению сопротивляемости организма. Вот поэтому в больницах скорой помощи, особенно в анестезиолого-реанимационных отделениях, где тяжелые пациенты порой лежат очень долго, ацинетобактеры показывают свой дурной нрав.

A. baumannii включают в так называемый ESKAPE-патоген (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa и виды из рода Enterobacter) — группу бактерий с повышенной резистентностью к антибиотикам, которые ответственны за большинство больничных инфекций. Поэтому в очередной раз мораль басни такова — разумное применение антибиотиков.

Обсудите в соцсетях

Генетическое разнообразие и фармакодинамическое обоснование прогноза резистентности к антимикробным препаратам нозокомиальных штаммов Acinetobacter spp. в различных регионах России и Беларуси

На правах рукописи

004599700

МАРТИНОВИЧ Алексей Александрович

ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ И ФАРМАКОДИНАМИЧЕСКОЕ ОБОСНОВАНИЕ ПРОГНОЗА РЕЗИСТЕНТНОСТИ К АНТИМИКРОБНЫМ ПРЕПАРАТАМ НОЗОКОМИАЛЬНЫХ ШТАММОВ ACINETOBACTER SPP. В РАЗЛИЧНЫХ РЕГИОНАХ РОССИИ И БЕЛАРУСИ

14.03.06 — фармакология, клиническая фармакология 03.02.03 — микробиология

Автореферат

диссертации на соискание ученой степени

кандидата медицинских наук

1 kW? 2910

Смоленск -2010

004599700

Работа выполнена в лаборатории молекулярной диагностики и микробиологической лаборатории НИИ антимикробной химиотерапии ГОУ ВПО «Смоленская государственная медицинская академия Федерального агентства по здравоохранению и социальному развитию»

НАУЧНЫЙ РУКОВОДИТЕЛЬ

Доктор медицинских наук, профессор Козлов Роман Сергеевич

ОФИЦИАЛЬНЫЕ ОППОНЕНТЫ:

Доктор медицинских наук, профессор Ушкалова Елена Андреевна Доктор медицинских наук Сидоренко Сергей Владимирович

ВЕДУЩАЯ ОРГАНИЗАЦИЯ

ГОУ ВПО «Самарский государственный медицинский университет Федерального агентства по здравоохранению и социальному развитию»

Защита диссертации состоится «21» ^ 2010 г.Д. 2010 г.

Ученый секретарь диссертационного совета, доктор медицинских наук, профессор

Яйленко А. А.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы

Нозокомиальные инфекции являются основной инфекционной проблемой любого современного стационара (Relio J, 2002). Особенно остро этот вопрос стоит в отделениях со значительным потреблением антибиотиков, где нозокомиальная инфекция развивается у каждого пятого пациента и является основной причиной летальности (Alberti С, 2002). Одним из наиболее проблемных нозокомиальных возбудителей в зарубежных странах является Acinetobacter spp., при этом более 75% штаммов в Европе (Masterton R.G., 2005) и более 50% в США (Rhomberg PR, 2009) резистентны практически ко всем имеющимся антимикробным препаратам. Относительно высокую активность сохраняют карбапенемы, однако, благодаря продукции приобретённых карбапенемаз, и эти препараты теряют свою эффективность (Perez F., 2007). В связи с этим ведётся постоянный мониторинг резистентности к данной группе препаратов (Turner P.J., 2008). По данным российских исследователей, в нашей стране ежегодно отмечается порядка 2,5 млн. нозокомиальных инфекций (Акимкин В.Г., 2005). Причиной 15% из них в ОРИТ является A. baumannii, который более чем в 60% случаев является резистентным к трём и более группам антибиотиков. Группа карбапенемов сохраняет довольно неплохую активность, но некоторые штаммы проявляют устойчивость и к данным препаратам (Решедько Г.К., 2008). Масштабы распространения резистентности к карбапенемам, а также её механизмы на настоящий момент времени не изучены. Необходимо проведение крупного микробиологического исследования, которое помимо этого должно ответить на вопрос, какие препараты могут быть рекомендованы для включения в лекарственные формуляры и использованы в эмпирической терапии инфекций, вызванных полирезистентными ацинетобактерами, а какие следует исключить при данных инфекциях. Для возможности прогнозирования активности карбапенемов в будущем, необходима также оценка эпидемических свойств циркулирующих штаммов.

Цель исследования

Изучить с помощью современных методов генетическое разнообразие, динамику резистентности к антимикробным препаратам и распространённость карбапенемаз среди нозокомиальных штаммов Acinetobacter spp., выделенных в отделениях с интенсивным потреблением антибиотиков, и разработать на этой основе рекомендации по оптимизации эмпирической и этиотропной терапии инфекций, вызванных этими микроорганизмами.

Задачи исследования

1. Оценить в динамике распространенность Acinetobacter spp. в общей структуре грамотрицательных возбудителей нозокомиальных инфекций.

2. Определить с помощью современных методов чувствительность Acinetobacter spp. к используемым и перспективным антимикробным препаратам.

3. Разработать технологию ЛЦР в реальном времени для детекции приобретённых карбапенемаз молекулярного класса D у Acinetobacter spp.

4. Выявить распространённость металло-р-л актам аз и ОХА-карбапенемаз среди клинических штаммов Acmeiobacferspp., нечувствительных к карбапенемам.

5. Оптимизировать протокол мультилокусного секвенирования-типирования Acinetobacter baumannii и с его помощью изучить генетическое разнообразие карбапенемазо-продуцирующих штаммов.

Научная новизна работы

Впервые:

1. Организована система мониторинга карбапенеморезистентных штаммов Acinetobacter spp., вызывающих нозокомиальные инфекции в стационарах 21 города 7 федеральных округов Российской Федерации и 2 городов Беларуси.

2. Дана оценка in vitro активности перспективных антимикробных препаратов в отношении нозокомиальных штаммов Acinetobacter spp.

3. Разработан метод ПЦР в реальном времени для быстрого выявления генов приобретённых ОХА-карбапенемаз у Acinetobacter spp.

4. Изучена принадлежность карбапенеморезистентных штаммов Acinetobacter spp., вызывающих инфекции в стационарах России и Беларуси, к циркулирующим международным эпидемическим клонам.

Практическая значимость работы

1. Организованная система мониторинга карбапенеморезистентных штаммов Acinetobacter spp. в стационарах России и Беларуси является одним из направлений работы Научно-методического центра Федерального агентства по здравоохранению и социальному развитию по мониторингу антибиотикорезистентности.

2. Полученные фармакодинамические данные по активности различных классов и групп антимикробных, препаратов позволяют прогнозировать резистентность нозокомиальных штаммов Acinetobacter spp. в России и

предложить рекомендации по этиотропной и эмпирической терапии инфекций, вызываемых данным родом микроорганизмов. 3. Разработанный метод ПЦР в реальном времени и оптимизация протокола мультилокусного секвенирования-типирования А. ЬаитаппИ позволяет расширить возможности лабораторий центров Госсанэпиднадзора и микробиологических лабораторий при лечебно-профилактических учреждениях по своевременному выявлению эпидемиологически опасных штаммов.

Основные положения, выносимые на защиту

1.ег эрр. в России и Беларуси продукция приобретённых ОХА-карбапенемаз и принадлежность к новым и известным эпидемическим клональным группам является неблагоприятным прогностическим признаком распространения карбапенеморезистентности в ближайшем будущем.

3. Перспективными препаратами для терапии инфекций, вызванных Асте1оЬаЫег эрр., в настоящее время являются имипенем, дорипенем, меропенем и цефоперазон/сульбактам, а в будущем — колистин и лолимиксин Б.

Внедрение результатов в практику

Практические рекомендации, разработанные в диссертации, используются в работе медико-профилактических учреждений гг. Екатеринбурга, Новосибирска, Москвы, Краснодара, Минска, Смоленска. Основные положения работы излагаются на семинарах и циклах повышения квалификации врачей и курсах усовершенствования лаборантов в НИИАХ ГОУ ВПО СГМА Росздрава, на конгрессах, конференциях и семинарах МАШАХ, на практических занятиях и лекциях кафедры клинической фармакологии ГОУ ВПО СГМА Росздрава.

Апробация работы

Результаты исследования представлены на Международном конкурсе научно-исследовательских работ по антимикробной химиотерапии, памяти члена-корреспондента РАМН, д.м.н., профессора Л.С. Страчунского (Смоленск, 2007 г.), 35-й конференции молодых ученых СГМА (Смоленск, 2007 г.), Научно-практическом семинаре «Бета-лактамазы: значение и методы выявления» (Смоленск, 2007 г.),

Научно-практическом семинаре «Определение чувствительности к антибиотикам: практические аспекты и значение для клинической практики» (Смоленск, 2007 г.),

XVIII конгрессе ECCM1D (Барселона, 2008 г.), Ш Национальном конгрессе терапевтов (Москва, 2008), курсах усовершенствования лаборантов (Смоленск, 2008, 2009 гг.), циклах повышения квалификации врачей-бактериологов (Смоленск, 2008, 2009 гг.), циклах повышения квалификации клинических фармакологов (Смоленск, 2008, 2009 гг.), XI Российском национальном конгрессе «Человек и лекарство» (Москва, 2009 г.),

XIX конгрессе ECCMID (Хельсинки, 2009 г.), XI Международном конгрессе МАКМАХ по антимикробной терапии (Москва, 2009 г), 37-й конференции молодых ученых СГМА (Смоленск, 2009 г.), XIX Национальном конгрессе по болезням органов дыхания (Москва, 2009), 49-й конференции ICAAC (Сан-Франциско, 2009 г.), Научно-практическом семинаре «Молекулярная бактериология: идентификация, типирование и выявление антибиотикорезистентности» (Смоленск, 2009 г.), совместном заседании сотрудников кафедр госпитальной педиатрии с курсом неонатологаи ФПК и ППС, клинической фармакологии, микробиологии, поликлинической педиатрии, терапии педиатрического и стоматологического факультета, терапии ФПК и ППС, общественного здоровья и здравоохранения, травматологии и ортопедии, урологии, факультетской терапии, сотрудников НИИ антимикробной химиотерапии ГОУ ВПО «Смоленская медицинская академия Федерального агентства по здравоохранению и социальному развитию» (Смоленск, 2010 г.).

Публикации

По материалам диссертации опубликовано 6 научных работ, из них в ВАК рецензируемых журналах — 2, в зарубежных научных изданиях — 4, в центральных научных изданиях — 2.

Объем и структура диссертации

Диссертация изложена на 144 страницах машинописного текста и состоит из введения, обзора литературы, материалов и методов исследования, результатов и обсуждения собственных исследований, заключения, выводов, практических рекомендаций, списка литературы, который включает 27 отечественных и 257 иностранных источников. Материал иллюстрирован 15 таблицами, 35 рисунками, содержит 1 приложение.

СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы исследования

Фенотипическое изучение микроорганизмов

В исследование включался клинический материал, полученный от пациентов с нозокомиальными инфекциями любой локализации, находящихся на госпитализации в лечебных учреждениях России и Беларуси. На каждый штамм Acinetobacter spp. заполнялась специально разработанная индивидуальная регистрационная карта. Для регистрации штаммов нами была создана база данных «КАРАТ» на основе программы M-Lab (НИИАХ, Смоленск). Повторные изоляты одного вида, полученные от одного пациента, в исследование не включались. Культурапьное исследование клинического материала и предварительную идентификацию производили в локальных лабораториях, реидентификацию — в лаборатории НИИАХ ГОУ ВПО СГМА Росздрава на основании тинкториальных и биохимических свойств (Приказ №535, 1985). МПК антибиотиков устанавливались методом двойных серийных разведений в агаре Мюллера-Хинтон II (Becton Dickinson, США) химически чистых субстанций антибиотиков (BioRad, США). Результаты оценивали в соответствии с МУК 4.2.1890-04. Все микроорганизмы, в зависимости от полученной МПК, были разделены на чувствительных к определённому антибиотику и нечувствительных (умеренно-резистентные + резистентные). Контроль качества определения чувствительности производили с использованием референтных штаммов Американской коллекции типовых культур Р. aeruginosa АТСС®27853, Е. coli АТСС®25922 и Е. coli АТСС®35218. Штаммы Acinetobacter spp., нечувствительные к карбапенемам, были изучены на продукцию метапло-бета-лактамаз методом синергизма двойных дисков с ЭДТА.

Обработка данных и статистический анализ

Обработка данных и анализ результатов исследования были проведены с использованием программ Excel (Microsoft, США) и M-Lab (НИИАХ, Смоленск). Статистический анализ проводился в системе статистического анализа SAS (SAS Institute, США, версия 8.02 для Windows ХР). Качественные признаки представлены в виде долей, процентных интервалов, абсолютных чисел. Сравнительный анализ качественных переменных проводился с помощью критерия Хи-квадрат, если более 20% ожидаемых частот были менее 5, то использовался точный двусторонний

критерий Фишера. Результат представлялся в виде критерия «р», различие считалось достоверным при р < 0,0001.

Генотипическое изучение A. baumannii

Наличие генов V1M- и IMP- лактамаз устанавливалось методом ПЦР (Шевченко О.В., 2007). Длина продуктов амплификации изучалась с помощью электрофореза (PowerPac Basic, BioRad, США) в 2% агарозном геле (peq Gold Universal agarose, peQ Lab GmbH, Германия) и 0,5х TBE буфере (Sigma-Aldrich, Inc., США).

Разработка методики по выявлению приобретённых ОХА-карбапенемаз осуществлялась на основе известных последовательностей генов Ь/зоха’- ОХА-23 (Na GB -AJ132105), ОХА-24 (№ GB — AJ239129), ОХА-25 (№ № GB — AF201826), ОХА-26 (№ GB — AF201827), ОХА-27 (Na GB — AF201828), ОХА-40 (№ GB — AF509241), ОХА-49 (№ GB — AY288523) и ОХА-58 (№ GB — DQ385607), полученных в базе данных NCBI с помощью программы CLC Combined Workbench 3 (CLC bio, Дания). Для дизайна прай-меров использовали программы GeneRunner (Hastings Software Inc., США) и BioEdit (Isis Pharmaceuticals Inc., США). Проверка специфичности праймеров осуществлялась на сайте PubMed с помощью функции Primer-BLAST.

Выбор методики для мультилокусного секвенирования-типирования штаммов А. baumannii осуществлялся из двух работ: английской (Sergio Bartual, 2005) и французской (Keith Jolley, 2004). Большей достоверностью и дифференцирующей способностью характеризовался первый метод, но он имел ряд недостатков, которые ухудшали качество результатов реакции, а иногда и приводили к невозможности её постановки. Это: 1) отсутствие единого протокола амплификации и секвенирования; 2) вырожденность праймеров; 3) различные температурные режимы работы праймеров; 4) большая длина праймеров; 5) наличие описанных замен в местах посадки праймеров. Для усовершенствования методики было необходимо: а) разработать собственные праймеры, лишённые указанных недостатков; б) создать единый протокол амплификации и секвенирования; в) для сохранения преемственности, набор изучаемых генов, длину и состав анализируемых фрагментов оставить прежними.

Дизайн праймеров осуществлялся на основе известной последовательности генома штамма A. baumannii АТСС 17978, полученной в базе данных NCBI с помощью программы CLC Combined Workbench 3 (CLC bio, Дания). Разработка праймеров велась на программном обеспечении GeneRunner (Hastings Software Inc., США) и BioEdit (Isis Pharmaceuticals Inc., США). Проверка специфичности праймеров осуществлялась на сайте PubMed с помощью функции Primer-BLAST. Амплификацию про-

водили на термоциклере Chromo4 (Bio Rad Laboratories, США). Очистка продуктов амплификации для последующего секвенирования осуществлялась колонками (Promega Corporation, США) либо набором ферментов ExoSAP-iT (Fermentas, Канада). Секвенирование проходило на термоциклере DNA Engine РТС-200 (MJ Research Inc, США). Отмывка продуктов секвенирования осуществлялась этиловым спиртом (РосБио, Россия). Для анализа использовали секвенатор ABI PRISM 310 Genetic Analyzer (Applied Biosystems, США).

Результаты исследования и их обсуждение

География и сроки проведения исследования

Исследование проходило в 4 этапа. В 1997-1999 гг. изучалась грамотрицательная флора 29 ОРИТ 14 городов России, в 2002-2004 гг. — 33 ОРИТ 22 городов России, в 2006-2008 гг. — 36 стационаров различного профиля 26 городов России, расположенных в 7 федеральных округах. С 2008 г. нами была организована система мониторинга резистентных к карбапенемам Acinetobacter spp. в стационарах России и Беларуси. В её рамках к концу 2009 г. были получены штаммы из 7 стационаров 2 городов Беларуси и 7 стационаров 6 городов России. Всего в исследовании участвовало 74 стационара 35 городов (Рис. 1). Из них было получено

Рис. 1. География центров-участников исследования.

8167 штаммов микроорганизмов: 2787 в первый, 3042 во второй, 2224 в третий и 114 в четвёртый этапы исследования. Общее количество ацинетобактеров составило 1114 штаммов.

Структура нозокомиальных возбудителей в России и положение Acinetobacter spp.

Рис. 2. Структура нозокомиальных патогенов в ОРИТ в 1997-1999 гг.

В 1997-1999 гг. частота выделения Acinetobacter spp. в ОРИТ России составляла 7,25% и он являлся шестым грамотрицательным нозокомиальным патогеном после Р. aeruginosa и ряда энтеробактерий (Рис. 2).

17,8*/.

К. рпеитот 13,8

Другие ГОБ 33%

_ Другие ГОНФБ

1,9%

P. aeruginosa 34,6%

Acinetobacter spp.

153%

Всего: 3 042 штамм«

Рис. 3. Структура нозокомиальных патогенов в ОРИТ в 2002-2004 гг.

В 2002-2004 гг. доля ацинетобакгеров выросла более чем в два раза (15,3%, р < 0,0001) и по значимости он уступал только Р. aeruginosa, а суммарная доля неферментирующих бактерий превысила 50% (Рис. 3).

Proteus spjb

19 7% Всего: 1 292 цгтаииа

Рис. 4. Структура нозокомиальных патогенов в ОРИТ в 2006-2008 гг.

В 2006-2008 гг. частота обнаружения Ас/пе&>6айег эрр. выросла незначительно (16,3%, р = 0,37) и он стал третьим грамотрицательным и вторым нефермен-тирующим патогеном в ОРИТ России (Рис. 4).

Таким образом, доля нозокомиальных инфекций, вызванных АстеЫаЫег эрр., в российских ОРИТ с годами неуклонно растёт, а группа неферментирующих бактерий является лидирующей в структуре патогенов.

Оценивая роль изучаемых микроорганизмов в отделениях различного профиля следует отметить, что наибольшую значимость в 2006-2008 гг. ацинетобактеры имели в ожоговых отделениях и отделениях инфекционной хирургии, где они являлись причиной 28,9% инфекций, а общая доля неферментирующих бактерий превышала 75%.Отдоленив МО Все отделения ОРИТ ОИ Хирургия ОГ Терапия

P. aeruginosa 35,4 35,9 44,4 32,7 11,1 46,4

К. pneumoniae 16,7 19,7 6,1 12,3 33,3 12,5

Acinetobacter spp. 15,0 16,3 28,9 10,9 0 3,6

Е. coli 13,7 9,6 3,9 23,3 22,2 23,2

Enterobacter spp. 6,3 5,4 6,1 6,7 22,2 3,6

Proteus spp. 4,2 3,5 5,6 5,8 0 3,6

S. marcescens 2,7 3,9 0 1,4 0 0

S. maltophilia 2,5 3,3 . 2,2 1,1 1,6 3,6

Другие ГО Б 3,1 1,9 2,2 5,1 9,5 3,6

Другие ГОНФБ 0,5 0,5 0,6 0,6 0 0

Всего МО 2224 1292 180 626 63 56

ОИ — ожоговая и инфекционная хирургия, ОГ- онкология и гематология.

Динамика резистентности к используемым антибиотикам и различия в зависимости от профиля отделения

Оценить динамику резистентности возможно только на примере ОРИТ. Из представленных на Рисунке 5 данных видно, что уже в конце 90-х гг. высокой активностью в отношении нозокомиальных Acinetobacter spp. обладали только имипенем и амикацин, менее активными были ципрофлоксацин и цефепим. Остальные препараты были неактивны в 50% случаев и более. В период с 1999 г. по 2002 г. произошёл скачок резистентности и в 2002-2004 гг. единственной высоко активной группой препаратов осталась группа карбапенемов, резистентность к другим препаратам превышала 60%. В 2006-2008 гг. было отмечено снижение активности и карбапенемов, в меньшей степени имипенема, в большей -меропенема. Однако по-прежнему эти препараты сохраняли высокую активность в отношении нозокомиальных Acinetobacter spp. Более 95% штаммов были нечувствительны к цефалоспоринам III поколения и пиперациллину.

ДмлкаЦПЯ 1997-1999 гг. НЧ, % п — 205 Ч «<■ 2002-200-1 гг. НЧ. % „ — 464 ч. % 2006-2008 гг. НЧ.’ъ п-2П Ч.%

9.4 ■ | 90,6 65,1 ■■■ 1 343 81 ■■■■■ОЛ 19

Гентамнцив 69 ■■■■■ИЗ 51 88.3 ■■■■■■□ 1 и 82 ■■■■■■□□ 18

Швшенем Левофлоксяцие Меропенем

2,5 1 1 9-г 2.4 1 | 9″ .6 4″ | | 953

1 Не оыл тучен 1 |<:зНВВ 13— 90 ■■■■■О Ю

| Н е оыл щучен [ 3.газобактам, тик/клав — тикарцил-лин/клавулунат

Рис. 5. Динамика резистентности Аапе1оЬаЫег эрр. в ОРИТ России.

При изучении активности антимикробных препаратов в отделениях различного профиля видно, что наиболее благоприятная ситуация наблюдалась в хирургических отделениях. Ситуация в ОРИТ сопоставима с таковой в ожоговых отделениях и отделениях хирургической инфекции, однако в последнем случае практически все штаммы были нечувствительны к гентамицину и пилерациллину/тазобактаму, меньшей активностью обладал амикацин. При оценке карбапенемов следует отметить, что лучшей активностью во всех отделениях обладал имипенем, наибольшая резистентность к которому наблюдалась в ОРИТ и составляла 4,7%. В ожоговых и отделениях хирургической инфекции не было выделено ни одного устойчивого к имипенему штамма, однако уровень резистентности к меропенему был самым высоким — 23,1%. Резистентность к меропенему в хирургических отделениях была выше таковой в ОРИТ, что может говорить о нерациональном применении меропенема в хирургии.

Хирургия И% и = 68 Ч, % он ЯЧ,% U-52 ■7. «о OPIIT НЧ,\ п- 211 Ч,

Ампкацпн 6is шшшшт 1 38jl 94 Л 5’s 81 ■■■■■■ | 19

Гентамыцпн so з Н 19,1 98,1 Ц И 1.9 82 ЯШШ _] 18

Шшпенем 1,5 L 98,5 »1 100 4-1 I 953

_

Левофлок сядпа «2.1 НИНЕ! П 2″<> 1 | т 90 ■ I 10

Меропенем ».»в _ 1 853 23,1 ■ -ei пзи )8

Ппперлцнлтпн 92.« Н ■Д «..4 98.1 ЗШВШИМШЕЖ 1<9 98,1 ■■ Hi

Пппертазо Г; 11.8 шВН Ml 3.8 382 ■Ли ■ J 11.8

Та к.-к лав зол Я | 19.1 84.6 ■■ CJ 15’4 80.1 МаЯ _ 19J>

Цефепам 32.4 Ш| _11-,6 И&ШШ В (15.4 ‘•>.!, П J 20.4

Цефоперазон

95.6 Ш ■J 4.4 98.1 ■ 99- ПИВ Hfl 0.;

Цефотакслм 9U| С s.8 98,1 ИН HQ 1.9 НЕН ■U 2.8

Цефтазпдп м

91.2 ННМС 8.8 962 ЯН 95,- в ■Li 4. 1 [ 1« 93.8 Щ ■J 6-2

ОИ — ожоговые отделения и отделения хирургической инфекции, п — количество штаммов, пи-пер/тазо — пиперациллин/тазобактам, тик/клав — тикарциллин/клавулунат. Рис. 6. Резистентность /\cOTefobacierspp. в стационарах России в 2006-2008 гг.

Оценка активности перспективных антимикробных препаратов

В ситуации неуклонного роста устойчивости к карбапенемам необходимо иметь в резерве антибиотики, активные в отношении полирезистентных Acinetobacter spp. В данной работе была произведена оценка 5 перспективных препаратов: дорипенема, колистина, нетилмицина, полимиксина Б и цефоперазона/ сульбактама (Рис. 7). Из них, наибольшую активность проявили полимиксины: резистентных к колистину штаммов выделено не было, нечувствительным к полимиксину Б был только один штамм. Дорипенем и цефоперазон/сульбактам характеризовались сходной активностью и уступали только полимиксинам и имипенему. Нетилмицин был наиболее активным препаратом в группе аминогликозидов, но наименее активным среди перспективных. Использовать его в терапии инфекций, вызванных нозокомиальными, следует только после подтверждения его активности in vitro.

НЧ. % и — 333 ч, %

Ампклщш 20,9

Гейтами цин 15.8

Нетлмицнн 21.8 НЯЯВМ 1 -Я 2

Дорнпенем «3 ЯМ 1 92″

Меропенем и’ шятш …… 1 855

Имнпенем г.- ■ I 97.3

Левофлоксяцин ыа

Цппроф доксацин 3.5

Ппперацнллнн 2~

Пнпер та то 10.6

Тик/кляв 19.1

— 18.8

Цефепим

Цефоперазон 1.2

Цефопер сульб 103 ииг- » «1 89.»

Цеф отакснм 3.6

Цефтазпднм 4.8

Ко.ШСШН 0 1 ‘ 1 1<Н)

Полпмнксин Б 1 0.3 1 1 99.»

Рис. 7. Резистентность Ас/пе?оЬас?ег эрр. в стационарах различного профиля в России в 2006-2008 гг.

Ввиду высокой активности полимиксинов, карбапенемов и цефоперазона/ сульбактама представляется целесообразным рассмотреть распределение их МПК в отношении 333 Аа’пеЬЬаЫегзрр.ег зрр. по значениям МПК полимиксина Б.

Полимиксин Б имел схожее с колистином распределение МПК (Рис. 9), однако один штамм был резистентен к препарату. Большая часть штаммов также отстояла от границы резистентности на два разведения, что является хорошим признаком.

30,9 30,3

0,06 0,125 0,25 0,5 1 2 4 ■ 8 16 32

Рис. 10. Распределение Ac;лefobacferspp. по значениям МПК дорипенема.

мг/мл

Распределение МПК дорипенема имело мономодальный характер, что затрудняет выделение групп резистентности к данному препарату.

ч

УР

%

9,7

0,06 0,125 0,25 0,5 1

0,6

8

1,8 03

мг/мл

16 32

Рис. 11. Распределение Лc/лeíoЬэcíer эрр. по значениям МПК имипенема.

УР

%

03 03 !>5

25,2 _ 23,6!

0,06 0,125 0,25 0,5 1 2 4,8

0,9 03

мг/мл

16 32

Рис.-ф-л 1 1

16 -32 • 64

мг/мл

0,125 0,25 0,5 1 2 4 8

Рис. 13. Распределение Ас/пе(оЬас(ег врр. по значениям МПК цефоперазо-на/сульбактама.

Как видно из представленных рисунков, наилучшее положение действительно имели полимиксины, так как большая часть штаммов отстояла на два разведения от границы резистентности и, вероятно, в ближайшее время будет сохранять чувствительность к данным препаратам. Распределение МПК имипенема носило бимодальный характер и совпадало с установленными критериями резистентности, большая часть штаммов также отстояла от границы на два разведения. Согласно бимодальному распределению меропенема, нечувствительными к нему являются

штаммы с МПК > 1 мг/мл, то есть 57,2% штаммов. Дорипенем имел мономодальное распределение МПК, однако оно было схожим с меропенемом; в таком случае резистентность к нему так же будет выше установленной — 53,1%. Более 20% штаммов находилось на границе резистентности к цефоперазону/сульбактаму и потенциально может потерять чувствительность к нему в ближайшее время.Ac/лetoЬacíeг врр. в России в 2006-2008 гг.

Выявление приобретённых карбапенемаз и разработка технологии ПЦР для детекции генов приобретённых ОХА-карбапенемаз

За время исследования было получено 186 штаммов АЫпеЬЬаЫег врр., устойчивых хотя бы к одному из двух карбапенемов (МПК имипвнема и/или

Дорипенем

Пмппене;

меропенема >8 мг/мл): 5 на первом, 17 на втором, 50 на третьем и 114 на четвёртом этапе. Ни одного продуцента МБЛ среди них обнаружено не было. Для возможности выявления генов приобретённых КМКД была разработана собственная технология ПЦР в реальном времени: осуществлён дизайн 6 праймеров для трёх описанных у ацинетобактеров групп данных ферментов (Табл. 2), оптимизирован состав реакционной смеси (0,6 мкМ каждого праймера, набор азотистых оснований дНТФ — 200 мкМ ка>едого, 1,7 мМ MgCI2, 1,5 Ед Taq-F ДНК-полимеразы, 5 мкл однократного безмагниевого ПЦР-буфера, 0,5 мкл SYBR Green I, 6,7 мкл воды и 2 мкл образца ДНК, полученного кипячением 3-5 колоний в ТЕ буфере) и отработан температурный протокол ПЦР (активация Taq-F полимеразы: 95°С, 15 мин.; 30 циклов амплификации: денатурация 95°С, 20 сек, отжиг 59°С, 20 сек, элонгация 72°С, 30 сек, анализ кривых плавления: стабилизация смеси 72°С, 3 мин.; плавление в диапазоне 72°С — 95°С с задержкой в 30 сек на 72°С и последующим подъёмом на 1°С каждые 5 секунд) для термоциклера Rotor-Gene 2000 System (Corbett Research, Австралия). В результате было получено три продукта амплификации, имеющих различные температуры плавления, которые методом электрофореза были причислены к соответствующей группе ОХА-карбапенемаз. Разработанным методом было выявлено 132 продуцента приобретённых ОХА-карбаленемаз: 1 в 1997-1999 гг., 11 в 2002-2004 гг., 9 в 20062008 гг., 58 в 2008-2009 гг. в России и 53 в 2008-2009 гг. в Беларуси (Табл. 3). Таким образом, до 2008 г. в России наблюдались единичные случаи инфекций, вызванных ОХА-продуцирующими штаммами, в географически отдалённых друг от друга городах. Обращает на себя внимание выделение OXA-58-продуцирующих штаммов

Таблица 2

Праймеры, разработанные для детекции приобретённых КМКД у Acinetobacter spp.

Название Ген Последовательность Длина продукта,

OXA-23-F1 Ыа охА-23 TGAAACCCCGAGTCAGATTGT 498

OXA-23-R1 Ыа оха-23 CTAAATGGAAGCTGTGTATGTGCT

OXA-40-F Ь/с?оХА-40 GATG AAG СТСАААСАС AG G GTG 587

OXA-40-R Ыа охА-40 TTTCCATTAGCTTGCTCCACC

OXA-58-F Ыа OXA-58 GGGCTTGTGCTGAGCATAGT 739

OXA-58-R Ь/Э0ХА-58 CGTAGAGCAATATCATCACCAGC

Таблица 3

География продуцентов приобретённых КМКД.

Тип КМКД Страна Город Центр Год Кол-во

ОХА-58 Россия Ставрополь 1 1997 1

ОХА-23 Россия Иркутск 1 2002 2

ОХА-58 Россия — Москва 2 2002 4

ОХА-58 Россия Москва 2 2003 1

ОХА-58 Россия Новосибирск 2 2003 3

ОХА-23 Россия Москва 11 2004 1

ОХА-58 Россия Екатеринбург 1 2006 2

ОХА-58 Россия Екатеринбург 4 2006 1

ОХА-58 Россия Новосибирск 1 2006 4

ОХА-58 Россия Москва 2 2006 2

ОХА-23 Россия Краснодар 2 2008 14

ОХА-40 Беларусь Минск 1 2008 5

ОХА-40 Беларусь Могилёв 1 2008 5

ОХА-40 Беларусь Могилёв 2 2008 2

ОХА-23 Россия Краснодар 2 2009 8

ОХА-40 Беларусь Минск 2 2009 28

ОХА-40 Беларусь Минск 3 2009 4

ОХА-40 Беларусь Минск 4 2009 3

ОХА-40 Беларусь Минск 5 2009 2

ОХА-40 Беларусь Минск 6 2009 2

ОХА-40 Беларусь Минск 7 2009 2

ОХА-40 Россия Москва 12 2009 5

ОХА-23 Россия Ростов-на-Дону 1 2009 1

ОХА-40 Россия Самара 1 2009 16

ОХА-40 Россия Санкт-Петербург 3 2009 6

ОХА-58 Россия Санкт-Петербург 3 2009 2

ОХА-58 Россия Смоленск 2 2009 4

ОХА-58 Россия Смоленск 3 2009 2

Аа’пе1оЬас!ег $рр. на протяжении нескольких лет в центре №2 г. Москвы, что может свидетельствовать о циркуляции карбапенеморезистентных штаммов либо факторов резистентности к карбапенемам в среде данного стационара. В 2002 г.,

возможно, имела место вспышка инфекций, так как все 4 штамма были получены в течение одного месяца. В центре №1 Новосибирска в 2006 г. так же могла иметь место циркуляция либо возбудителя, либо факторов резистентности к карбапенемам. В 2008-2009 гг. количество карбапенеморезистентных штаммов значительно выросло, а инфекции иногда стали приобретать массовый характер и возникать в близлежащих городах. Более того, все полученные штаммы продуцировали ту или иную группу ОХА-карбапенемаз. Похожая ситуация наблюдалась и в Беларуси, где за аналогичный период времени было получено 56 резистентных к карбапенемам штаммов, из которых 53 являлись продуцентами приобретённых КМКД. В большинстве стационаров Беларуси наблюдались случаи единичных инфекций, однако из центра №2 г. Минска было получено 30 штаммов в течение трёх месяцев, что свидетельствует о серьёзности проблемы и о высокой патогенное™ данного возбудителя.

Также в работе был проведён поиск разработанным методом «молчащих» генов приобретённых ОХА-карбапенемаз у 168 чувствительных к карбапенемам штаммов (МПК и меропенема, и имипенема <8 мг/мл). Результаты исследования во всех случаях были отрицательными. Это, во-первых, подтверждает эпидемические свойства ферментов, во-вторых, показывает, что наличие генов приобретённых КМКД всегда свидетельствует о резистентности штамма к карбапенемам.

Оптимизация методики мультилокусного секвенирования-

типирования штаммов Acinetobacter baumannii

Модернизация методики типирования штаммов A. baumannii осуществлялась путём дизайна 14 праймеров к локусам 7 генов (Табл. 4), оптимизации состава реакционной смеси (0,6 мкМ каждого праймера, набор азотистых оснований дНТФ — 200мкМ каждого, 1,7 мМ MgCI2, 1,5 Ед Taq-F ДНК-полимеразы, 5 мкл однократного безмагниевого ПЦР-буфера, 0,5 мкл SYBR Green I, 11,2 мкл воды и 2 мкл образца ДНК, полученного кипячением 3-5 колоний в ТЕ буфере) и отработки температурного протокола ПЦР (активация Taq-F попимеразы: 95°С, 15 мин., 30 циклов амплификации: денатурация 95°С, 20 сек., отжиг 54°С, 30 сек., элонгация 72°С, 45 сек.; и анализ кривых плавления: стабилизация смеси 72°С, 3 мин.; плавление в диапазоне 72°С — 94°С с подъёмом на 1°С каждые 5 сек.) для термоциклера Chromo4 (Bio Rad Laboratories, США). Данные условия обеспечивали выраженную специфическую амплификацию, а длина продукта амплификации каждого локуса, определяемая при электрофорезе, соответствовала указанной в

Таблица 4

Собственные праймеры для секвенирования-типирования A. baumanniï.

Локус Праймер Последовательность праймера Размер ампликона Opt T° Задача

gltA gltA-f АСА GTG GCA CAT TAG GTC С 722 63,4 А+С

gltA-r GCA GAG ATA CCA GCA GAG ATA CA 63,5 А+С

дугВ gyrB-f AAC CAT CTC AAC GAA АТС TTC С 909 64,7 А+С

дугВ-г CTG GGT CTT TTT CCT GAC А 64 А+С

gdhB gdhB-f1 CCA CAT GCT TTG TTA TGG GG 775 65,3 А+С

gdhB-r1 GAT TTA AGC GTA ATA CTT TAC CCA T 64,4 А+С

гесА гесА-f GGT CCT GAA TCT TCT GGT AAA AC 425 64 А+С

recA-г GAA TTT AAG AGC ATT ACC ACC AGT 64,5 А+С

српбО cpn60-f CAA CTG TAC TTG CTC AAG С 479 54,5 А+С

српбО-г CGC TTC ACC TTC AAC АТС TTC 64,1 А+С

9Р> gpi-f AAA АТС CAT GCT GGG CAA TA 508 65 А+С

gpi-r1 CAT СТА TAC CAA TCG TTA GGG CT 65 А+С

rpoD rpoD-f GTG AAG GTG AAA TCA GCA TTG С 492 66,6 А+С

rpoD-r GCA ATT TGT TCA TCT AAC CAA GC 66 А+С

оригинальной методике. Условия секвенирования также были несколько изменены. Объём секвенирующей смеси равнялся 10 мкл и включал 2 мкл смеси терминаторов, по 1 мкл 5-кратного секвенирующего буфера, праймера и продукта ПЦР, 5 мкл воды. Конечный протокол секвенирования состоял из активации при 96°С в течение 1 минуты и 30 циклов амплификации: денатурация 96°С, 10 сек.; отжиг 50°С, 10 сек.; элонгация 60°С, 4 мин. В результате анализа продуктов секвенирования были получены чёткие хроматограммы.

Генетическое разнообразие А, ЬаитаппИ в России и Беларуси

Для оценки генетического разнообразия циркулирующих в стационарах России и Беларуси штаммов А. ЬаитаппИ из каждого центра было взято по одному ОХА-продуцирующему штамму с характерной антибиотикограммой. Всего в работу было включено 15 штаммов: 14 штаммов А. ЬаитаппИ и один штамм А. !моШ (Табл.

5). Перед проведением мультилокусного секвенирования-типирования было проведено типирование по локусу гесА, в результате которого штамм А. ЬаитаппИ МУУ-3577 был реидентифицирован как Аапе(оЬас(ег геномовид 10, а штамм А. ¡\NQffn N32-1777 — как А. ЬаитаппИ. Штамм М\Л/-3577 из дальнейшего анализа был исключён. В результате МЛСТ были установлены аллельные варианты изучаемых генов каждого штамма (Табл. 6). В большинстве случаев полученные аллели были идентифицированы как ранее описанные. Однако было выделено 16 новых аллелей, отличающихся от известных на 1-4 нукпеотидные замены. Каждый из изученных штаммов содержал хотя бы один новый аллель, поэтому все они были отнесены к 9 новым сиквенс-типам. Методом минимальных нуклеотидных различий и методом аллельных вариантов было установлено высокое генетическое сходство большинства штаммов с известными сиквенс-типами (Табл. 6), которые являются причиной ряда нозокомиальных инфекций в Австралии и в различных странах Европы и Азии с 1991 г. Для оценки эпидемических свойств изучаемых штаммов по

Таблица 5

Штаммы Ac/лeío6acíeгspp., выбранные для секвенирования-типирования.

№ МО ОХА Год Город Центр

ЕК1-386 А. ЬаитаппИ 58 2006 Екатеринбург 1

ЕК2-1283 А. ЬаитаппИ 58 2006 Екатеринбург 4

1Я-547 А. ЬаитаппИ 23 2002 Иркутск 1

КК-26517 А. ЬаитаппИ 23 2008 Краснодар 2

Мв-25674 А. ЬаитаппИ 40 2008 Могилёв 1

М1-25818 А. ЬаитаппИ 40 2008 Минск 1

М\Л/-797 А. ЬаитаппИ 58 2002 Москва 2

М\Л/-3577 А. ЬаитаппИ 23 2004 Москва 11

М\Л/-2282 А. ЬаитаппИ 58 2006 Москва 2

М\/У-816 А. ЬаитаппИ 58 2003 Москва 2

N81-2280 А. ЬаитаппИ 58 2003 Новосибирск 2

N32-1671 А. ЬаитаппИ 58 2006 Новосибирск 1

N32-1744 А. ЬаитаппИ 58 2006 Новосибирск 1

N32-1777 А./иго/У» 58 2006 Новосибирск 1

31.-248 А. ЬаитаппИ 58 1997 Ставрополь 1

их МЛСТ профилям методом кластерного анализа невзвешенных средних арифметических величин (иРвМА) было установлено, что большинство штаммов действительно относятся к описанным клональным группам, а значит, имеют доказанное клиническое и эпидемическое значение. Интересным представляется факт циркуляции штаммов, имеющих абсолютно одинаковое строение изучаемых локусов, в географически отдалённых городах двух стран (Новосибирск-Екатеринбург-Могилёв; Москва- Новосибирск). В тоже время в одном стационаре Новосибирска было выделено три штамма, имеющих абсолютно разное строение.

В рамках данного исследования был проведён анализ зависимости типа продуцируемой карбапенемазы от принадлежности к той или иной клонапьной группе. Было выявлено, что штаммы, имеющие одинаковые или близкие сиквенс-типы, несли гены приобретённых ОХА-карбапенемаз различных групп. Таким образом можно говорить о независимом наследовании факторов устойчивости к карбапенемам нозокомиальными штаммами Ас/пе(оЬас(егБрр.

Таблица 6

Результаты типирования штаммов А. Ьаитапп/7.

Ыг Штамма дИА дугВ дсЖВ гесА српбО др> гроЭ Родственный СТ

МРН ЗДЛ

81.-248 1 15 23х 12 4 12х 2 20 20

113-547 1х 15 16х 11 15х Зх 2 — -

М\Л/-816 1 15 23хх 10 14 12х 18 37 34, 35, 37,48,49

ГШ-2282 1 15 2х 15 1 14х 18 — 45

М\Л/-797 1 15 2х 15 1 14х 18 —

N82-1777 1 15 2х 15 1 14х 18 —

N31-2280 10 12 4х 11 4 9х 5 16, 25 43,44 44

ЕК1-386 10 12 4х 11 4 9х 5

ЕК2-1283 10 12 4х 11 4 9х 5

МС-25674 10 12 4х 11 4 9х 5

N32-1671 10 12 4х 11 14 9х 5 -

N82-1744 1 12 Зх 2 2 19х 3 6, 33 4, 21,33

М1-25818 1 3 Зх 2 2 7х 3 22,41 22,41,53

КК-26517 10 25х 4х 11 4 23х 5 — -

х, хх — новые варианты аллелей, наиболее близкие к указанному цифрой, МРН — метод минимального различия нуклеотидов, ЗДЛ — метод замещения двух локусов, СТ — сиквенс-тип

Выводы

1. Acinetobacter spp. является вторым по частоте встречаемости (15%) неферментирующим грамотрицательным патогеном в отделениях с интенсивным потреблением антибиотиков в 2006-2008 гг. в России, причём, количество вызванных им инфекций в отделениях реанимации и интенсивной терапии в России за последние 12 лет увеличилось в 2,3 раза и составило 16,3%.

2. Наибольшую in vitro активность в отношении нозокомиальных штаммов Acinetobacter spp., выделенных в России, проявляют: колистин -> полимиксин Б -> имипенем -» дорипенем -> цефоперазон/сульбактам меропенем -> нетилмицин, чувствительными к которым оказались 100% -> 99,7% 97,3% -> 92,7% -> 89,7% -»• 85,5% -> 78,2% штаммов, соответственно.

3. Создание 6 новых праймеров и оптимизация состава реакционной смеси и протокола ПЦР в реальном времени позволили разработать способ выявления всех известных генов приобретённых ОХА-карбапенемаз.

4. Распространённость приобретённых ОХА-карбапенемаз среди карбаленеморезистентных штаммов Acinetobacter spp. в 2006-2008 гг. в России составила 18% (100% — ОХА-58), в 2008-2009 гг. — 100% (39,7% — ОХА-23; 46,5% -ОХА-40; 13,8% — ОХА-58). Распространённость ОХА-карбапенемаз в 2008-2009 гг. в Беларуси составила 94,6% (100% — ОХА-40). Металло-бета-лактамаз ни в одной из стран выявлено не было.

5. Для оптимизации протокола мультилокусного секвенирования-типирования штаммов A. baumannii было 14 новых праймеров, оптимизированы составы реакционных смесей и протоколы ПЦР, что позволило расширить возможности практического применения данного метода в микробиологических лабораториях.

6. Среди 14 изученных штаммов выявлено 16 новых аллельных вариантов различных генов; сами штаммы отнесены к 9 новым сиквенс-типам, 7 из которых принадлежат к известным эпидемическим клонапьным группам. При этом три из них являются возбудителями большого числа инфекций в зарубежных странах, две — в России и Беларуси.

7. В ближайшие годы в России и Беларуси следует ожидать стремительный рост резистентности к карбапенемам среди нозокомиальных штаммов Acinetobacter spp. ввиду увеличения продуцентов приобретённых ОХА-карбапенемаз и циркуляции штаммов, имеющих эпидемические свойства.

Практические рекомендации

Для микробиологов

1. Проводить скрининг всех клинических штаммов Acinetobacter spp. на метапло-бета-лактамазы и приобретённые ОХА-карбапенемазы до определения чувствительности к антибиотикам.

2. Включить разработанную технологию ПЦР в алгоритм исследований Acinetobacter spp. в микробиологических лабораториях при лечебно-профилактических учреждениях и центрах Госсанэпиднадзора.

3. Микробиологическим лабораториям при лечебно-профилактических учреждениях и центрах Госсанэпиднадзора вести учёт результатов проведённых тестов на чувствительность к антибиотикам и предоставлять врачам суммарные данные о наиболее активных за определённый период антимикробных препаратах в отношении Acinetobacter spp. в каждом конкретном стационаре.

Для клинических фармакологов

4. Рассматривать имипенем, дорипенем, меропенем и цефоперазон/сульбактам в качестве препаратов эмпирической и этиотропной терапии нозокомиальных инфекций, вызванных Acinetobacter spp., во всех стационарах России.

5. Исключить из протоколов терапии нозокомиальных инфекций, вызванных Acinetobacter spp., незащищённые пенициллины и незащищённые цефалоспори-ны (II поколения, а в ожоговых отделениях и отделениях хирургической инфекции — также гентамицин и пиперациллин/тазобактам.

6. Обратиться с ходатайством в Федеральную службу по надзору в сфере здравоохранения и социального развития о внедрении на фармацевтический рынок России парентеральных форм полимиксина Б и колистина ввиду их высокой активности в отношении полирезистентных Acinetobacter spp.

Описок научных работ по теме диссертации

1. Martinovich A. Assessment of carbapenem resistance and presence of

acquired carbapenemases in Russian nosocomial isolates of Acinetobacter spp. / A.

Martinovich, O. Shevchenko, M. Edelstein, R. Kozlov. // Proceedings of the 18m

European Congress of Clinical Microbiology and Infectious Diseases, Barcelona, Spain,

2008 (P 1505).

2. Козлов P.C. Порщняння in vitro ефективносл цефтршсону й

цефтршсону/сульбактаму щодо БЛРС-продукуючих штамш амейства

Enterobacteriaceae. / P.С. Козлов, A.A. Мартинович, А.В. Дехнич // Пед1атр1я, акушерство та пнеколопя — 2009. — Vol. 71. № 2 — С. 50 — 52

3. Martinovich A. Ten-year resistance trends of nosocomial Acinetobacter spp. in Russia / A. Martinovich, N. Ivanchik, O. Kretchikova, G. Reshedko, E. Riabkova, M. Edelstein, R. Kozlov // Proceedings of the 19lh European Congress of Clinical Microbiology and Infectious Diseases, Helsinki, Finland, 2009 (P 1717).

4. Мартинович A.A. Анализ резистентности к карбапенемам и продукции приобретённых карбапенемаз нозокомиальными штаммами Acinetobacter spp. в России I А.А. Мартинович, М.В. Эйдельштейн, О.В. Шевченко, Р.С. Козлов. //Клин, микробиол. антимикроб, химиотер. — 2009. -Т. 11. № 2-1 — С. 23 — 24.

5. Мартинович А.А. Динамика антибиотикорезистентности и эпидемиология инфекций, вызванных Acinetobacter spp. в России. / А.А. Мартинович. //Клин, микробиол. антимикроб, химиотер. — 2010. — Т. 12. № 2- С. 96-104.

СПИСОК СОКРАЩЕНИЙ

Микроорганизмы

A. baumannii A. Iwoffii

Acinetobacter baumannii Acinetobacter iwoffii Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Stenotrophomonas maltophilia

E. coli

К. pneumoniae P. aeruginosa S. maltophilia

Другие термины

ДНК

MAKMAX

ГОБ ГОНФБ ГОУ В ПО

МБЛ

МЛСТ

МО

мпк

НИИАХ

грамотрицательная бактерия грамотрицательная неферментирующая бактерия Государственное образовательное учреждение высшего профессионального образования дезоксирибонуклеиновая кислота

Межрегиональная ассоциация по клинической микробиологии и

антимикробной химиотерапии

металло-бета-лакгамаза

мультилокусное секвенирование-типирование

микроорганизм

минимальная подавляющая концентрация Научно-исследовательский институт антимикробной химиотерапии

НЧ нечувствительный микроорганизм

КМКД ОХА карбапенемазы молекулярного класса й

ОРИТ отделение реанимации и интенсивной терапии

ПЦР полимеразная цепная реакция

Р резистентный микроорганизм

СГМА Смоленская государственная медицинская академия

УР умеренно-резистентный микроорганизм

Ч чувствительный микроорганизм

АТСС Американская коллекция типовых культур

ЕССМЮ Европейский конгресс по клинической микробиологии и

инфекционным болезням

вВ база данных о геноме микроорганзимов

1СААС Междисциплинарная конференция по антимикробным

препаратам и химиотерапии

ЫСВ! Национальный центр биотехнологической информации

врр. обозначение рода микроорганизмов

Формат 60×84/16. Тираж 100. Печ. листов 1. Заказ № 2118/1. Дата сдачи в печать 24.03.2010 г.

Отпечатано в ООО «Принт-Экспресс», г. Смоленск, проспект Гагарина, 21, т.: (4812) 32-80-70

Acinetobacter — обзор | Темы ScienceDirect

Методы обнаружения

Acinetobacter легко выделяются и культивируются на обычных лабораторных средах без дополнительных добавок факторов роста. Часто используемые лабораторные среды для выращивания Acinetobacter включают органическую среду 79, минеральную среду с сырым маслом, среду пептонного дрожжевого экстракта, триптиказо-соевый агар с глицерином и среду с триптиказо-фитонами. Установленные селективные и дифференциальные среды, такие как агар Селлерса, агар Herellea и агар МакКонки, также использовались для выделения Acinetobacter (AWWA, 1999).В случае образцов питьевой воды агар с эозин-метиленовым синим может отличить Acinetobacter от других гетеротрофных организмов (AWWA, 1999).

Для улучшения извлечения видов Acinetobacter из окружающей среды образцы могут быть обогащены добавлением 20 мл ацетатно-минеральной среды с 5 мл образца воды или фильтрованной 10% почвенной суспензии с последующей интенсивной аэрацией при 30 ° C. ° C или при комнатной температуре (AWWA, 1999).

Клинические изоляты Acinetobacter растут при 37 ° C, некоторые из них могут расти при температурах до 42 ° C.Однако для роста Acinetobacter часто рекомендуется температура 30 ° C. На таких средах, как питательный агар и триптиказо-соевый агар, Acinetobacter образует гладкие, иногда слизистые колонии от бледно-желтого до серовато-белого цвета, диаметром около 1-2 мм.

Селективной средой для роста Acinetobacter является агар Herellea (Mandel et al., 1964). Эта среда содержит соли желчных кислот, сахара и бромкрезоловый пурпурный и является избирательной для выделения, культивирования и дифференциации грамотрицательных неферментативных и ферментативных бактерий.Агар Herellea особенно рекомендуется для дифференциации видов Acinetobacter от Neisseria gonorrhoeae в уретральных или вагинальных образцах. Leeds Acinetobacter Medium — это новая селективная среда, содержащая антибиотики, которая сочетает в себе селективность с дифференциальными характеристиками и была использована для улучшенного выделения видов Acinetobacter как из клинических, так и из экологических источников (Jawad et al., 1994).

Таким образом, предполагаемая идентификация Acinetobacter основана на внешнем виде колонии и биохимических характеристиках.Однако идентификация видов с помощью ручных или полуавтоматических наборов для идентификации, таких как системы API, Vitek 2 и MicroScan, является проблематичной отчасти потому, что используемые субстраты не предназначены для идентификации Acinetobacter . В самом деле, биохимические тест-наборы, как правило, неспособны различить виды ABC-комплекса, и все они обычно идентифицируются как A. baumannii .

Типирование штаммов помогает определить источники инфекционных микроорганизмов, клональность и распространение инфекции.Типичные методы, используемые для типирования Acinetobacter , включают биотипирование , фаготипирование , серотипирование и типирование бактериоцина. Поскольку эти методы требуют много времени, были предприняты значительные исследования по использованию методов молекулярного снятия отпечатков пальцев для Acinetobacter , включая анализ плазмидного профиля, анализ хромосомной ДНК путем расщепления рестрикционными эндонуклеазами и гель-электрофорез в импульсном поле, профилирование случайных амплифицированных полиморфных ДНК, риботипирование, профили белков клеточной оболочки и внешней мембраны и мультилокусное ферментное электрофоретическое типирование (Thurm and Ritter, 1993).С точки зрения эпидемиологии, все эти методы успешно использовались для расследования вспышек инфекции, связанной с Acinetobacter , хотя до сих пор ни одна система не получила всеобщего признания для типирования Acinetobacter видов.

Тяжелая внебольничная инфекция кровотока Acinetobacter ursingii у человека, употребляющего инъекционные наркотики — Том 22, номер 1 — январь 2016 г. — Журнал Emerging Infectious Diseases

Принадлежность автора: Университетский медицинский центр Гамбург-Эппендорф, Гамбург, Германия (H.J.F. Salzer, T. Rolling, S. Schmiedel, E.-M. Клупп); Исследовательский центр Борстель, Зюльфельд, Германия (H.J.F. Salzer, C. Lange); Каролинский институт, Стокгольм, Швеция (К. Ланге); Школа медицины Университета Намибии, Виндхук, Намибия (К. Ланге); Немецкий центр инфекционных исследований, Брауншвейг, Германия (К. Ланге, Х. Зайферт); Кельнский университет, Кельн, Германия (Х. Зайферт)

Actinetobacter spp. представляют собой разнообразную группу грамотрицательных аэробных коккобацилл.В настоящее время> 50 Acinetobacter spp. признаны; большинство из них не патогенны для человека. Большинство инфекций человека носят внутрибольничный характер и преимущественно вызываются A. baumannii и другими членами группы A. baumannii , включая A. nosocomialis , A. pittii и A. seifertii ( 1 ). . Появляются новые виды, такие как A. ursingii и A. schindleri , которые могут вызывать тяжелые оппортунистические инфекции ( 2 8 ).Приобретенный сообществом Acinetobacter spp. инфекции зарегистрированы в основном из тропических регионов. Большинство инфицированных пациентов имеют внебольничную пневмонию, вызванную A. baumannii ( 1 ). Мы сообщаем о случае внебольничной инфекции кровотока, вызванной A . ursingii у ВИЧ-отрицательной женщины, употребляющей инъекционные наркотики.

В марте 2014 года 47-летняя женщина была госпитализирована в клинику Бернхарда Нохта (Гамбург, Германия) с ознобом, тошнотой и лихорадкой (температура <40 ° C).Пациент в анамнезе употреблял наркотики (кокаин и бензодиазепины) внутривенно и в настоящее время участвует в программе заместительной терапии метадоном. У нее также была хроническая вирусная инфекция гепатита С, которую успешно лечили пегилированным интерфероном-α, рибавирином и боцепревиром. У пациента был устойчивый вирусологический ответ и отрицательные результаты на РНК вируса гепатита С при последующем наблюдении без прогрессирования до фиброза или цирроза печени.

При поступлении лейкоциты периферической крови 6.6 × 10 3 клеток / мкл, и ее уровень С-реактивного белка был увеличен (29 мг / л [контрольное значение <5 мг / л]). Другие стандартные химические анализы сыворотки и мочи были без особенностей. ВИЧ-1/2 инфекции не обнаружено. Рентгенограмма грудной клетки без отклонений от нормы. Абсцесса мягких тканей не наблюдалось, но пациентка призналась, что за день до госпитализации вводила кокаин и неизвестные измельченные таблетки внутривенно. Токсикологический скрининг показал сильно повышенные уровни бензодиазепина (> 5000 нг / мл) и кокаина (> 1000 нг / мл) (контрольные значения <20 нг / мл для обоих веществ).Перед проведением эмпирической антимикробной терапии цефтриаксоном внутривенно (2 г 1 раз в день) на 1-й день были собраны три культуры крови.

На следующий день состояние больного ухудшилось. Количество лейкоцитов увеличилось до 27,6 × 10 90 · 10 5 3 90 · 106 клеток / мкл, а уровень С-реактивного белка увеличился до 112 мг / л. У нее была сильная лихорадка, артериальная гипотензия и тахикардия, совместимые с тяжелым сепсисом. Пациент быстро отреагировал на замещение жидкости, стал гемодинамически стабильным и не нуждался в вазопрессорах.Противомикробную терапию эмпирически заменили меропенемом (1000 мг 3 раза в день) на 2-й день.

После 18 ч инкубации культур рост микробов был обнаружен в 3 бутылях для аэробных культур крови, инокулированных при поступлении. Окрашивание по Граму показало грамотрицательные палочки, а лазерная десорбционная ионизация / времяпролетная масс-спектрометрия с использованием матрицы и снятие отпечатков пальцев с прямым осаждением образца без экстракции (Bruker Daltonim GmbH, Бремен, Германия) идентифицировали A . ursingii (2 балла.19). BLAST-поиск (http://www.ncbi.nlm.nih.gov/BLAST) частичной последовательности гена 16S рРНК был выполнен с использованием таксономического браузера (http://www.ncbi.nlm.nih.gov) и показал 99% идентичности со штаммом типа A. ursingii NBRC110605 (номер доступа в GenBank LC014147.1).

Тестирование чувствительности к противомикробным препаратам проводилось с использованием Vitek 2 (bioMérieux, Нюртинген, Германия). Результаты показали чувствительность к имипенему (МИК <0,25 мг / мл), меропенему (<0,25 мг / мл), гентамицину (<1 мг / мл) и ципрофлоксацину (<0.25 мг / мл) и устойчивость к цефтриаксону (32 мг / мл).

На следующий день у пациентки повысилась температура, улучшились клинические симптомы, а лабораторные показатели воспаления вернулись к контрольным значениям. Последующие посевы оставались отрицательными. Чреспищеводная эхокардиограмма без особенностей, без каких-либо признаков инфекционного эндокардита. Терапия противомикробными препаратами была продолжена в течение 10 дней до выписки. При контрольном осмотре через 2 месяца у пациента не было никаких симптомов, и он посещал групповые консультации, чтобы сохранить воздержание от наркотиков.

После первого описания A. ursingii как нового вида ( 2 ), для которого 13 из 29 изолятов A. ursingii были получены от пациентов с внутрибольничными инфекциями кровотока, несколько случаев — A. ursingii кровотока. сообщений об инфекциях (таблица). Нам не удалось идентифицировать случаи внебольничной инфекции кровотока A. ursingii в литературе. Loubinoux et al. сообщили о случае инфекции кровотока A. ursingii у пациента с тяжелым иммунодефицитом и аденокарциномой легких, получавшего химиотерапию и кортикостероиды ( 3 ).В этом исследовании A. ursingii было связано с имплантированным портом и считалось имеющим низкий патогенный потенциал.

Однако в последние несколько лет были сообщения о серьезных инфекциях кровотока, вызванных A. ursingii , у пациентов с ослабленным иммунитетом и иммунокомпетентных пациентов. Horii et al. сообщили о нозокомиальных A. ursingii инфекциях кровотока у 2 беременных женщин, у которых не было сопутствующих заболеваний ( 4 ), но путь передачи не был выяснен.Авторы предположили, что инфекции могли быть переданы через внутривенные катетеры из душевой кабины, где было обнаружено A. ursingii и 2 различных штамма A. junii . A. ursingii также был связан с внутрибольничными инфекциями кровотока среди новорожденных, о чем свидетельствуют 2 вспышки в отделениях интенсивной терапии новорожденных с высоким уровнем смертности. В обеих вспышках источник инфекции установить не удалось. Во вспышках, о которых сообщали Kilic et al.( 5 ) и Máder et al. ( 6 ) предполагались катетерные инфекции. Kilic et al. ( 5 ) идентифицировали организмы как A. septicus sp. nov., которые позже были показаны Nemec et al. ( 7 ) быть идентичным A. ursingii . Dortet et al. ( 8 ) сообщили о 10 инфекциях A. ursingii , включая 3 случая внутрибольничных инфекций кровотока, но не предоставили клинических данных.

Хотя тяжелые инфекции A.ursingii встречаются редко, идентификация A. ursingii молекулярными методами, такими как секвенирование гена 16S рРНК, кластерный анализ последовательности гена rpoB и фингерпринтинг полиморфизма длины амплифицированного фрагмента, указывает на относительно высокую распространенность A. ursingii ( диапазон 2,6–4,5%) среди клинических Acinetobacter spp. изоляты ( 10 13 ). В исследовании, проведенном в Соединенном Королевстве, A. ursingii было идентифицировано у 28 (4%) из 690 клинических Acinetobacter spp.изоляты, собранные за 20-месячный период в 2008–2009 гг .; в общей сложности 17 (71%) из 24 изолятов A. ursingii были выделены из посевов крови, но клинические детали не сообщались ( 12 ). Karah et al. ( 13 ) сообщили о 113 случаях заболевания Acinetobacter spp. инфекции кровотока в Норвегии; 3 (2,6%) были с A. ursingii , но клинические данные этих пациентов не были предоставлены. Этот относительно высокий уровень заболеваемости согласуется с результатами из Нидерландов ( 10 ) и Северной Ирландии ( 11 ).

В большинстве отчетов изолятов A. ursingii были более чувствительны к противомикробным препаратам, чем изолятов A. baumannii ( 4 , 6 , 8 , 12 , 13 ). Однако Endo et al. ( 9 ) сообщил о продуцирующем IMP-1, устойчивом к карбапенемам изоляте A. ursingii от пациента из Японии с внутрибольничной инфекцией кровотока.

Изоляты A. ursingii обычно устойчивы к цефалоспоринам ( 3 , 5 , 8 ), как и изолят от пациентки, о которой мы сообщаем, что объясняет прогрессирование тяжелого сепсиса, когда ей эмпирически давали цефтриаксон. быстрое клиническое улучшение после приема меропенема.Máder et al. ( 6 ) сообщили о недоношенном ребенке с инфекцией кровотока A. ursingii , также получавшей цефалоспорин (цефтазидим). Однако младенец получал комбинацию амикацина и иммуноглобулинов в течение 3 недель. Младенец выжил и был выписан.

Эти данные позволяют предположить, что A. ursingii является новым и серьезным клиническим патогеном, который часто участвует в внутрибольничных инфекциях кровотока и связан с использованием внутрисосудистых катетеров.Его естественная среда обитания остается неясной, но до сих пор она была изолирована только из клинических источников. Частота и клиническая роль A. ursingii могла быть недооценена, поскольку идентификация видов с помощью фенотипических и полуавтоматических методов идентификации ненадежна. Например, Vitek 2 ошибочно идентифицировал A. ursingii как Bordetella bronchiseptica ( 6 , 8 ). Самая последняя версия программного обеспечения для Vitek 2 позволяла однозначно идентифицировать A.ursingii (Х. Зайферт, личное сообщение).

Мы сообщаем о случае внебольничной инфекции кровотока и тяжелого сепсиса, вызванного A. ursingii , который, вероятно, был связан с внутривенным введением наркотиков у иммунокомпетентного пациента. В этом отчете также подчеркивается полезность времяпролетной масс-спектрометрии с лазерной десорбцией / ионизацией на основе матрицы для идентификации Acinetobacter spp. Мы считаем, что эта технология может улучшить правильную видовую идентификацию Acinetobacter spp., включая A. ursingii , в повседневной клинической практике и помогает выяснить распространенность и клиническую роль этого появляющегося патогена.

Д-р Зальцер — научный сотрудник отделения клинических инфекционных болезней исследовательского центра Борстель, Зюфельд, Германия. Его основные исследовательские интересы включают инвазивные и хронические грибковые инфекции.

Вершина

Выводы, выводы и мнения, высказанные авторами, пишущими для этого журнала, не обязательно отражают официальную позицию U.S. Министерство здравоохранения и социальных служб, Служба общественного здравоохранения, Центры по контролю и профилактике заболеваний или аффилированные с авторами учреждения. Торговые наименования используются только для идентификации и не подразумевают одобрения какой-либо из вышеперечисленных групп.

Границы | Резервуары видов Acinetobacter, отличных от baumannii,

Введение

Внедрение молекулярных методов в исследовательских лабораториях значительно улучшило идентификацию видов Acinetobacter .Среди этих методов секвенирование генов 16S-рРНК, субъединицы B РНК-полимеразы ( rpoB ) и субъединицы B ДНК-гиразы ( gyrB ), а также гибридизация ДНК-ДНК и полногеномное секвенирование обеспечивают хорошие информативные данные для Acinetobacter таксономические исследования (Rafei et al., 2014; Jung, Park, 2015). На основе этих методов были зарегистрированы новые виды, и в настоящее время род включает 51 вид с действительными опубликованными названиями (http://apps.szu.cz/anemec/Classification.pdf (по состоянию на октябрь 2015 г.)).

Виды Acinetobacter широко распространены в природе и могут быть обнаружены в различных источниках окружающей среды, таких как загрязненные углеводородами территории, активный ил, сточные воды, свалки, а также на овощах, животных и людях (Doughari et al., 2011). Способность доминировать во многих экологических нишах побудила некоторых авторов рассматривать эти бактерии как микробные сорняки (Cray et al., 2013).

Среди различных видов лидирует Acinetobacter baumannii .В последние десятилетия он стал клинически значимым патогеном, вызывающим широкий спектр внутрибольничных инфекций, внебольничных инфекций или инфекций, связанных с войнами и стихийными бедствиями (Peleg et al., 2008). Тем не менее, все чаще сообщается о роли Acinetobacter , отличной от baumannii, в человеческих инфекциях благодаря технологическим достижениям, таким как молекулярная биология, которые позволяют правильно идентифицировать бактерии на уровне видов. Так, например, во всем мире зарегистрировано несколько случаев, касающихся штаммов Acinetobacter pittii и Acinetobacter nosocomialis с множественной лекарственной устойчивостью, которые вызывали инфекции в медицинских учреждениях (Karah et al., 2011; Kouyama et al., 2012; Ян и др., 2012; Schleicher et al., 2013; Фитцпатрик и др., 2015). Acinetobacter calcoaceticus , который в основном является экологическим видом, был описан в нескольких случаях пневмонии и бактериемии (Mostachio et al., 2012; Li et al., 2015a), а также внутрибольничных инфекций, вызванных такими видами, как Acinetobacter lwoffii, Acinetobacter junii , или Acinetobacter johnsonii (Lee et al., 2007; Karah et al., 2011).

В связи с его важной ролью в инфекциях человека, A.baumannii — наиболее изученная бактерия из рода Acinetobacter . Напротив, о других видах Acinetobacter известно немного. Целью настоящего обзора является обобщение последних данных по не baumannii Acinetobacter с акцентом на естественный резервуар, включая новые виды, которые были впервые описаны из источников окружающей среды и зарегистрированы в последние годы с помощью молекулярных методов. (Таблица 1).

Таблица 1.Естественная среда обитания не baumannii Acinetobacter видов .

Естественная среда обитания не-

Baumannii Acinetobacter

Окружающая среда

Acinetobacter spp. давно описаны из различных источников окружающей среды. В 1994 году Wiedman et al. впервые охарактеризованы A. lwoffii, A. junii и A. johnsonii на очистных сооружениях в Германии (Wiedmann-al-Ahmad et al., 1994).Позже Houang et al. исследовали образцы почвы из различных районов Гонконга и показали, что примерно 37% были положительными на Acinetobacter spp. и что среди этих бактерий 27% составляли A. pittii (Houang et al., 2001). Различные авторы описали также новые виды Acinetobacter , выделенные из активного ила, очистных сооружений и неочищенных сточных вод в Австралии, Португалии, Корее и Пакистане. Этими видами были Acinetobacter baylyi, Acinetobacter bouvetii, Acinetobacter grimontii, Acinetobacter tjernbergiae, Acinetobacter towneri, Acinetobacter tandoii, Acinetobacter gerneri, Acinetobacter kyonggiensis, Acinetobacter gerneri, Acinetobacter kyonggiensis, Acinetobacter., 2003; Ли и Ли, 2010; Ваз-Морейра и др., 2011; Аббас и др., 2014).

В ходе различных исследований, проведенных в Корее, авторы выделили новых видов Acinetobacter , включая Acinetobacter marinus и Acinetobacter seohaensis из морской воды (Yoon et al., 2007), Acinetobacter soli из лесной почвы (Kim et al., 2008). ), а также Acinetobacter brisouii из водно-болотных угодий (Anandham et al., 2010). В другом исследовании, проведенном на образцах почвы и искусственной окружающей среды в Корее, Choi et al.идентифицировано геномных видов A. calcoaceticus, A. nosocomialis, A. pittii, Acinetobacter , близких к 13TU, Acinetobacter parvus, Acinetobacter radioresistens, A. soli, A. tandoii, Acinetobacter bereziniae, Acinetobacter genomic , Acinetobacter schindleri 15TU, демонстрируя огромное разнообразие видов Acinetobacter (Choi et al., 2012). Ситуация в других странах была несколько иной. В Ливане Rafei et al. провели исследования на нескольких образцах окружающей среды, чтобы выяснить наличие Acinetobacter spp.Они показали распространенность 18% и обнаружили, что не относящиеся к baumannii Acinetobacter , включая A. pittii и A. calcoaceticus , были наиболее часто изолированными видами (Rafei et al., 2015). Эти результаты могут подчеркивать потенциальную роль климатических факторов, которые могут повлиять на распространенность Acinetobacter spp. в окружающей среде.

В Индии Acinetobacter indicus был впервые описан в образцах почвы, собранных со свалок гексахлорциклогексана (Malhotra et al., 2012). Acinetobacter kookii — новый вид, выделенный из свекольных полей в Германии, из почвы в Нидерландах и в Корее, а также из донных отложений рыбных хозяйств в Малайзии и Таиланде (Choi et al., 2013). Acinetobacter venetianus — новый вид, выделенный из морской воды в Израиле, нефти в Италии, прудов аквакультуры в Дании и из моря в Японии (Vaneechoutte et al., 2009). Наконец, Acinetobacter bohemicus и Acinetobacter albensis были двумя новыми видами, впервые описанными в Чешской Республике и извлеченными из природных экосистем, таких как почва, грязь и вода (Krizova et al., 2014, 2015а).

Примечательно, что разработка новых методов высокопроизводительного секвенирования позволила проводить метагеномические исследования, которые могут улучшить наше понимание бактериальной микробиоты, выжившей в различных местах окружающей среды. Например, Acinetobacter spp. были обнаружены в образцах почвы, загрязненных нефтяными углеводородами (Sarma et al., 2004; Bordenave et al., 2007; Obuekwe et al., 2009), а также в пробах донных отложений и воды в азиатских странах, собранных либо из рыбоводных прудов, загрязненных органическими отходами, либо из рыбных и креветочных хозяйств (Huys et al., 2007; Xiong et al., 2015). Однако, даже если метагеномика может предоставить информацию о бактериальном разнообразии, в этих исследованиях изоляты не были охарактеризованы на уровне видов.

В последние годы в Корее и Китае было описано несколько новых видов Acinetobacter . Acinetobacter antiviralis и Acinetobacter oleivorans были двумя новыми видами, выделенными из корней растений табака и рисовых полей в Корее (Lee et al., 2009; Kang et al., 2011).В Китае Acinetobacter Холодильников, Acinetobacter puyangensis, Acinetobacter qingfengensis, Acinetobacter populi, Acinetobacter guangdongensis и Acinetobacter harbinensis были шестью новыми видами, которые были изолированы из холодильника, популярной цинковой воды или заброшенных свинцовых рудников. реки соответственно (Li et al., 2013, 2014a, b, 2015b; Feng et al., 2014a, b).

Дальнейшие исследования микробиома были проведены для изучения бактериальной популяции в цветочном нектаре некоторых растений.Интересно, что было показано, что Acinetobacter был основным из основанных бактериальных таксонов (Фридман и др., 2012; Álvarez-Pérez and Herrera, 2013). Кроме того, Acinetobacter boissieri и Acinetobacter nectaris были двумя новыми видами, которые были выделены из образцов нектара растений в Испании (Álvarez-Pérez et al., 2013).

Недавно было показано, что окружающая среда может представлять собой потенциальный резервуар для Acinetobacter spp. устойчивые изоляты.Действительно, штаммы, продуцирующие карбапенемазу и бета-лактамазу с расширенным спектром действия, были выделены из больничных сточных вод, образцов почвы вокруг животноводческих ферм, а также из загрязненных рек (Zong and Zhang, 2013; Maravić et al., 2015; Wang and Sun, 2015; Таблица 1), подчеркивая потенциальную роль этих бактерий в распространении генов устойчивости к антибиотикам в окружающей среде.

Еда

Наличие Acinetobacter spp. в пищевой цепи также была изучена.С 1999 г. Берлау и др. изолировали A. guillouiae, A. calcoaceticus, A. pittii, A. lwoffii и A. bereziniae на овощах, купленных на рынках в Соединенном Королевстве или собранных в садах летом (Berlau et al., 1999a). В последующем исследовании овощей, проведенном в Гонконге, были обнаружены геномных видов A. pittii и Acinetobacter 10 и 16 (Houang et al., 2001). Различные виды Acinetobacter также были выделены из образцов рыбы, мяса, сыра и молока.В Ливане Rafei et al. сообщили о выделении не- baumannii Acinetobacter , включая A. pittii, A. calcoaceticus, A. bereziniae и A. soli , из сырого коровьего мяса, сырого сыра, сырого коровьего молока и образцов овощей (Rafei et al. , 2015), а совсем недавно они выделили устойчивый к карбепенему A. calcoaceticus из овощей (Al Atrouni et al., 2016). Acinetobacter spp. сообщалось в предыдущих исследованиях образцов молока, собранных из молочных стад в Соединенных Штатах (Jayarao and Wang, 1999) и Кении (Ndegwa et al., 2001). Уровень изоляции составил 1,3 и 5% соответственно. Acinetobacter spp. сообщалось также о пробах маститного молока и сырого молока из резервуаров в Корее (Nam et al., 2009; Gurung et al., 2013).

Животные

Хотя в нескольких опубликованных исследованиях сообщалось об изоляции A. baumannii от таких животных, как утки, голуби, курицы, ослы, кролики, домашние животные (кошки, собаки), мулы, домашний скот (козы, свиньи, крупный рогатый скот, коровы), лошади, вши и членистоногие (Gouveia et al., 2008; Хамуда и др., 2008, 2011; Bouvresse et al., 2011; Эндимиани и др., 2011; Кемпф и др., 2012а, б; Бельмонте и др., 2014; Rafei et al., 2015), в нескольких исследованиях сообщалось о выделении не- baumannii Acinetobacter от животных. Acinetobacter геномных видов 15 TU было выделено Poirel et al. из ректальных проб коров на молочной ферме во Франции (Poirel et al., 2012). Совсем недавно Rafei et al. сообщили о выделении A. pittii, A. calcoaceticus, A. bereziniae, A.johnsonii, A. lwoffii, A. schindleri, A. radioresistens, A. beijerinckii, A. junii, A. gerneri и Acinetobacter геномные виды 15 TU из образцов животных в Ливане. Штаммы были выделены в основном из поголовья, лошадей и домашних животных (Rafei et al., 2015). Smet et al. впервые описан Acinetobacter gandensis от лошади и крупного рогатого скота (Smet et al., 2014). La Scola et al. сообщили об обнаружении A. anitratus в образцах вшей, собранных в приютах для бездомных во Франции (La Scola et al., 2001), а недавно A. radioresistens и A. schindleri были обнаружены у головных вшей, собранных у учеников начальной школы в Таиланде (Sunantaraporn et al., 2015). Acinetobacter spp. были также обнаружены у водных животных (Huys et al., 2007; Geiger et al., 2009), а также в кишечнике некоторых членистоногих, таких как муха цеце, в Анголе, Африка (Guardabassi et al., 1999). Кроме того, Acinetobacter apis был новым видом, выделенным из кишечника медоносной пчелы в Корее (Kim et al., 2014).

Кроме того, были проведены другие исследования кишечной экосистемы рыб с использованием метагеномных подходов. В результате, Acinetobacter был, несомненно, одним из наиболее часто обнаруженных родов. Действительно, способность продуцировать антибактериальные соединения против нескольких других видов, а также факторы окружающей среды и условия питания могут влиять на бактериальное сообщество в кишечнике рыб и объяснять доминирование этой группы (Hovda et al., 2007; Etyemez and Balcázar, 2015) .

Наконец, недавно Sun et al. сообщили о выделении NDM-1, продуцирующего A. lwoffii , из ректального образца кошки в Китае (Sun et al., 2015), предполагая, что эти животные-компаньоны могут играть решающую роль в распространении бактерий с множественной лекарственной устойчивостью.

Человеческая коляска

Acinetobacter spp. может быть частью флоры человека. В большой университетской больнице в Кельне, Германия, Seifert et al. провели эпидемиологическое исследование для изучения колонизации Acinetobacter spp.кожи и слизистых оболочек госпитализированных пациентов и здоровых людей. Они показали, что уровень колонизации был выше у пациентов, чем в контрольной группе (75 против 42,5%) (Seifert et al., 1997). Руки, пах, перепонки на пальцах ног, лоб и уши были наиболее часто заселяемыми участками тела. Почти все изолированные виды не относились к baumannii Acinetobacter , включая A. lwoffii (47%), A. johnsonii (21%), A. radioresistens (12%), A.pittii (11%) и A. junii (5%). Напротив, A. baumannii и A. bereziniae выявлялись редко, и авторы не обнаружили A. calcoaceticus или A. haemolyticus на коже или слизистых оболочках (Seifert et al., 1997).

Berlau et al. провели аналогичное исследование для изучения присутствия Acinetobacter spp. на коже (предплечье, лоб, перепонка пальцев ног) 192 здоровых добровольцев в Соединенном Королевстве.Как и в предыдущем исследовании, они обнаружили, что уровень колонизации составляет около 40%, причем наиболее часто выделяемым видом является A. lwoffii , а наиболее часто колонизируется предплечье. Однако распределение других видов было другим: Acinetobacter геномных видов 15BJ (12%), A. radioresistens (8%), и только одна особь несла комплекс Acinetobacter baumannii-calcoaceticus (Berlau et al., 1999b). В другом исследовании, проведенном в Гонконге, Chu et al.показали, что процент носительства через кожу у студентов-медсестер и новых медсестер из сообщества составлял 32 и 66% соответственно, причем A. pittii были наиболее распространенными видами (Chu et al., 1999). Авторы также сообщили о потенциальной сезонной изменчивости колонизации кожи (Chu et al., 1999). Патил и др. изучили носительство кожи на шести участках тела (переднекубитальная ямка, подмышечная впадина, лоб с линией роста волос, шея, внешняя поверхность носа и перепонки пальцев ног) у добровольцев из Индии. Было обнаружено, что не относящиеся к baumannii Acinetobacter были наиболее часто изолированными видами, включая A.lwoffii, A. junii, A. haemolyticus, A. calcoaceticus и A. pittii . В этом исследовании антекубитальная ямка имела самую высокую частоту колонизации (48,5%), и мужчины-добровольцы были более колонизированы, чем женщины (Patil and Chopade, 2001).

Аналогично, Acinetobacter spp. были также изолированы из образцов фекалий. Исследование, проведенное Dijkshoorn et al. в Соединенном Королевстве и Нидерландах для исследования кишечного носительства Acinetobacter spp.показали, что из 226 проб фекалий, собранных случайным образом в сообществе, 38 оказались положительными. Обычно выделялись следующие виды: A. johnsoni i, A. guillouiae и A. junii (Dijkshoorn et al., 2005).

Геномные подходы также использовались для изучения бактериального сообщества некоторых образцов человека. Так, Захаркина и др. сообщили о Acinetobacter spp. из микробиоты дыхательных путей здоровых людей (Захаркина и др., 2013), а Urbaniak et al.сообщили об обнаружении этих микроорганизмов в образцах грудного молока (Urbaniak et al., 2014). Недавно в другой работе, проведенной для изучения микробного разнообразия кишечной микробиоты здоровых добровольцев, Li et al. показали, что Acinetobacter присутствует в основном в двенадцатиперстной кишке (Li et al., 2015c). Согласно этим результатам, мы можем увидеть способность Acinetobacter выживать в образцах комменсалов, что позволяет предположить, что человек может представлять собой потенциальный резервуар для этой условно-патогенной бактерии.Однако происхождение и факторы, которые могут повлиять на эту колонизацию, остались неясными.

Глобальные примечания

Ссылаясь на эти результаты, мы показали, что окружающая среда является основным резервуаром Acinetobacter spp. и, что интересно, бактерии были в основном изолированы от мест, контактирующих с людьми, животными или с территорий, загрязненных углеводородами. Поэтому было высказано предположение, что Acinetobacter spp. принадлежат к небольшому меньшинству видов, способных доминировать в открытой среде обитания (Cray et al., 2013). Действительно, микроорганизмы подвергаются воздействию в окружающей среде множества факторов, которые влияют на их рост и действуют как параметры стресса, такие как условия высыхания, температура, влажность воздуха и другие параметры, которые подвержены динамическим изменениям. В отличие от некоторых других грамотрицательных бактерий, Acinetobacter spp. способны выживать в засушливой среде в течение длительных периодов времени и поддерживать условия высыхания (Wendt et al., 1997; Wagenvoort and Joosten, 2002). Эта толерантность может быть обусловлена ​​различными механизмами, такими как сверхэкспрессия белков, участвующих в устойчивости к противомикробным препаратам, оттоком насосов, понижающая регуляция белков, участвующих в клеточном цикле, транскрипции и трансляции с целью перехода в состояние покоя (Gayoso et al., 2014). Кроме того, углеводороды и полисахариды представляют собой макромолекулы, доступные в окружающей среде, и могут составлять первичный субстрат для этих микроорганизмов. Acinetobacter видов могут катаболизировать полисахариды посредством продукции ксиланазы, которая является ключевым ферментом для разложения сложных внеклеточных веществ, таких как гемицеллюлозы. Также было показано, что загрязнение окружающей среды мазутом или металлами может повлиять на микробное разнообразие и только на некоторые виды бактерий, такие как Acinetobacter spp.смогли противостоять таким загрязненным территориям и доминировать над ними (Bordenave et al., 2007; Zhao et al., 2014). Более того, эти бактерии способны разлагать различные загрязнители и органические соединения и играют важную роль в биоремедиации окружающей среды (Adegoke et al., 2012; Cray et al., 2013). Наконец, Acinetobacter spp. разработали стратегии подавления роста конкурирующих видов либо путем подкисления окружающей среды (секреция органических кислот), либо путем производства ингибирующих биосурфактантов (Cray et al., 2013).

В этом обзоре мы также показали, что использование методов на основе ДНК способствует прогрессу в области разнообразия рода Acinetobacter . В результате было доступно большое количество хорошо охарактеризованных видов, и Acinetobacter остается интересной моделью для систематиков для изучения природного разнообразия, а также истории эволюции этой бактерии. Фактически, недавние исследования показали, что климатические изменения и загрязнение могут изменить распределение видов в окружающей среде (Coelho et al., 2013). Другие теории считают, что эволюция видов может быть прямым ответом на климатические изменения (Hoffmann and Sgrò, 2011). Эти результаты вызывают много вопросов, было ли описание нового вида Acinetobacter результатом этих экологических изменений. С другой стороны, есть важный вопрос, на который остается неясно ответ: могут ли эти недавно описанные виды Acinetobacter играть потенциальную роль в заражении человека? Фактически, несколько исследований показали, что необычные и недавно описанные виды Acinetobacter, , такие как A.septicus и A. bereziniae были вовлечены в инфицирование человека, и некоторые из них были устойчивы к карбапенемам (Kilic et al., 2008; Kuo et al., 2010; Sung et al., 2014). Более того, в других исследованиях, проведенных во Франции, Хорватии, Японии и Китае, сообщалось об обнаружении штаммов с множественной лекарственной устойчивостью A. schindleri, A. guillouiae, A. soli, A. ursingii и A. beijerinckii , выделенных из клинических образцов (Dortet et al., 2006; Bošnjak et al., 2014; Endo et al., 2014; Fu et al., 2015; Quiñones et al., 2015). Основываясь на этих результатах, можно предположить, что другие виды Acinetobacter будут вскоре обнаружены при инфекциях человека благодаря более эффективным молекулярным методам, используемым для идентификации бактерий.

В заключение, даже если настоящие данные получены только из нескольких исследований, кажется, что почти все виды Acinetobacter широко распространены в природе и что загрязненная среда может способствовать росту этих микроорганизмов.Тем не менее необходимы дальнейшие исследования, чтобы понять поведение Acinetobacter spp. и выяснить способ передачи этих бактерий из этих различных мест обитания человеку.

Авторские взносы

AA, MJ, MH и MK внесли свой вклад в концепцию и дизайн работы, а также в сбор и интерпретацию данных. Все авторы внесли свой вклад в составление рукописи и утвердили окончательную версию для публикации.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Эта работа финансировалась Ливанским университетом и Национальным советом по научным исследованиям Ливана.

Список литературы

Аббас, С., Ахмед, И., Кудо, Т., Иида, Т., Али, Г. М., Фудзивара, Т. и др. (2014). Устойчивые к тяжелым металлам и психротолерантные бактерии Acinetobacter pakistanensis sp. ноя изолирован от пруда очистки сточных вод крашения текстиля. Пак. J. Agric. Sci. 51, 593–606.

Google Scholar

Адегоке, А.A., Mvuyo, T., and Okoh, A. I. (2012). Вездесущие виды Acinetobacter в качестве полезных комменсалов, но постепенно становятся более смелыми благодаря генам устойчивости к антибиотикам. J. Basic Microbiol. 52, 620–627. DOI: 10.1002 / jobm.201100323

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Аль-Атруни, А., Кемпф, М., Эвейяр, М., Рафей, Р., Хамзе, М., и Жоли-Гийу, М.-Л. (2016). Первое сообщение о том, что Oxa-72 производит Acinetobacter calcoaceticus в Ливане. Новые микробы. Новый Инфект . 9, 11–12. DOI: 10.1016 / j.nmni.2015.11.010

CrossRef Полный текст | Google Scholar

Альварес-Перес, С., и Эррера, К. М. (2013). Состав, богатство и неслучайная сборка культивируемых бактериально-микрофунгальных сообществ в цветочном нектаре средиземноморских растений. FEMS Microbiol. Ecol. 83, 685–699. DOI: 10.1111 / 1574-6941.12027

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Альварес-Перес, С., Ливенс, Б., Жакемин, Х., и Эррера, К. М. (2013). Acinetobacter nectaris sp. ноя и Acinetobacter boissieri sp. nov., выделенный из цветочного нектара дикорастущих средиземноморских растений, опыляемых насекомыми. Внутр. J. Syst. Evol. Microbiol. 63, 1532–1539. DOI: 10.1099 / ijs.0.043489-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Anandham, R., Weon, H.-Y., Kim, S.-J., Kim, Y.-S., Kim, B.-Y., and Kwon, S.-W. (2010). Acinetobacter brisouii sp.nov., изолированное от водно-болотных угодий в Корее. J. Microbiol. Сеул Корея 48, 36–39. DOI: 10.1007 / s12275-009-0132-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бельмонте, О., Пайлориес, Х., Кемпф, М., Готье, М. П., Лемари С., Рамон, К. и др. (2014). По данным многоцентрового исследования, проведенного в ветеринарных клиниках на острове Реюньон, высокая распространенность близкородственной Acinetobacter baumannii у домашних животных. Вет. Microbiol. 170, 446–450. DOI: 10.1016 / j.vetmic.2014.01.042

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Берлау Дж., Окен Х., Малник Х. и Питт Т. (1999b). Распространение видов Acinetobacter на коже здоровых людей. Eur. J. Clin. Microbiol. Заразить. Дис. 18, 179–183. DOI: 10.1007 / s100960050254

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Берлау Дж., Окен Х. М., Хоуанг Э. и Питт Т. Л. (1999a). Выделение Acinetobacter spp.в том числе A. baumannii из овощей: последствия для внутрибольничных инфекций. J. Hosp. Заразить. 42, 201–204. DOI: 10.1053 / jhin.1999.0602

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Борденаве, С., Гони-Урриса, М.С., Кауметт, П., и Дюран, Р. (2007). Влияние мазута на структуру бактериального сообщества нетронутого микробного мата. Заявл. Environ. Microbiol. 73, 6089–6097. DOI: 10.1128 / AEM.01352-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bošnjak, Z., Плеко В., Будимир А. и Марекович И., Беденич Б. (2014). Первый отчет N. D.M-1-Proroduction Acinetobacter guillouiae . Химиотерапия 60, 250–252. DOI: 10.1159 / 000381256

CrossRef Полный текст | Google Scholar

Бувресс, С., Соколовши, К., Берджане, З., Дюран, Р., Изри, А., Рауль, Д., и др. (2011). Нет свидетельств Bartonella quintana, но обнаружено Acinetobacter baumannii в головных вшах у школьников начальной школы в Париже. Сост. Иммунол. Microbiol. Заразить. Дис. 34, 475–477. DOI: 10.1016 / j.cimid.2011.08.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Карр, Э. Л., Кемпфер, П., Патель, Б. К. К., Гюртлер, В., и Севиур, Р. Дж. (2003). Семь новых видов Acinetobacter , выделенных из активного ила. Внутр. J. Syst. Evol. Microbiol. 53, 953–963. DOI: 10.1099 / ijs.0.02486-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Цой, Дж.-Y., Kim, Y., Ko, E.A., Park, Y.K., Jheong, W.-H., Ko, G., et al. (2012). Acinetobacter видов изолятов из различных сред: обзор видов и наблюдения за устойчивостью к противомикробным препаратам. Диагн. Microbiol. Заразить. Дис. 74, 177–180. DOI: 10.1016 / j.diagmicrobio.2012.06.023

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Choi, J. Y., Ko, G., Jheong, W., Huys, G., Seifert, H., Dijkshoorn, L., et al. (2013). Acinetobacter kookii sp.nov., изолированное от почвы. Внутр. J. Syst. Evol. Microbiol. 63, 4402–4406. DOI: 10.1099 / ijs.0.047969-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Chu, Y. W., Leung, C. M., Houang, E. T., Ng, K. C., Leung, C. B., Leung, H. Y., et al. (1999). Кожное носительство Acinetobacters в Гонконге. J. Clin. Microbiol. 37, 2962–2967.

PubMed Аннотация | Google Scholar

Коэльо, Ф. Дж. Р. К., Сантос, А. Л., Коимбра, Дж., Алмейда А., Кунья В., Клири Д. Ф. Р. и др. (2013). Интерактивное воздействие глобального изменения климата и загрязнения на морские микробы: путь вперед. Ecol. Evol. 3, 1808–1818. DOI: 10.1002 / ece3.565

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Крей, Дж. А., Белл, А. Н. У., Бхаганна, П., Мсвака, А. Ю., Тимсон, Д. Дж., И Холлсворт, Дж. Э. (2013). Биология доминирования местообитаний; могут ли микробы вести себя как сорняки? Microb. Biotechnol. 6, 453–492.DOI: 10.1111 / 1751-7915.12027

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Dijkshoorn, L., van Aken, E., Shunburne, L., van der Reijden, T. J. K, Bernards, A. T., Nemec, A., et al. (2005). Распространенность Acinetobacter baumannii и других Acinetobacter spp. в образцах фекалий не госпитализированных лиц. Clin. Microbiol. Заразить. 11, 329–332. DOI: 10.1111 / j.1469-0691.2005.01093.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дорте, Л., Легран, П., Сусси, К.-Дж., и Каттуар, В. (2006). Идентификация бактерий, клиническое значение и чувствительность к противомикробным препаратам Acinetobacter ursingii и Acinetobacter schindleri , двух часто неправильно определяемых условно-патогенных микроорганизмов. J. Clin. Microbiol. 44, 4471–4478. DOI: 10.1128 / JCM.01535-06

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дугари Х. Дж., Ндакидеми П. А., Хуман И. С. и Бенаде С. (2011).Экология, биология и патогенез Acinetobacter spp .: обзор. Microbes Environ. 26, 101–112. DOI: 10.1264 / jsme2.ME10179

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Endimiani, A., Hujer, K. M., Hujer, A. M., Bertschy, I., Rossano, A., Koch, C., et al. (2011). Изоляты Acinetobacter baumannii от домашних животных и лошадей в Швейцарии: молекулярная характеристика и клинические данные. J. Antimicrob. Chemother. 66, 2248–2254. DOI: 10.1093 / jac / dkr289

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эндо, С., Яно, Х., Канамори, Х., Иномата, С., Аояги, Т., Хатта, М., и др. (2014). Высокая частота Acinetobacter soli среди изолятов Acinetobacter , вызывающих бактериемию в специализированной больнице в Японии. J. Clin. Microbiol. 52, 911–915. DOI: 10.1128 / JCM.03009-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Этьемез, М., и Балькасар, Дж. Л. (2015). Структура бактериального сообщества в кишечной экосистеме радужной форели ( Oncorhynchus mykiss ), выявленная с помощью анализа генов 16S рРНК на основе пиросеквенирования. Res. Вет. Sci . 100, 8–11. DOI: 10.1016 / j.rvsc.2015.03.026

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фэн, Г., Ян, С., Ван, Ю., Яо, К., и Чжу, Х. (2014a). Холодильник Acinetobacteris sp. nov., изолированное от бытового холодильника. Curr. Microbiol. 69, 888–893. DOI: 10.1007 / s00284-014-0669-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Feng, G.-D., Yang, S.-Z., Wang, Y.-H., Deng, M.-R., and Zhu, H.-H. (2014b). Acinetobacter guangdongensis sp. nov., выделенный из заброшенных свинцово-цинковых руд. Внутр. J. Syst. Evol. Microbiol. 64, 3417–3421. DOI: 10.1099 / ijs.0.066167-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фитцпатрик, М.А., Озер, Э., Болон, М. К., Хаузер, А. Р. (2015). Влияние комплексных геновидов ACB на клинические исходы в больнице США с высокими показателями множественной лекарственной устойчивости. J. Infect. 70, 144–152. DOI: 10.1016 / j.jinf.2014.09.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Fu, Y., Liu, L., Li, X., Chen, Y., Jiang, Y., Wang, Y., et al. (2015). Распространение общей плазмиды, несущей blaNDM-1, среди различных видов Acinetobacter . Заражение.Genet. Evol. 32, 30–33. DOI: 10.1016 / j.meegid.2015.02.020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Fuhs, G. W., and Chen, M. (1975). Микробиологические основы удаления фосфатов в процессе обработки активного ила сточных вод. Microb. Ecol. 2, 119–138. DOI: 10.1007 / BF02010434

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гайосо, К. М., Матеос, Дж., Мендес, Дж. А., Фернандес-Пуэнте, П., Румбо К., Томас М. и др. (2014). Молекулярные механизмы, участвующие в реакции на стресс высыхания и персистенции у Acinetobacter baumannii . J. Proteome Res. 13, 460–476. DOI: 10.1021 / pr400603f

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гейгер А., Фардо М.-Л., Гребо П., Ватунга Г., Хосенандо Т., Гердер С. и др. (2009). Первое выделение Enterobacter, Enterococcus и Acinetobacter spp.как обитатели мухи цеце ( Glossina palpalis palpalis ) средней кишки. Заражение. Genet. Evol. 9, 1364–1370. DOI: 10.1016 / j.meegid.2009.09.013

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гувейя, К., Асенси, М. Д., Занер, В., Рангель, Э. Ф., и де Оливейра, С. М. П. (2008). Исследование бактериальной микробиоты средней кишки, связанной с различными бразильскими популяциями Lutzomyia longipalpis (Lutz & Neiva) (Diptera: Psychodidae). Neotrop.Энтомол. 37, 597–601. DOI: 10.1590 / S1519-566X2008000500016

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гуардабасси, Л., Далсгаард, А., и Олсен, Дж. Э. (1999). Фенотипическая характеристика и устойчивость к антибиотикам Acinetobacter spp. изолирован от водных источников. J. Appl. Microbiol. 87, 659–667. DOI: 10.1046 / j.1365-2672.1999.00905.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гурунг, М., Nam, H.M., Tamang, M.D., Chae, M.H., Jang, G.C., Jung, S.C. и др. (2013). Распространенность и чувствительность к противомикробным препаратам Acinetobacter из сырого молока в резервуарах в Корее. J. Dairy Sci. 96, 1997–2002. DOI: 10.3168 / jds.2012-5965

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хамуда, А., Финдли, Дж., Аль-Хассан, Л., и Эмис, С. Г. (2011). Эпидемиология Acinetobacter baumannii животного происхождения. Внутр. J. Antimicrob.Агенты 38, 314–318. DOI: 10.1016 / j.ijantimicag.2011.06.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хамуда, А., Вали, Л., и Эмис, С. Г. (2008). Грамотрицательные неферментирующие бактерии от сельскохозяйственных животных несут низкий риск внутрибольничных инфекций. J. Chemother. 20, 702–708. DOI: 10.1179 / joc.2008.20.6.702

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Houang, E. T., Chu, Y. W., Leung, C.М., Чу, К. Ю., Берлау, Дж., Нг, К. С. и др. (2001). Значение Acinetobacter spp. В эпидемиологии и контроле за инфекцией. в Гонконге. J. Clin. Microbiol. 39, 228–234. DOI: 10.1128 / JCM.39.1.228-234.2001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ховда, М. Б., Лунестад, Б. Т., Фонтанильяс, Р., и Роснес, Дж. Т. (2007). Молекулярная характеристика кишечной микробиоты выращиваемого атлантического лосося (Salmo salar L.). Аквакультура 26, 581–588.DOI: 10.1016 / j.aquaculture.2007.08.045

CrossRef Полный текст | Google Scholar

Хайс, Г., Барти, К., Кнокарт, М., Хоанг Оан, Д. Т., Фуонг, Н. Т., Сомсири, Т., и др. (2007). Биоразнообразие устойчивых к хлорамфениколу мезофильных гетеротрофов из аквакультуры Юго-Восточной Азии. Res. Microbiol. 158, 228–235. DOI: 10.1016 / j.resmic.2006.12.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Юнг Дж. И Парк У.(2015). Acinetobacter видов как модельные микроорганизмы в микробиологии окружающей среды: современное состояние и перспективы. Заявл. Microbiol. Biotechnol. 99, 2533–2548. DOI: 10.1007 / s00253-015-6439-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кан, Й.-С., Юнг, Дж., Чон, К. О., и Пак, В. (2011). Acinetobacter oleivorans sp. ноя способен прилипать к дизельному топливу и расти на нем. J. Microbiol. Сеул Корея 49, 29–34.DOI: 10.1007 / s12275-011-0315-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Karah, N., Haldorsen, B., Hegstad, K., Simonsen, G. S., Sundsfjord, A., Samuelsen, Ø., Et al. (2011). Идентификация видов и молекулярная характеристика Acinetobacter spp. изоляты гемокультуры из Норвегии. J. Antimicrob. Chemother. 66, 738–744. DOI: 10.1093 / jac / dkq521

PubMed Аннотация | CrossRef Полный текст

Кемпф, М., Абдисса, А., Диатта, Г., Трапе, Дж. Ф., Ангелакис, Э., Медианников, О. и др. (2012b). Обнаружение Acinetobacter baumannii у головных и нательных вшей человека из Эфиопии и идентификация новых генотипов. Внутр. J. Infect. Дис. 16, e680 – e683. DOI: 10.1016 / j.ijid.2012.05.1024

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кемпф, М., Ролайн, Дж. М., Диатта, Г., Азза, С., Самб, Б., Медианников, О. и др. (2012a). Устойчивость к карбапенемам и Acinetobacter baumannii в Сенегале: парадигма общего явления в естественных водоемах. PLoS ONE 7: e39495. DOI: 10.1371 / journal.pone.0039495

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Килич, А., Ли, Х., Мельманн, А., Басустаоглу, А.С., Кул, М., Senses, Z., et al. (2008). Acinetobacter septicus sp. ноя связь с внутрибольничной вспышкой бактериемии в отделении интенсивной терапии новорожденных. J. Clin. Microbiol. 46, 902–908. DOI: 10.1128 / JCM.01876-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, Д., Байк, К.С., Ким, М.С., Парк, С.С., Ким, С.С., Ри, М.С. и др. (2008). Acinetobacter soli sp. nov., выделенный из лесной почвы. J. Microbiol. Сеул Корея 46, 396–401. DOI: 10.1007 / s12275-008-0118-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, П. С., Шин, Н.-Р., Ким, Дж. Ю., Юн, Д.-Х., Хён, Д.-В., и Бэ, Ж.-В. (2014). Acinetobacter apis sp. nov., выделенный из кишечника медоносной пчелы Apis mellifera. J. Microbiol. Сеул Корея 52, 639–645. DOI: 10.1007 / s12275-014-4078-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Куяма Ю., Харада С., Исии Ю., Сага Т., Йошизуми А., Татеда К. и др. (2012). Молекулярная характеристика нечувствительных к карбапенему Acinetobacter spp. в Японии: преобладание клонального комплекса Acinetobacter baumannii с множественной лекарственной устойчивостью и видов не- baumannii Acinetobacter , продуцирующих металло-β-лактамазу IMP-типа. J. Infect. Chemother. 18, 522–528. DOI: 10.1007 / s10156-012-0374-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кризова Л., Майкснерова М., Седо О., Немец А. (2014). Acinetobacter bohemicus sp. ноя Широко распространен в естественных почвенных и водных экосистемах Чехии. Syst. Прил. Microbiol. 37, 467–473. DOI: 10.1016 / j.syapm.2014.07.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кризова, Л., Майкснерова М., Седо О., Немец А. (2015a). Acinetobacter albensis sp. nov., изолированные от естественных почвенных и водных экосистем. Внутр. J. Syst. Evol. Microbiol. 65, 857–863. DOI: 10.1099 / ijs.0.000028

CrossRef Полный текст | Google Scholar

Кризова, Л., МакГиннис, Дж., Майкснерова, М., Немек, М., Пуарель, Л., Мингл, Л. и др. (2015b). Acinetobacter variabilis sp. ноя (ранее группа ДНК 15 sensu Tjernberg & Ursing), выделенная от человека и животных. Внутр. J. Syst. Evol. Microbiol. 65, 857–863. DOI: 10.1099 / ijs.0.000028

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Kuo, S.-C., Fung, C.-P., Lee, Y.-T., Chen, C.-P., and Chen, T.-L. (2010). Бактериемия, вызванная геномными видами Acinetobacter 10 . J. Clin. Microbiol. 48, 586–590. DOI: 10.1128 / JCM.01857-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

La Scola, B., Fournier, P-E, Brouqui, P.и Рауль Д. (2001). Обнаружение и культивирование Bartonella quintana, Serratia marcescens и Acinetobacter spp. от обеззараженных вшей человеческого тела. J. Clin. Microbiol. 39, 1707–1709. DOI: 10.1128 / JCM.39.5.1707-1709.2001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, Х.-Дж., и Ли, С.-С. (2010). Acinetobacter kyonggiensis sp. nov., бактерия-продуцент β-глюкозидазы, выделенная из очистных сооружений. J. Microbiol. Сеул Корея 48, 754–759. DOI: 10.1007 / s12275-010-0355-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, Дж. Х., Чой, К. Х., Кан, Х. Й., Ли, Дж. Й., Ким, Дж., Ли, Ю. К. и др. (2007). Различия в фенотипических и генотипических признаках противомикробных препаратов между Acinetobacter baumannii и Acinetobacter геномных видов 13TU . J. Antimicrob. Chemother. 59, 633–639. DOI: 10.1093 / jac / dkm007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, Дж.-S., Ли, К. С., Ким, К. К., Хван, И. К., Джанг, К., Ким, Н. Г. и др. (2009). Acinetobacter antiviralis sp. nov., из корней табака. J. Microbiol. Biotechnol. 19, 250–256. DOI: 10.4014 / jmb.0901.083

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, Г., Ян, М., Чжоу, К., Чжан, Л., Тиан, Л., Львов, С. и др. (2015c). Разнообразие микробиоты двенадцатиперстной и прямой кишки в биопсийных тканях и содержимом просвета у здоровых добровольцев. Дж.Microbiol. Biotechnol. 25, 1136–1145. DOI: 10.4014 / jmb.1412.12047

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, П., Ян, К., Се, Дж., Лю, Н., Ван, Х., Чжан, Л. и др. (2015a). Acinetobacter calcoaceticus из смертельного случая пневмонии, несущей blaNDM-1 на широко распространенной плазмиде. BMC Infect. Дис. 15: 131. DOI: 10.1186 / s12879-015-0870-7

CrossRef Полный текст | Google Scholar

Ли В., Чжан Д., Хуанг, X., и Qin, W. (2014b). Acinetobacter harbinensis sp. nov., изолированное от речной воды. Внутр. J. Syst. Evol. Microbiol. 64, 1507–1513. DOI: 10.1099 / ijs.0.055251-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Li, Y., Chang, J., Guo, L.-M., Wang, H.-M., Xie, S.-J., Piao, C.-G., et al. (2015b). Описание Acinetobacter populi sp. ноя выделен из коры с симптомами Populus × euramericana canker. Внутр.J. Syst. Evol. Microbiol. DOI: 10.1099 / ijsem.0.000599. [Epub перед печатью].

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Li, Y., He, W., Wang, T., Piao, C., Guo, L., Chang, J., et al. (2014a). Acinetobacter qingfengensis sp. nov., выделенный из язвенной коры Populus x euramericana. Внутр. J. Syst. Evol. Microbiol. 64, 1043–1050. DOI: 10.1099 / ijs.0.051995-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, Ю., Piao, C., Ma, Y., He, W., Wang, H., Chang, J., et al. (2013). Acinetobacter puyangensis sp. nov., выделенный из здоровой и больной части коры язвы Populus xeuramericana. Внутр. J. Syst. Evol. Microbiol. 63, 2963–2969. DOI: 10.1099 / ijs.0.047274-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Малхотра, Дж., Ананд, С., Джиндал, С., Раджагопал, Р., и Лал, Р. (2012). Acinetobacter indicus sp. nov., выделенный со свалки гексахлорциклогексана. Внутр. J. Syst. Evol. Microbiol. 62, 2883–2890. DOI: 10.1099 / ijs.0.037721-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маравич, А., Скочибушич, М., Фредотович,., Шаманич, И., Цветан, С., Кнезович, М., и др. (2015). Прибрежная городская среда является источником клинически важных бактерий Acinetobacter spp. Environ. Sci. Загрязнение. Res. Int. DOI: 10.1007 / s11356-015-5586-0. [Epub перед печатью].

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мостачио, А. К., Левин, А. С., Ризек, К., Росси, Ф., Зербини, Дж., И Коста, С. Ф. (2012). Высокая распространенность OXA-143 и изменение белков внешней мембраны у устойчивых к карбапенемам Acinetobacter spp. изоляты в Бразилии. Внутр. J. Antimicrob. Агенты 39, 396–401. DOI: 10.1016 / j.ijantimicag.2012.01.021

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нам, Х.М., Лим, С. К., Кан, Х. М., Ким, Дж. М., Мун, Дж. С., Янг, К. С. и др. (2009). Распространенность и чувствительность к антимикробным препаратам грамотрицательных бактерий, выделенных от мастита крупного рогатого скота в период с 2003 по 2008 год в Корее. J. Dairy Sci. 92, 2020–2026. DOI: 10.3168 / jds.2008-1739

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ндегва, Э. Н., Мулей, К. М., и Муньюа, С. Дж. (2001). Распространенность микроорганизмов, связанных с инфекциями вымени у молочных коз на небольших фермах в Кении. J. S. Afr. Вет. Доц. 72, 97–98. DOI: 10.4102 / jsava.v72i2.627

PubMed Аннотация | CrossRef Полный текст

Нисимура, Ю., Ино, Т., и Иидзука, Х. (1988). Acinetobacter radioresistens sp. ноя изолирован от хлопка и почвы. Внутр. J. Syst. Бактериол. 38, 209–211. DOI: 10.1099 / 00207713-38-2-209

CrossRef Полный текст | Google Scholar

Обуэкве, К. О., Аль-Джади, З. К., и Аль-Салех, Э. С. (2009). Распад углеводородов в связи с гидрофобностью клеточной поверхности среди бактериальных деструкторов углеводородов из загрязненной нефтью среды пустыни Кувейта. Внутр. Биодетериор. Биодеград. 63, 273–279. DOI: 10.1016 / j.ibiod.2008.10.004

CrossRef Полный текст | Google Scholar

Патил, Дж. Р., и Чопаде, Б. А. (2001). Распространение и in vitro антимикробной чувствительности видов Acinetobacter на коже здоровых людей. Natl. Med. J. India 14, 204–208.

PubMed Аннотация | Google Scholar

Poirel, L., Berçot, B., Millemann, Y., Bonnin, R.A., Pannaux, G., и Нордманн, П. (2012). Продуцирующая карбапенемаза Acinetobacter spp. в крупном рогатом скоте, Франция. Emerging Infect. Дис. 18, 523–525. DOI: 10.3201 / eid1803.111330

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Quiñones, D., Carvajal, I., Perez, Y., Hart, M., Perez, J., Garcia, S., et al. (2015). Высокая распространенность bla, OXA-23 среди Acinetobacter spp. и обнаружение bla, NDM-1 в A. soli на Кубе: отчет Национальной программы надзора (2010-2012). Новые микробы Новый зараз . 7, 52–56. DOI: 10.1016 / j.nmni.2015.06.002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Rafei, R., Hamze, M., Pailhoriès, H., Eveillard, M., Marsollier, L., Joly-Guillou, M.-L., et al. (2015). Внечеловеческая эпидемиология Acinetobacter baumannii в Ливане. Заявл. Environ. Microbiol. 81, 2359–2367. DOI: 10.1128 / AEM.03824-14

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рафей Р., Kempf, M., Eveillard, M., Dabboussi, F., Hamze, M., and Joly-Guillou, M.-L. (2014). Современные молекулярные методы эпидемиологического типирования Acinetobacter baumannii . Future Microbiol. 9, 1179–1194. DOI: 10.2217 / fmb.14.63

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сарма, П. М., Бхаттачарья, Д., Кришнан, С., и Лал, Б. (2004). Оценка внутривидового разнообразия штаммов Acinetobacter baumannii , выделенных с участков, загрязненных нефтяными углеводородами. Банка. J. Microbiol. 50, 405–414. DOI: 10.1139 / w04-018

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шлейхер, X., Хиггинс, П.Г., Висплингхофф, Х., Кёрбер-Иррганг, Б., Крескен, М., и Зайферт, Х. (2013). Молекулярная эпидемиология Acinetobacter baumannii и Acinetobacter nosocomialis в Германии за 5-летний период (2005-2009 гг.). Clin. Microbiol. Заразить. 19, 737–742. DOI: 10.1111 / 1469-0691.12026

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Зайферт, Х., Дейксхорн, Л., Гернер-Шмидт, П., Пельцер, Н., Тьернберг, И., и Ваничутт, М. (1997). Распространение видов Acinetobacter на коже человека: сравнение методов фенотипической и генотипической идентификации. J. Clin. Microbiol. 35, 2819–2825.

PubMed Аннотация | Google Scholar

Смет, А., Коулс, П., Кризова, Л., Майкснерова, М., Седо, О., Хезебрук, Ф. и др. (2014). Acinetobacter gandensis sp. ноя изолирован от лошади и крупного рогатого скота. Внутр. J. Syst. Evol. Microbiol. 64, 4007–4015. DOI: 10.1099 / ijs.0.068791-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Sun, Y., Ji, X., Liu, Y., Liu, Q., Guo, X., Liu, J., et al. (2015). Нью-Дели, продуцирующая металло-β-лактамазу-1 Acinetobacter lwoffii домашнего животного происхождения в Китае. Indian J. Med. Microbiol. 33, 615–617. DOI: 10.4103 / 0255-0857.167333

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Sunantaraporn, S., Санпрасерт, В., Пенгсакул, Т., Фуми, А., Бонсерм, Р., Таватсин, А., и др. (2015). Молекулярное исследование головной вши Pediculus humanus capitis в Таиланде и ее потенциальной роли в переносе Acinetobacter spp. Паразит. Векторы . 8, 127. DOI: 10.1186 / s13071-015-0742-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сунг, Дж. Й., Ку, С. Х., Ким, С., и Квон, К. С. (2014). Эпидемиологические характеристики интегронов класса 1 из изолятов Acinetobacter с множественной лекарственной устойчивостью в Тэджоне, Корея. Ann. Лаборатория. Med. 34, 293–299. DOI: 10.3343 / alm.2014.34.4.293

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Урбаниак, К., Макмиллан, А., Анджелини, М., Глор, Г. Б., Сумара, М., Бертон, Дж. П. и др. (2014). Влияние химиотерапии на микробиоту и метаболом грудного молока, клинический случай. Микробиом 2:24. DOI: 10.1186 / 2049-2618-2-24

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ваничутте, М., Nemec, A., Musílek, M., van der Reijden, T. J.K, van den Barselaar, M, Tjernberg, I., et al. (2009). Описание Acinetobacter venetianus ex Di Cello et al. 1997 sp. ноя Внутр. J. Syst. Evol. Microbiol. 59, 1376–1381. DOI: 10.1099 / ijs.0.003541-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ваз-Морейра И., Ново А., Ханцис-Захаров Э., Лопес А. Р., Гомила М., Нунес О. С. и др. (2011). Acinetobacter rudis sp.nov., изолированное от сырого молока и сырых сточных вод. Внутр. J. Syst. Evol. Microbiol. 61, 2837–2843. DOI: 10.1099 / ijs.0.027045-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wagenvoort, J. H., and Joosten, E. J. (2002). J. Вспышка Acinetobacter baumannii , которая имитирует MRSA по своей экологической долговечности. J. Hosp. Заразить. 52, 226–227. DOI: 10.1053 / jhin.2001.1294

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван, Б., и Сан, Д. (2015). Обнаружение Acinetobacter calcoaceticus и Acinetobacter junii , продуцирующих карбапенемазу NDM-1, в образцах окружающей среды с животноводческих ферм. J. Antimicrob. Chemother. 70, 611–613. DOI: 10.1093 / jac / dku405

PubMed Аннотация | CrossRef Полный текст

Wendt, C., Dietze, B., Dietz, E., and Rüden, H. (1997). Выживаемость Acinetobacter baumannii на сухих поверхностях. J. Clin. Microbiol. 35, 1394–1397.

PubMed Аннотация | Google Scholar

Видманн-аль-Ахмад, М., Тихи, Х. В., и Шен, Г. (1994). Характеристика штаммов и изолятов типа Acinetobacter , полученных с очистных сооружений, методом ПЦР-отпечатков пальцев. Заявл. Environ. Microbiol. 60, 4066–4071.

PubMed Аннотация | Google Scholar

Xiong, W., Sun, Y., Zhang, T., Ding, X., Li, Y., Wang, M., et al. (2015). Антибиотики, гены устойчивости к антибиотикам и состав бактериального сообщества в среде пресноводной аквакультуры в Китае. Microb. Ecol. 70, 425–432. DOI: 10.1007 / s00248-015-0583-x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ян, Дж., Чен, Ю., Цзя, X., Ло, Ю., Сун, К., Чжао, В. и др. (2012). Распространение и характеристика NDM-1-продуцента Acinetobacter pittii в отделении интенсивной терапии в Китае. Clin. Microbiol. Заразить. 18, E506 – E513. DOI: 10.1111 / 1469-0691.12035

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Юн, Дж.-H., Kim, I.-G., и Oh, T.-K. (2007). Acinetobacter marinus sp. ноя и Acinetobacter seohaensis sp. nov., выделенный из морской воды Желтого моря в Корее. J. Microbiol. Biotechnol. 17, 1743–1750.

PubMed Аннотация | Google Scholar

Захаркина Т., Хайнцель Э., Кочулла Р. А., Грейлих Т., Рентц К., Полинг Дж. К. и др. (2013). Анализ микробиоты дыхательных путей здоровых людей и пациентов с хронической обструктивной болезнью легких с помощью T-RFLP и секвенирования клонов. PLoS ONE 8: e68302. DOI: 10.1371 / journal.pone.0068302

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чжао, Дж., Чжао, X., Чао, Л., Чжан, В., Ю, Т., и Чжан, Дж. (2014). Изменение разнообразия микробных сообществ в ответ на загрязнение цинком и мышьяком в реке на северо-востоке Китая. J. Zhejiang Univ. Sci. B 15, 670–680. DOI: 10.1631 / jzus.B1400003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Acinetobacter — microbewiki

Страница Microbial Biorealm по роду Acinetobacter

Классификация

Таксоны высшего порядка:

Бактерии; Протеобактерии; Гаммапротеобактерии; Pseudomonadales; Moraxellaceae

Виды:

Acinetobacter baumannii
Acinetobacter baylyi
Acinetobacter bouvetii
Acinetobacter calcoaceticus

Описание и значение

Acinetobacter — это род условно-патогенных микроорганизмов в группе протеобактерий, виды которых распространены в широко распространенных и разнообразных средах обитания.Он привлек внимание средств массовой информации из-за вспышки болезни среди солдат в Ираке, заразившихся видом Acinetobacter baumannii . Хотя изначально предполагалось, что бактерии пришли из иракской почвы, оказалось, что бактерии на самом деле заразились в ходе военной эвакуации. По меньшей мере 280 человек, в основном солдаты, вернувшиеся с поля боя, были инфицированы этой болезнью, и не менее 5 человек (не военнослужащих) умерли.

Эти бактерии часто можно обнаружить как причину пневмонии у госпитализированных пациентов, особенно у тех, кто зависит от аппаратов ИВЛ в отделениях интенсивной терапии.Бактерии чаще всего заражаются при контакте открытых ран с зараженной почвой. Это создает проблему во время войны (это была вторая по значимости причина заражения войск во время Вьетнамского конфликта) из-за большого количества ранений, вызванных взрывчатыми веществами, которые легко могут привести к загрязнению открытых участков кожи. У здоровых людей наличие на поверхности кожи некоторого количества Acinetobacter является нормальным явлением; На самом деле эти бактерии есть у 25% здоровых взрослых людей.

Структура генома

В то время как имеется много информации о типах инфекций, вызываемых Acinetobacter , относительно мало исследований было выполнено в отношении генетики бактерий. Поскольку Acinetobacters очень устойчивы к антибиотикам и их трудно различить между видами при изолировании от пациентов, больше информации об их ДНК поможет разработать более эффективные лекарства для борьбы со вспышками инфекции.

Структура и метаболизм клеток

Клетки Acinetobacter представляют собой грамотрицательные короткие палочки (коккобациллы) размером 1.0-1,5 на 1,5-2,5 мкм при росте; они часто становятся более кокковыми во время стационарной фазы. Клетки встречаются парами или небольшими кластерами; группы образуют гладкие светлые колонии на твердой среде. Все виды строго аэробны, положительны по каталазе и отрицательны по оксидазе; это последний тест, который чаще всего используется для отличия Acinetobacter от других инфекционных бактерий. Эти бактерии могут использовать различные органические материалы в качестве источников углерода.

Экология

Acinetobacters широко распространены в больницах, где они представляют опасность передачи устойчивости другим живущим в больницах бактериям.Они обнаружены в почве, воде и в живых организмах, где они могут быть или не быть патогенными. До 27% сифонов для раковин в больницах и 20% мазков с пола в больницах дали изоляты Acinetobacter . Было обнаружено, что бактерии заражают респираторы и больничный воздух, когда присутствуют колонизированные пациенты, а также находящиеся поблизости одеяла и занавески. В настоящее время проводятся исследования методов очистки воздуха в больницах с целью снижения распространенности этих патогенов среди пациентов с ограниченными возможностями.

Биотехнологии

Многие из характеристик экологии, таксономии, физиологии и генетики Acinetobacter указывают на возможность использования его уникальных свойств для будущих приложений. Штаммы Acinetobacter часто распространены повсеместно, демонстрируют метаболическую универсальность, являются надежными, а некоторые из них обеспечивают удобные системы для современных молекулярно-генетических манипуляций и последующей инженерии продуктов. Эти характеристики используются в различных биотехнологических приложениях, включая биодеградацию и биоремедиацию, производство новых липидов и пептидов, ферментную инженерию, производство биосурфактантов и биополимеров, а также разработку новых производных этих продуктов.Ожидается, что прогресс в этих областях расширит диапазон применения Acinetobacter в современной биотехнологии.

Список литературы

Acinetobacter . Хьюстонская медицинская школа Техасского университета. 1995.

Херпер, Мэтью. Иракская инфекция. Forbes.com, 2 августа 2005 г.

Зильберман, Стив. Невидимый враг. Журнал Wired, выпуск 15.02, февраль 2007 г.

Bergogne-Berezin, E. et al. Acinetobacter spp.как внутрибольничные патогены: микробиологические, клинические и эпидемиологические особенности. Обзоры клинической микробиологии, апрель 1996 г. 148-165.

Геришер У (редактор). Acinetobacter Molecular Biology, Caister Academic Press. 2008 г.

Гутник Д. Возможное применение Acinetobacter в биотехнологии в молекулярной биологии Acinetobacter . Геришер У (редактор), Caister Academic Press. 2008 г.

Диас Э. (редактор). Микробная биодеградация: геномика и молекулярная биология, Caister Academic Press.2008 г.

Ретроспективное исследование заболеваемости, клинических характеристик, идентификации и чувствительности к противомикробным препаратам изолятов бактериемии Acinetobacter ursingii | BMC Infectious Diseases

  • 1.

    Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: появление успешного возбудителя. Clin Microbiol Rev.2008; 21: 538–82.

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 2.

    Schreckenberger PC, Daneshvar MI, Weyant RS, Hollis DG. Acinetobacter, Achromobacter, Chryseobacterium, Moraxella и другие неферментативные грамотрицательные палочки. Руководство по клинической микробиологии. 2003. 8: 749–79.

    Google Scholar

  • 3.

    Зейферт Х., Дейкшорн Л., Гернер-Смидт П., Пельцер Н., Тьернберг И., Ваничутт М. Распространение видов Acinetobacter на коже человека: сравнение методов фенотипической и генотипической идентификации.J Clin Microbiol. 1997; 35: 2819–25.

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 4.

    Humphreys H, Towner KJ. Воздействие Acinetobacter spp. в отделениях интенсивной терапии в Великобритании и Ирландии. J Hosp Infect. 1997. 37: 281–6.

    CAS
    Статья
    PubMed

    Google Scholar

  • 5.

    Список названий прокариот, стоящих в номенклатуре. LPSN bacterio.сеть. http://www.bacterio.net/acinetobacter.html

  • 6.

    Boo TW, Walsh F, Crowley B. Молекулярная характеристика устойчивых к карбапенемам видов Acinetobacter в больнице ирландского университета: преобладание геномных видов Acinetobacter 3. J Med Microbiol. 2009. 58: 209–16.

    CAS
    Статья
    PubMed

    Google Scholar

  • 7.

    Karah N, Haldorsen B, Hegstad K, Simonsen GS, Sundsfjord A, Samuelsen O. Идентификация видов и молекулярная характеристика Acinetobacter spp.изоляты гемокультуры из Норвегии. J Antimicrob Chemother. 2011; 66: 738–44.

    CAS
    Статья
    PubMed

    Google Scholar

  • 8.

    Turton JF, Shah J, Ozongwu C, Pike R. Распространенность видов Acinetobacter, отличных от A. baumannii, среди клинических изолятов Acinetobacter: доказательства появления новых видов. J Clin Microbiol. 2010; 48: 1445–9.

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 9.

    Chuang YC, Sheng WH, Li SY, Lin YC, Wang JT, Chen YC и др. Влияние геновидов комплекса Acinetobacter baumannii на клинические исходы пациентов с бактериемией acinetobacter. Clin Infect Dis. 2011; 52: 352–60.

    Артикул
    PubMed

    Google Scholar

  • 10.

    Schleicher X, Higgins PG, Wisplinghoff H, Körber-Irrgang B, Kresken M, Seifert H. Молекулярная эпидемиология Acinetobacter baumannii и Acinetobacter nosocomialis в Германии за 5-летний период 2005–2009 гг.Clin Microbiol Infect. 2013; 19 (8): 737–42.

    CAS
    Статья
    PubMed

    Google Scholar

  • 11.

    Wisplinghoff H, Paulus T, Lugenheim M, Stefanik D, Higgins PG, Edmond MB, et al. Нозокомиальные инфекции кровотока, вызванные Acinetobacter baumannii, Acinetobacter pittii и Acinetobacter nosocomialis в США. J Infect. 2012; 64: 282–90.

    Артикул
    PubMed

    Google Scholar

  • 12.

    Dortet L, Legrand P, Soussy CJ, Cattoir V. Идентификация бактерий, клиническое значение и чувствительность к противомикробным препаратам Acinetobacter ursingii и Acinetobacter schindleri, двух часто ошибочно идентифицируемых условно-патогенных микроорганизма. J Clin Microbiol. 2006; 44: 4471–8.

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 13.

    Nemec A, De Baere T., Tjernberg I, Vaneechoutte M, Van Der Reijden TJ, Dijkshoorn L.Acinetobacter ursingii sp. ноя и Acinetobacter schindleri sp. nov., выделенный из клинических образцов человека. Intl J Sys Evol Microbiol. 2001; 51: 1891–9.

    CAS
    Статья

    Google Scholar

  • 14.

    Гарнер Дж. С., Джарвис В. Р., Эмори Т. Г., Хоран Т. К., Хьюз Дж. М.. Определения CDC для нозокомиальных инфекций, 1988. Am J Infect Control. 1988. 16: 128–40.

    CAS
    Статья
    PubMed

    Google Scholar

  • 15.

    Horan TC, Гейнес РП. Эпиднадзор за внутрибольничными инфекциями. В: Mayhall CG, редактор. Госпитальная эпидемиология и инфекционный контроль. 3-е изд. Балтимор, Мэриленд: Липпинкотт Уильямс и Уилкинс; 2004. с. 1659–702.

    Google Scholar

  • 16.

    Кнаус В.А., Дрейпер Е.А., Вагнер Д.П., Циммерман Дж. Э. APACHE II: система классификации тяжести заболевания. Crit Care Med. 1985; 13: 818–29.

    CAS
    Статья
    PubMed

    Google Scholar

  • 17.

    Chen TL, Siu LK, Wu RC, Shaio MF, Huang LY, Fung CP и др. Сравнение мультиплексной ПЦР в одной пробирке, автоматического риботипирования и секвенирования межгенных спейсеров (ITS) для быстрой идентификации Acinetobacter baumannii. Clin Microbiol Infect. 2007; 13: 801–6.

    CAS
    Статья
    PubMed

    Google Scholar

  • 18.

    Kommedal Ø, Karlsen B, Sæbø Ø. Анализ хроматограмм смешанного секвенирования и его применение в прямом секвенировании гена 16S рРНК полимикробных образцов.J Clin Microbiol. 2008; 46: 3766–71.

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 19.

    Chang HC, Wei YF, Dijkshoorn L, Vaneechoutte M, Tang CT, Chang TC. Идентификация на уровне видов изолятов комплекса Acinetobacter calcoaceticus-Acinetobacter baumannii путем анализа последовательности спейсерной области гена 16S-23S рРНК. J Clin Microbiol. 2005; 43: 1632–9.

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 20.

    Chen TL, Siu LK, Lee YT, Chen CP, Huang LY, Wu RCC и др. Acinetobacter baylyi как возбудитель оппортунистической инфекции. J Clin Microbiol. 2008; 46: 2938–44.

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 21.

    Уэйн PA. Институт клинических и лабораторных стандартов (CLSI): Стандарты эффективности тестирования чувствительности к противомикробным препаратам: Двадцать первое информационное приложение. CLSI 2014; M100 – S24.

  • 22.

    Nemec A, Dijkshoorn L, Ježek P. Распознавание двух новых фенонов рода Acinetobacter среди не подкисляющих глюкозу изолятов из образцов человека. J Clin Microbiol. 2000; 38: 3937–41.

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 23.

    Бергонь-Березин Э., Таунер К.Дж. Acinetobacter spp. как внутрибольничные возбудители: микробиологические, клинико-эпидемиологические особенности. Clin Microbiol Rev.1996; 9: 148–65.

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 24.

    Гернер-Смидт П., Тьернберг И., Урсинг Дж. Надежность фенотипических тестов для идентификации видов Acinetobacter. J Clin Microbiol. 1991; 29: 277–82.

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 25.

    Дейксхорн Л., Немек А., Зейферт Х. Возрастающая угроза в больницах: Acinetobacter baumannii с множественной лекарственной устойчивостью. Nat Rev Microbiol. 2007; 5: 939–51.

    CAS
    Статья
    PubMed

    Google Scholar

  • 26.

    Bernards AT, van der Toorn J, van Boven CP, Dijkshoorn L. Оценка способности коммерческой системы идентифицировать геномные виды Acinetobacter. Eur J Clin Microbiol Infect Dis. 1996; 15: 303–8.

    CAS
    Статья
    PubMed

    Google Scholar

  • 27.

    Van Dessel H, Kamp-Hopmans TEM, Fluit AC, Brisse S, De Smet AMGA, Dijkshoorn L, et al. Вспышка восприимчивого штамма Acinetobacter разновидностей 13 (sensu Tjernberg and Ursing) в отделении нейрохирургической интенсивной терапии для взрослых.J Hosp Infect. 2002; 51: 89–95.

    Артикул
    PubMed

    Google Scholar

  • 28.

    Кишии К., Кикучи К., Мацуда Н., Йошида А., Окузуми К., Уэтера Ю. и др. Оценка масс-спектрометрии с использованием матричной лазерной десорбции, ионизации и времени пролета для видовой идентификации штаммов Acinetobacter, выделенных из культур крови. Clin Microbiol Infect. 2014; 20 (5): 424–30.

    CAS
    Статья
    PubMed

    Google Scholar

  • Различия в чувствительности к колистину у разных видов рода Acinetobacter | Журнал антимикробной химиотерапии

    Sir,

    Бактерии рода Acinetobacter и Acinetobacter baumannii , в частности, оказались важными внутрибольничными патогенами, особенно для пациентов в отделениях интенсивной терапии. 1 A. baumannii обладает замечательной способностью развивать устойчивость ко всем клинически значимым противомикробным препаратам. Штаммы этого вида, устойчивые к большинству доступных возбудителей, встречаются в больницах по всему миру. Недавнее распространение устойчивости к карбапенемам резко сузило возможности лечения инфекций, вызванных A. baumannii , и привело к повторному введению полимиксинов с колистином, в частности, для системного лечения инфекций, вызываемых этими бактериями. 1

    Несмотря на то, что A. baumannii является клинически и эпидемиологически наиболее важным видом этого рода, другие виды Acinetobacter также были причастны к человеческим инфекциям, и штаммы некоторых из этих видов могут также обладать множественной лекарственной устойчивостью в сочетании с возможность распространения среди госпитализированных пациентов. 1 В настоящее время в рамках этого рода признано 22 вида с действительными названиями и не менее 11 дополнительных предполагаемых видов, причем 25 из них были обнаружены в образцах человека. 1,2 Однако идентификация видов Acinetobacter в диагностических лабораториях затруднительна из-за отсутствия практических диагностических систем, обеспечивающих надежную идентификацию этих микроорганизмов. 1 Следовательно, ацинетобактеры, идентифицированные стандартными процедурами как принадлежащие к определенному виду, могут фактически представлять другой вид, что может привести к неправильной ассоциации фенотипа или генотипа устойчивости к противомикробным препаратам с данным видом.

    Поскольку в литературе была доступна лишь ограниченная информация о чувствительности штаммов A. baumannii , отличных от , к полимиксинам, мы решили определить чувствительность in vitro к колистину у представителей видов Acinetobacter , которые, как известно, встречаются у человека в клинических условиях. образцы. Всего было изучено 154 штамма 21 вида (табл. 1). Штаммы были отобраны из коллекций Национального института общественного здравоохранения в Праге и Медицинского центра Лейденского университета.Каждый вид включал тип или эталонный штамм и дополнительные штаммы, полученные из клинических образцов человека. Подавляющее большинство ( n = 126) штаммов было выделено в 1978–1999 годах, то есть до повторного введения колистина для системного лечения грамотрицательных инфекций, тогда как с 2000 года было собрано только девять штаммов, что свидетельствует о небольшом вкладе селективное давление полимиксина на исследуемые штаммы. Большинство штаммов ( n = 92) были отобраны из нашего предыдущего исследования клинических изолятов Acinetobacter из Чешской Республики; 3 остальные происходили в основном из других европейских стран.На основании данных о происхождении во времени и пространстве и типировании не было никаких указаний на прямые эпидемиологические связи между штаммами. Все штаммы были идентифицированы методами, обеспечивающими надежную идентификацию на уровне видов, то есть с помощью так называемой консенсусной идентификации, 3 , которая основана на сопоставлении результатов анализа рестрикции амплифицированного гена рРНК (ARDRA) и биохимических тестов, и / или путем снятия отпечатков пальцев AFLP. 2 Colistin Etest (AB Biodisk, Солна, Швеция) проводили с использованием агара Мюллера – Хинтона II (BBL TM BD, США), как рекомендовано производителем.Тестирование чувствительности к колистину (MAST Group, Bootle, UK) с использованием разведения агаром проводилось с ~ 10 90 10 5 4 90 10 6 КОЕ на место посева в соответствии с рекомендациями CLSI. 4 МИК, определенные с помощью Etest, которые попадали между 2-кратными разведениями агаровых разведений. МИК были повышены до следующей наивысшей концентрации лекарственного средства, чтобы они соответствовали схеме 2-кратного разведения. Pseudomonas aeruginosa ATCC 27853 и Escherichia coli ATCC 25922 были включены во все эксперименты, поскольку штаммы контроля качества и полученные значения соответствовали опубликованным стандартам.

    Таблица 1

    Распределение МИК колистина (мг / л) для 154 изолятов Acinetobacter spp.

    917) 917 8 (2)

    000

    0009

    A. )

    41

    41

    41

    6 917

    36

    917 917 917

    917 917 917 917 917 917 917 917 917 917 917 917

    6

    723

    6

    9168
    .

    917) 917 8 (2)

    000

    0009

    A. )

    41

    41

    41

    6 917

    36

    917 917 917

    917 917 917 917 917 917 917 917 917 917 917 917

    в таблице распределения

    мг / л) для 154 изолятов Acinetobacter spp.

    . . Кол-во штаммов


    .

    . . МИК Etest (МИК для разведения в агаре)


    .

    Виды
    .
    Общее количествоштаммов
    .
    ≤0,064
    .
    0,125
    .
    0,25
    .
    0,5
    .
    1
    .
    2
    .
    4
    .
    8
    .
    16
    .
    ≥32
    .
    A. baumannii a 20 (1) 19 (4) 1 (13) (2)
    А.calcoaceticus a 4 1 3 (3) (1) 36

    97

    9174

    97

    7 3 (2) (6) (2)
    Геномные виды 3 a

    1 (

    2 (3) (3) (1)
    A.berezinae 10 4 3 (3) 3 (2) (5) 1 1 (2) 3 (2) (1)
    A. radioresistens41 41741

    1 (1)
    A.gyllenbergii 5 3 2 (3) (2)
    off

    off

    ) 2
    А.

    А.ursingii 10 2 (9) 8 (1)
    ri 101736

    ri

    ri 917 ) 7
    A. haemolyticus 10 917

    1 (2)
    А.junii 10 1 2 (3) 2 (2) 1 (1) 3 (3) 1 (1)
    A. parvus 5 (2) 1 2 (1) 1 (2) 1
    9 1 2 (1) 2 (3) (1) 1 3 (2) (2)
    8 3 5 (8)
    Геномные виды 14BJ 1 (1)
    Геномные виды 15BJ 2 1 (11741 936 917) 11741 936

    Геномные виды 16 3 (1) 1 1
    Геномные виды 17 2 1 1 (1) (1) . Кол-во штаммов


    .

    . . МИК Etest (МИК для разведения в агаре)


    .

    Виды
    .
    Общее количество штаммов
    .
    ≤0,064
    .
    0,125
    .
    0,25
    .
    0,5
    .
    1
    .
    2
    .
    4
    .
    8
    .
    16
    .
    ≥32
    .
    A. baumannii a 20 (1) 19 (4) 1 (13) (2)
    А.calcoaceticus a 4 1 3 (3) (1) 36

    97

    9174

    97

    7 3 (2) (6) (2)
    Геномные виды 3 a

    1 (

    2 (3) (3) (1)
    A.berezinae 10 4 3 (3) 3 (2) (5) 1 1 (2) 3 (2) (1)
    A. radioresistens41 41741

    1 (1)
    A.gyllenbergii 5 3 2 (3) (2)
    off

    off

    ) 2
    А.

    А.ursingii 10 2 (9) 8 (1)
    ri 101736

    ri

    ri 917 ) 7
    A. haemolyticus 10 917

    1 (2)
    А.junii 10 1 2 (3) 2 (2) 1 (1) 3 (3) 1 (1)
    A. parvus 5 (2) 1 2 (1) 1 (2) 1
    9 1 2 (1) 2 (3) (1) 1 3 (2) (2)
    8 3 5 (8)
    Геномные виды 14BJ 1 (1)
    Геномные виды 15BJ 2 1 (11741 936 917) 11741 936

    Геномные виды 16 3 (1) 1 1
    Геномные виды 17 2 1 1 (1) (1) Таблица

    917) 917 8 (2)

    000

    0009

    A. )

    41

    41

    41

    6 917

    36

    917 917 917

    917 917 917 917 917 917 917 917 917 917 917 917

    6

    723

    6

    9168
    .

    917) 917 8 (2)

    000

    0009

    A. )

    41

    41

    41

    6 917

    36

    917 917 917

    917 917 917 917 917 917 917 917 917 917 917 917

    результаты тестирования на чувствительность 916 916 показано в таблице 1.МИК колистина, полученные с помощью Etest, хорошо коррелировали с таковыми при разведении агара в диапазоне концентраций 0,064–32 мг / л, с 88% и 100% согласованием в пределах двух и трех log 2 разведений, соответственно. Используя контрольную точку чувствительности CLSI (≤2 мг / л), категорическое согласие было достигнуто для всех штаммов, кроме двух. На основе MIC виды можно разделить на три группы. В первую группу вошли четыре не подкисляющих глюкозу и негемолитических видов ( Acinetobacter lwoffii , Acinetobacter johnsonii , Acinetobacter ursingii и Acinetobacter schindleri ), ассоциированных с МИК ≤0.125 мг / л, в то время как вторая группа включала 12 видов с МПК от 0,064 до 1,0 мг / л. В последнюю группу вошли пять видов, у которых по крайней мере некоторые штаммы показали МПК колистина> 2 мг / л, то есть Acinetobacter junii , Acinetobacter parvus , Acinetobacter beijerinckii , геномные виды (gen. Sp.) 13BJ и ген. sp. 16. Практически важно, что все штаммы с МИК ≥4 мг / л можно легко отличить от A. baumannii на основе их основных фенотипических признаков, таких как наличие явного гемолиза на чашках с агаром с овечьей кровью ( А.beijerinckii , ген. sp. 13BJ и ген. sp. 16) или неспособность подкислять среду глюкозой (все, кроме gen. Sp. 13BJ). Наибольшего внимания заслуживают результаты для A. beijerinckii , A. junii и gen. sp. 13BJ. В то время как первые два вида включали как чувствительные, так и устойчивые штаммы, все восемь штаммов ген. sp. 13BJ показал МПК ≥16 мг / л.

    Недавно было показано, что терапия колистином может быть нарушена выбором и распространением устойчивых к колистину A.baumannii штаммов. 5 Наши данные также показывают, что устойчивость к колистину может обычно присутствовать ( A. junii , A. beijerinckii ) или даже присуща (gen. Sp. 13BJ) некоторым видам A. baumannii , отличным от . Хотя устойчивые к колистину не штаммы A. baumannii редко выделяются из клинических образцов, и эти штаммы обычно чувствительны к другим противомикробным препаратам (данные в файле), наши результаты подчеркивают важность точной идентификации видов, особенно в отчетах о резистентности к полимиксину у животных. Acinetobacter spp.Примечательно, что устойчивость к колистину у A. baumannii недавно была связана с мутациями в двухкомпонентной системе PmrAB 6 , и еще предстоит установить, играет ли эта система также роль в устойчивости не- A. baumannii. штаммов.

    Финансирование

    Работа поддержана Грантовым агентством Чешской Республики (грант № 310/08/1747).

    Заявления о прозрачности

    Отсутствуют для объявления.

    Благодарности

    Мы благодарны г-же Мартине Майкснеровой за техническую помощь в тестировании чувствительности.

    Список литературы

    1,,.

    Возрастающая угроза в больнице: множественная лекарственная устойчивость Acinetobacter baumannii

    ,

    Nat Rev Microbiol

    ,

    2007

    , vol.

    5

    (стр.

    939

    51

    ) 2« и др.

    Acinetobacter berezinae sp.ноя и Acinetobacter guillouiae sp. nov., для размещения соответственно Acinetobacter геномных видов 10 и Acinetobacter геномных видов 11

    ,

    Int J Syst Evol Microbiol

    ,

    2009

    3,,.

    Распознавание двух новых фенонов рода Acinetobacter среди не подкисляющих глюкозу изолятов из образцов человека

    ,

    J Clin Microbiol

    ,

    2000

    , vol.

    38

    (стр.

    3937

    41

    ) 4

    Институт клинических лабораторных стандартов

    ,

    Стандарты эффективности тестирования антимикробной чувствительности: Девятнадцатое информационное приложение M100-S19.

    ,

    2009

    Уэйн, Пенсильвания, США

    CLSI

    5« и др.

    Независимое появление колистин-устойчивых Acinetobacter spp. изоляты из Кореи

    ,

    Diagn Microbiol Infect Dis

    ,

    2009

    , vol.

    64

    (стр.

    43

    51

    ) 6« и др.

    Устойчивость к колистину у Acinetobacter baumannii , связанных с мутациями в двухкомпонентной системе PmrAB

    ,

    Антимикробные агенты Chemother

    ,

    2009

    , т.

    53

    (стр.

    3628

    34

    )

    © Автор 2009. Опубликовано Oxford University Press от имени Британского общества антимикробной химиотерапии. Все права защищены. Для получения разрешений обращайтесь по электронной почте: [email protected]

    .

    . . Кол-во штаммов


    .

    . . МИК Etest (МИК для разведения в агаре)


    .

    Виды
    .
    Общее количество штаммов
    .
    ≤0,064
    .
    0,125
    .
    0.25
    .
    0,5
    .
    1
    .
    2
    .
    4
    .
    8
    .
    16
    .
    ≥32
    .
    A. baumannii a 20 (1) 19 (4) 1 (13) (2)
    А.calcoaceticus a 4 1 3 (3) (1) 36

    97

    9174

    97

    7 3 (2) (6) (2)
    Геномные виды 3 a

    1 (

    2 (3) (3) (1)
    A.berezinae 10 4 3 (3) 3 (2) (5) 1 1 (2) 3 (2) (1)
    A. radioresistens41 41741

    1 (1)
    A.gyllenbergii 5 3 2 (3) (2)
    off

    off

    ) 2
    А.

    А.ursingii 10 2 (9) 8 (1)
    ri 101736

    ri

    ri 917 ) 7
    A. haemolyticus 10 917

    1 (2)
    А.junii 10 1 2 (3) 2 (2) 1 (1) 3 (3) 1 (1)
    A. parvus 5 (2) 1 2 (1) 1 (2) 1
    9 1 2 (1) 2 (3) (1) 1 3 (2) (2)
    8 3 5 (8)
    Геномные виды 14BJ 1 (1)
    Геномные виды 15BJ 2 1 (11741 936 917) 11741 936

    Геномные виды 16 3 (1) 1 1
    Геномные виды 17 2 1 1 (1) (1) . Кол-во штаммов


    .

    . . МИК Etest (МИК для разведения в агаре)


    .

    Виды
    .
    Общее количество штаммов
    .
    ≤0,064
    .
    0,125
    .
    0,25
    .
    0,5
    .
    1
    .
    2
    .
    4
    .
    8
    .
    16
    .
    ≥32
    .
    A. baumannii a 20 (1) 19 (4) 1 (13) (2)
    А.calcoaceticus a 4 1 3 (3) (1) 36

    97

    9174

    97

    7 3 (2) (6) (2)
    Геномные виды 3 a

    1 (

    2 (3) (3) (1)
    A.berezinae 10 4 3 (3) 3 (2) (5) 1 1 (2) 3 (2) (1)
    A. radioresistens41 41741

    1 (1)
    A.gyllenbergii 5 3 2 (3) (2)
    off

    off

    ) 2
    А.

    А.ursingii 10 2 (9) 8 (1)
    ri 101736

    ri

    ri 917 ) 7
    A. haemolyticus 10 917

    1 (2)
    А.junii 10 1 2 (3) 2 (2) 1 (1) 3 (3) 1 (1)
    A. parvus 5 (2) 1 2 (1) 1 (2) 1
    9 1 2 (1) 2 (3) (1) 1 3 (2) (2)
    8 3 5 (8)
    Геномные виды 14BJ 1 (1)
    Геномные виды 15BJ 2 1 (11741 936 917) 11741 936

    Геномные виды 16 3 (1) 1 1
    Геномные виды 17 2 1 1 (1) (1)

    Род: Acinetobacter

    Acinetobacter albensis Krizova et al. 2015 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter antiviralis » Lee et al. 2009 опубликовано недействительно
    Acinetobacter apis Kim et al. 2014 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter baretiae Alvarez-Perez et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter baumannii Bouvet and Grimont 1986 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter baylyi Carr et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter beijerinckii Nemec et al. 2009 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter bereziniae Nemec et al. 2010 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter bohemicus Krizova et al. 2015 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter boissieri Álvarez-Pérez et al. 2013 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter bouvetii Carr et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter brisouii Anandham et al. 2011 г. действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter calcoaceticus (Beijerinck 1911) Baumann et al. 1968 г. (утвержденные списки 1980 г.) действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter celticus Radolfova-Krizova et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter chengduensis Qin et al. 2020 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter chinensis Hu et al. 2019 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter colistiniresistens Nemec et al. 2017 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter courvalinii Nemec et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter cumulans Qin et al. 2019 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter defluvii Hu et al. 2017 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter dijkshoorniae Cosgaya et al. 2016 действительно опубликовано в соответствии с ICNP синоним
    Acinetobacter дисперсус Nemec et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter equi Poppel et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter gandensis Smet et al. 2014 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter gerneri Carr et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter grimontii Carr et al. 2003 действительно опубликовано в соответствии с ICNP синоним
    Acinetobacter guangdongensis Feng et al. 2014 действительно опубликовано в соответствии с ICNP синоним
    Acinetobacter guerrae Carvalheira et al. 2020 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter guillouiae Nemec et al. 2010 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter gyllenbergii Nemec et al. 2009 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter haemolyticus ( ex Stenzel and Mannheim 1963) Bouvet and Grimont 1986 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter halotolerans Dahal et al. 2017 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter harbinensis Li et al. 2014 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter idrijaensis » Campos-Guillen et al. 2014 опубликовано недействительно
    Acinetobacter indicus Malhotra et al. 2012 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter johnsonii Bouvet and Grimont 1986 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter junii Bouvet and Grimont 1986 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter kanungonis Das et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter kookii Choi et al. 2013 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter kyonggiensis » Lee and Lee 2010 опубликовано недействительно
    Acinetobacter lactucae Rooney et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter lanii Zhu et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter личинок Liu et al. 2017 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter lwoffii (Audureau 1940) Brisou and Prevot 1954 (утвержденные списки 1980) действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter marinus » Yoon et al. 2007 опубликовано недействительно
    « Acinetobacter mesopotamicus » Acer et al. 2020 опубликовано недействительно
    Acinetobacter modestus Nemec et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter movanagherensis » Moore et al. 2014 опубликовано недействительно
    Acinetobacter nectaris Álvarez-Pérez et al. 2013 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter nosocomialis Nemec et al. 2011 г. действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter oleivorans » Kang et al. 2011 г. опубликовано недействительно
    « Acinetobacter oryzae » Chaudhary et al. 2012 опубликовано недействительно
    Acinetobacter pakistanensis Abbas et al. 2015 действительно опубликовано в соответствии с ICNP синоним
    Acinetobacter parvus Nemec et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    « Candidatus Acinetobacter pediculi» Boumbanda Koyo et al. 2019 опубликовано недействительно
    Acinetobacter piscicola Liu et al. 2018 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter pittii Nemec et al. 2011 г. действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter plantarum » Du et al. 2016 опубликовано недействительно
    Acinetobacter pollinis Alvarez-Perez et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter populi Li et al. 2015 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter portensis Carvalheira et al. 2020 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter pragensis Radolfova-Krizova et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter proteolyticus Nemec et al. 2016 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter pseudolwoffii Nemec et al. 2019 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter pullicarnis » Han et al. 2020 опубликовано недействительно
    « Acinetobacter pullorum » Elnar et al. 2020 опубликовано недействительно
    Acinetobacter puyangensis Li et al. 2013 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter qingfengensis Li et al. 2014 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter radioresistens Nishimura et al. 1988 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter rathckeae Alvarez-Perez et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter Refrigeratorensis » Feng et al. 2014 опубликовано недействительно
    « Acinetobacter Холодильник » Feng et al. 2015 опубликовано недействительно
    « Acinetobacter rongchengensis » Qin et al. 2021 опубликовано недействительно
    Acinetobacter rudis Vaz-Moreira et al. 2011 г. действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter schindleri Nemec et al. 2001 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter seifertii Nemec et al. 2015 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter seohaensis » Yoon et al. 2007 опубликовано недействительно
    « Acinetobacter septicus » Kilic et al. 2008 опубликовано недействительно
    Acinetobacter shaoyimingii Zhu et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter sichuanensis Qin et al. 2018 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter soli Kim et al. 2009 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter stercoris Pulami et al. 2021 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter tandoii Carr et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter terrae » Nemec et al. 2021 опубликовано недействительно
    « Acinetobacter terrestris » Nemec et al. 2021 опубликовано недействительно
    « Acinetobacter tianfuensis » Qin et al. 2021 опубликовано недействительно
    Acinetobacter tjernbergiae Carr et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter towneri Carr et al. 2003 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter ursingii Nemec et al. 2001 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter variabilis Krizova et al. 2015 действительно опубликовано в соответствии с ICNP правильное имя
    Acinetobacter venetianus ( ex Di Cello et al. 1997) Vaneechoutte et al. 2009 действительно опубликовано в соответствии с ICNP правильное имя
    « Acinetobacter venetianus » Di Cello et al.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *