Стоматит по мкб: Ошибка 404. Файл не найден

Содержание

МКБ-10 код K12 | Стоматит и родственные поражения

ICD-10


ICD-10 is the 10th revision of the International Statistical Classification of Diseases and Related Health Problems (ICD), a medical classification list by the World Health Organization (WHO).


It contains codes for diseases, signs and symptoms, abnormal findings, complaints, social circumstances, and external causes of injury or diseases.

ATC

The Anatomical Therapeutic Chemical (ATC) Classification System is used for the classification of active ingredients of drugs according to the organ or system on which they act and their therapeutic, pharmacological and chemical properties.

It is controlled by the World Health Organization Collaborating Centre for Drug Statistics Methodology (WHOCC).

DDD


The defined daily dose (DDD) is a statistical measure of drug consumption, defined by the World Health Organization (WHO).


It is used to standardize the comparison of drug usage between different drugs or between different health care environments.

Международная классификация стоматологических заболеваний

МКБ–С, или международная классификация стоматологических болезней является извлечением МКБ–10 и служит практичной и удобной основой для классификации и кодирования данных всеми специалистами в области заболеваний и нарушений зубов, полости рта и смежных структур.



Инфекционные и паразитарные болезни
  • В00.10 — простой герпес лица
  • В00.11 — простой герпес губы
  • В00.2Х — герпетический гингивостоматит
  • В02.20 — постгерпетическая невралгия тройничного нерва
  • В02.21 — постгерпетическая невралгия других черепных нервов
  • В02.8Х — проявление в полости рта опоясывающего лишая
  • В07 — вирусные бородавки
  • В07.Х0 — простая бородавка полости рта
  • В07.Х1 — остроконечная кондилома полости рта
  • В08 .3Х — эритема инфекционная (пятая болезнь) проявления в полости рта
  • В08.4Х — энтеровирусный везикулярный стоматит
  • В08.5 — герпетическая ангина
  • В20 — ВИЧ
  • В20.0Х — болезнь, вызванная ВИЧ с проявлениями микобактериальной инфекции, проявления в полости рта
  • В20.1Х – болезнь, вызванная ВИЧ с проявлениями других бактериальных инфекций, проявления в полости рта
  • В20.2Х — болезнь, вызванная ВИЧ с проявлениями цитомеговирусного заболевания, проявления в полости рта
  • В20. 3Х — болезнь, вызванная ВИЧ с проявлениями других вирусных инфекций, проявления в полости рта.
  • В20.4Х — болезнь, вызванная ВИЧ с проявлениями кандидоза, проявления в полости рта
  • В37.00 — острый псевдомембранозный кандидозный стоматит
  • В37.01 — острый эритематозный (атрофический) кандидозный стоматит
  • В37.02 — хронический гиперпластический кандидозный стоматит (кандидозная лейкоплакия, множественный тип хронического гиперпластического кандидозного стоматита)
  • В37.03 — хронический эритематозный (атрофический) кандидозный стоматит (стоматит под съемным зубным протезом, вызванный кандидозной инфекцией)
  • В37.04 — кожно-слизистый кандидоз
  • В37.05 — кандидозная гранулема полости рта
  • В37.06 — ангулярный хейлит
  • В37.08 — другие уточненные проявления в полости рта
  • В37.09 — проявления в полости рта неуточненные (кандидозный стоматит БДУ молочница БДУ)
  • В75.VХ — трихинеллез проявления в полости рта

Новообразования
  • С00 — злокачественное новообразование губы
  • С43. 0 — злокачественное новообразование кожи губы меланома
  • С44.0 — злокачественное новообразование кожи губы
  • С00.0Х — злокачественное новообразование наружной поверхности красной каймы верхней губы
  • С00.1Х — злокачественное новообразование наружной поверхности красной каймы нижней губы
  • С01 — злокачественное новообразование основания языка (верхней поверхности основания языка задней трети языка)
  • С02 — злокачественное новообразование других и неуточненных частей языка
  • С03 — злокачественное новообразование десны (слизистой оболочки альвеолярного отростка десны)
  • С04 — злокачественное новообразование дна полости рта
  • С05 — злокачественное новообразование неба
  • С06.0 — злокачественное новообразование слизистой оболочки щеки
  • С06.1 — злокачественное новообразование преддверия рта
  • С06.2 — злокачественное новообразование ретромолярной области
  • С07 — злокачественное новообразование околоушной слюнной железы
  • С08 — злокачественное новообразование других и неуточненных больших слюнных желез
  • С31 — злокачественное новообразование придаточных пазух
  • С01 — злокачественное новообразование основания языка (верхней поверхности основания языка задней трети языка)
  • С02 — злокачественное новообразование других и неуточненных частей языка
  • С03 — злокачественное новообразование десны (слизистой оболочки альвеолярного отростка десны)
  • С04 — злокачественное новообразование дна полости рта
  • С05 — злокачественное новообразование неба
  • С06. 0 — злокачественное новообразование слизистой оболочки щеки
  • С06.1 — злокачественное новообразование преддверия рта
  • С06.2 — злокачественное новообразование ретромолярной области
  • С07 — злокачественное новообразование околоушной слюнной железы
  • С08 — злокачественное новообразование других и неуточненных больших слюнных желез
  • С31 — злокачественное новообразование придаточных пазух

Новообразования in situ
  • D00 — карцинома in situ полости рта
  • D00.00 — слизистой оболочки и красной каймы губы
  • D00.01 — слизистой оболочки щеки
  • D00.02 — десны и альвеолярного гребня при адентии
  • D00.03 — неба
  • D00.04 — дна полости рта

Доброкачественные новообразования
  • D10.0 — доброкачественное образование губы
  • D10.1 — доброкачественное образование языка
  • D10.2 — дна полости рта
  • D10.30 — слизистой оболочки щеки
  • D10.31 — слизистой оболочки щеки по линии смыкания
  • D10. 32 — щечной борозды
  • D10.33 — десны и альвеолярного гребня при адентии врожденный эпулис
  • К06.82 — фиброзный эпулис
  • К06.81 — гигантоклеточная периферическая гранулема
  • О26.8 – гранулема, связанная с беременностью
  • D10.34 — твердого неба соединения (границы) твердого и мягкого неба
  • D10.35 — мягкого неба
  • D10.37 — ретромолярной области
  • D10.38 — верхнечелюстного бугра

Доброкачественное образование больших слюнных желез
  • D11.0 — околоушной слюнной железы
  • D11.70 — поднижнечелюстной железы
  • D11.71 — подъязычной железы
  • D11.9 — большой слюнной железы неуточненное
  • К10. 88 — экзостоз челюсти
  • К10.80 — херувизм
  • К10.83 — фиброзная дисплазия челюсти
  • К10.1 — гигантоклеточная гранулема
  • К10.00 — торусы челюсти
  • D16.4 — костей и черепа
  • D16.5 — нижней челюсти костной части
  • D17.0 — доброкачественное новообразование жировой ткани кожи и подкожной клетчатки головы, лица и шеи
  • D18. 0Х — гемангиома любой локализации проявления в полости рта
  • D18.1Х — лимфангиома проявления в полости рта
  • D22. — меланоформный невус
  • Е14.ХХ — сахарный диабет проявления в полости рта

Болезни нервной системы
  • G40.VX — эпилепсия проявления полости рта
  • G50 — поражение тройничного нерва
  • G50.0 — невралгия тройничного нерва (болезненный тик)
  • G50.1 — атипичная лицевая боль
  • G50.8 — другие поражения тройничного нерва
  • G50.9 — поражения тройничного нерва неуточненные
  • G51- поражение лицевого нерва
  • G52.1Х — языкоглоточная невралгия
  • G52 — поражения подъязычного нерва

Болезни системы кровообращения
  • I78.0 — наследственная геморрагическая телеангиэктазия
  • I86.0 — варикозное расширение подъязычных вен
  • I88 — неспецифический лимфаденит

Болезни органов дыхания
  • J01 — острый синусит
  • J01.0 — острый верхнечелюстной синусит
  • J01. 1 — острый фронтальный синусит
  • J03 — острый тонзиллит
  • J10 — грипп
  • J32 — хронический синусит
  • J32.0 — хронический верхнечелюстной синусит
  • J35.0 — хронический тонзиллит
  • J36 — перитонзилярный абсцесс

Болезни органов пищеварения
К00 — нарушения развития и прорезывания зубов
  • К00.0 — адентия
  • К00.00 — частичная адентия (гиподентия) (олигодентия)
  • К00.01 — полная адентия
  • К00.09 — адентия неуточненная
  • К00.1 — сверхкомплектные зубы
  • К00.10 — областей резца и клыка мезиодентия (срединный зуб)
  • К00.11 — области премоляров
  • К00.12. — области моляров дистомолярный зуб, четвертый моляр, парамолярный зуб
  • К00.19 — сверхкомплектные зубы неуточненные
  • К00.2 — аномалии размеров и формы зубов
  • К00.20 — макродентия
  • К00.21 — микродентия
  • К00.22. — сращение
  • К00.23 — слияние (синодентия) и раздвоение (шизодентия)
  • К00. 24 — выпячивание зубов (добавочные окклюзионные бугорки)
  • К00.25 — инвагинированный зуб (зуб в зубе) (дилатированная одонтома)
  • К00.26 — премоляризация
  • К00.27 — аномальные бугорки и эмалевые жемчужины (адамантома)
  • К00.28 — бычий зуб (тауродонтизм)
  • К00.29 — другие и неуточненные аномалии размеров и формы зубов
К00.3 — крапчатые зубы
  • К00.30 — эндемическая (флюорозная) крапчатость эмали (флюороз зубов)
  • К00.31 — неэндемическая крапчатость эмали (нефлюорозное потемнение эмали )
  • К00.39 — крапчатые зубы неуточненные
К00.4 — нарушение формирования зубов
  • К00.40 — гипоплазия эмали
  • К00. 41 — перинатальная гипоплазия эмали
  • К00.42 — неонатальная гипоплазия эмали
  • К00.43 — аплазия и гипоплазия цемента
  • К00.44. — дилацеразия (трещины эмали )
  • К00.45 — одонтодисплазия (региональная одонтодисплазия)
  • К00.46 — зуб Тернера
  • К00.48 — другие уточненные нарушения формирования зубов
  • К00. 49 — нарушения формирования зубов неуточненные
К00.5 — наследственные нарушения структуры зуба, не классифицированные в других рубриках
  • К00.50 — незавершенный амелогенез
  • К00.51 — незавершенный дентиногенез
  • К00.52 — незавершенный одонтогенез
  • К00.58 — другие наследственные нарушения структуры зуба (дисплазия дентина, раковидные зубы)
  • К00 59 — наследственные нарушения структуры зуба неуточненные
К00.6 — нарушения прорезывания зубов
  • К00.60 — натальные (прорезавшие к моменту рождения) зубы
  • К00.61 — неонатальные (у новорожденного, прорезавшиеся преждевременно) зубы
  • К00.62 — преждевременное прорезывание (раннее прорезывание)
  • К00.63 — задержка (персистентная) смены первичных (временных) зубов
  • К00.64 — позднее прорезывание
  • К00.65 — преждевременное выпадение первичных (временных) зубов
  • К00.68 — другие уточненные нарушения прорезывания зубов
  • К00.69 — нарушение прорезывания зубов неуточненные
  • К00. 7 — синдром прорезывания зубов
  • К00.8 — другие нарушения развития зубов
  • К00.80 — изменение цвета зубов в процессе формирования вследствие несовместимости групп крови
  • К00.81 — изменение цвета зубов в процессе формирования вследствие врожденного порока билиарной системы
  • К00.82 — изменение цвета зубов в процессе формирования вследствие порфирии
  • К00.83 — изменение цвета зубов в процессе формирования вследствие применения тетрациклина
  • К00.88 — другие уточненные нарушения развития зубов
  • К00.9 — нарушение развития зубов неуточненные
К01 — ретенированные и импактные зубы
  • К07.3- ретенированные и импактные зубы с неправильным положением их или соседних зубов
  • К01.0 — ретенированные зубы (изменивший свое положение при прорезывании без препятствия со стороны соседнего зуба)
  • К01.1 — импактные зубы (изменивший свое положение при прорезывании из-за препятствия со стороны соседнего зуба)
  • К01. 10 — резец верхней челюсти
  • К01.11 — резец нижней челюсти
  • К01.12 — клык верхней челюсти
  • К01.13 — клык нижней челюсти
  • К01.14 — премоляр верхней челюсти
  • К01 15. — моляр верхней челюсти
  • К01.17 — моляр нижней челюсти
  • К01.18 — сверхкомплектный зуб
  • К01.19 — импактный зуб неуточненный
К02 — кариес зубов
  • К02.0 — кариес эмали стадия белого (мелового) пятна (начальный кариес)
  • К02.1 — кариес дентина
  • К02.2 — кариес цемента
  • К02.3 — приостановившийся кариес зубов
  • К02.4 — одонтоклазия детская меланодентия, меланодонтоклазия
  • К02.8 — другой уточненный кариес зубов
  • К02.9 — кариес зубов неуточненный
К03 — другие болезни твердых тканей зубов
  • F45.8 — бруксизм
  • К03.0 — повышенное стирание зубов
  • К03.00 — окклюзионное
  • К03.01 — апроксимальное
  • К03.08 — другое уточненное стирание зубов
  • К03.09 — стирание зубов неуточненное
К03.

1 — сошлифовывание (абразивный износ) зубов

  • К03.10 — вызванное зубным порошком (клиновидный дефект БДУ)
  • К03.11 — привычное
  • К03.12 — профессиональное
  • К03.13 — традиционное (ритуальное)
  • К03.18 – другое уточненное сошлифовывание зубов
  • К03.19 – сошлифовывание зубов неуточненное
К03.2 — эрозия зубов
  • К03.20 — профессиональная
  • К03.21 — обусловленная персистирующей регургитацией или рвотой
  • К03.22 — обусловленная диетой
  • К03.23 — обусловленная лекарственными средствами и медикаментами
  • К03.24 — идиопатическая
  • К03.28 — другая уточненная эрозия зубов
  • К03.29 — эрозия зубов неуточненная
К03.3 — патологическая резорбция зубов
  • К03.30 — внешняя (наружная)
  • К03.31 — внутренняя (внутренняя гранулема) (розовое пятно)
  • К03.39 — патологическая резорбция зубов неуточненная
  • К03.4 — гиперцементоз
  • К03.5 — анкилоз зубов
К03.

6 — отложения (наросты) на зубах

  • К03.60 — пигментированый налет (черный, зеленый, оранжевый)
  • К03.61 — обусловленные привычкой употреблять табак
  • К03.61 — обусловленные привычкой жевать бетель
  • К03.63 — другие обширные мягкие отложения (белые отложения)
  • К03.64 — наддесневой зубной камень
  • К03.65 — поддесневой зубной камень
  • К03.66 — зубной налет
  • К03.68 — другие уточненные отложения на зубах
  • К03.69 — отложения на зубах неуточненные
К03.7 — изменения цвета твердых тканей зубов после прорезывания
  • К03.70 — обусловленные наличием металлов и металлических соединений
  • К03.71 — обусловлены кровоточивостью пульпы
  • К03.72 — обусловлены привычкой жевать бетель
  • К03.78 — другие уточненные изменения цвета
  • К03.79 — изменения цвета неуточненные
К03.8 — другие уточненные болезни твердых тканей зубов
  • К03.80 — чувствительный дентин
  • К03. 81 — изменение эмали, обусловленные облучением
  • К03.88 — другие уточненные болезни твердых тканей зубов
  • К03.9 — болезнь твердых тканей зубов неуточненная
  • К04 — болезни пульпы и периапикальных тканей
К04.0 — пульпит
  • К04.00 — начальный (гиперемия)
  • К04.01 — острый
  • К04.02 — гнойный (пульпарный абсцесс)
  • К04.03 — хронический
  • К04.04 — хронический язвенный
  • К04.05 — хронический гиперпластический (пульпарный полип)
  • К04.08 — другой уточненный пульпит
  • К04.09 — пульпит неуточненный
  • К04.1 — некроз пульпы (гангрена пульпы)
  • К04.2 — дегенерация пульпы дентикли, пульпарные кальцификации, пульпарные камни
  • К04.3 — неправильное формирование твердых тканей в пульпе
  • К04.4 острый апикальный периодонтит пульпарного происхождения
  • К04.5 хронический апикальный периодонтит (апикальная гранулема)
К04.6 периапикальный абсцесс со свищем (дентальный абсцесс, дентоальвеолярный абсцесс, периодонтальный абсцесс пульпарного происхождения)
  • К04. 60 — имеющий сообщение (свищ) с верхнечелюстной пазухой
  • К04.61 — имеющий сообщение (свищ) с носовой полостью
  • К04.62 — имеющий сообщение (свищ) с полостью рта
  • К04.63 — имеющий сообщение (свищ) с кожей
  • К04.69 — периапикальный абсцесс со свищем неуточненный
  • К04.7 — периапикальный абсцесс без свища (дентальный абсцесс, дентоальвеолярный абсцесс, периодонтальный абсцесс пульпарного происхождения)
К04.8 — корневая киста (апикальная (периодонтальная), периапикальная)
  • К04.80 — апикальная и боковая
  • К04.81 — остаточная
  • К04.82 — воспалительная парадентальная
  • К09.04 — образовавшаяся в процессе формирования зубов боковая киста периодонтальная
  • К04.89 — корневая киста неуточненная
  • К04.9 — другие неуточненные болезни пульпы и периапикальных тканей
К05 — гингивит и болезни пародонта
  • К05.0 — острый гингивит
  • К05.22 — острый перикоронит
  • А69.10 — острый нектротический язвенный гингивит (фузоспирохетозный гингивит, гингивит Венсана)
  • К05. 00 — острый стрептококковый гингивостоматит
  • К05.08 — другой уточненный острый гингивит
  • К05.09 — острый гингивит неуточненный
К05.1 — хронический гингивит
  • К05.10 — простой маргинальный
  • К05.11 — гиперпластический
  • К05.12 — язвенный
  • К05.13 — десквамативный
  • К05.18 — другой уточненный хронический гингивит
  • К05.19 — хронический гингивит неуточненный
К05.2 — острый парадонтит
  • К05.20 — парадонтальный абсцесс (периодонтальный абсцесс) десневого происхождения без свища
  • К05.21 — периодонтальный абсцесс (пародонтальный абсцесс) десневого происхождения со свищем
  • К05.28 — другой уточненный острый пародонтит
  • К05.29 — острый пародонтит неуточненный
К05.3 — хронический пародонтит
  • К05.30 — локализованный
  • К05.31 — генерализованный
  • К05.32 — хронический перикоронит
  • К05.33 — утолщенный фолликул (гипертрофия сосочка)
  • К05. 38 — другой уточненный хронический пародонтит
  • К05.39 — хронический пародонтит неуточненный
  • К05.4 — пародонтоз
  • К05.5 — другие болезни пародонта
К06 — другие изменения десны и беззубого альвеолярного края
  • К08.2 — атрофия беззубого альвеолярного края
К06.0 — рецессия десны (включены постинфекционная, послеоперационная)
  • К06.00 — локальная
  • К06.01 — генерализованная
  • К06.09 — рецессия десны неуточненная
К06.1 — гипертрофия десны
  • К06.10 — фиброматоз десны
  • К06.18 — другая уточненная гипертрофия десны
  • К06.19 — гипертрофия десны неуточненная
К06.2 — поражения десны и беззубого альвеолярного края, обусловленные травмой
  • К06.20 — обусловленные травматической окклюзией
  • К06.21 — обусловленные чисткой зубов щеткой
  • К06.22 — фрикционный (функциональный) кератоз
  • К06.23 — гиперплазия вследствие раздражения (гиперплазия связанная с ношением съемного протеза)
  • К06. 28 — другие уточненные поражения десны и беззубого альвеолярного края, обуслословленные травмой
  • К06.29 — неуточненные поражения десны и беззубого альвеолярного края, обусловленные травмой
К06.8 — другие уточненные изменения десны и беззубого альвеолярного края
  • К06.80 — киста десны взрослых
  • К06.81 — гигантоклеточная периферическая гранулема (гигантоклеточный эпулис)
  • К06 82 — фиброзный эпулис
  • К06.83 — пиогенная гранулема
  • К06.84 — атрофия гребня частичная
  • К06.88 — другие изменения
  • К06.9 — изменения десны и беззубого альвеолярного края неуточненные
К07 — челюстно-лицевые аномалии (включая аномалии прикуса)
  • К07.0 — основные аномалии размеров челюстей
  • Е22.0 — акромегалия
  • К10.81 — односторонняя мыщелковая гиперплазия
  • К10.82 — односторонняя мыщелковая гипоплазия
  • К07.00 — макрогнатия верхней челюсти
  • К07.01 — макрогнатия нижней челюсти
  • К07. 02 — макрогнатия обеих челюстей
  • К07.03 — микрогнатия верхней челюсти (гипоплазия верхней челюсти)
  • К07.04 — микрогнатия нижней челюсти (гипоплазия н/ч)
  • К07 08 — другие уточненные аномалии размеров челюстей
  • К07.09 — аномалии размеров челюстей неуточненные
К07.1 — аномалии челюстно-черепных соотношений
  • К07.10 — ассиметрии
  • К07.11 — прогнатия н/ч
  • К07.12 — прогнатия в/ч
  • К07.13 — ретрогнатия н/ч
  • К07.14 — ретрогнатия в/ч
  • К07.18 — другие уточненные аномалии челюстно-черепных соотношений
  • К07.19 — аномалии челюстно-черепных соотношений неуточненная
К07.2 — аномалии соотношения зубных дуг
  • К07.20 — дистальный прикус
  • К07.21 — мезиальный прикус
  • К07.22 — чрезмерно глубокий горизонтальный прикус (горизонтальное перекрытие)
  • К07.23 — чрезмерно глубокий вертикальный прикус (вертикальное перекрытие)
  • К07.24 — открытый прикус
  • К07. 25 — перекрестный прикус (передний, задний)
  • К07.26 — смещение зубных дуг от средней линии
  • К07.27 — заднеязычный прикус нижних зубов
  • К07.28 — другие уточненные аномалии соотношений зубных дуг
  • К07.29 — аномалии соотношений зубных дуг неуточненные
К07.3 — аномалии положения зубов
  • К07.30 — скученность (черепицеобразное перекрытие)
  • К07.31 — смещение
  • К07.32 — поворот
  • К07.33 — нарушение межзубных промежутков (диастема)
  • К07.34 — транспозиция
  • К07.35 — ретенированные или импактные зубы с неправильным положением их или соседних зубов
  • К07.38 — другие уточненные аномалии положения зубов
  • К07.39 — аномалии положения зубов неуточненные
  • К07.4 — аномалии прикуса неуточненные
  • К07.5 — челюстно – лицевые аномалии функционального происхождения
  • К07 50 — неправильное смыкание челюстей
  • К07.51 — нарушение прикуса вследствие нарушения глотания
  • К07. 54 — нарушение прикуса вследствие ротового дыхания
  • К07.55 — нарушение прикуса вследствие сосания языка, губ или пальца
  • К07.58 — другие уточненные челюстно-лицевые аномалии функционального происхождения
  • К07.59 — челюстно – лицевая аномалия функционального происхождения неуточненная
К07.6 — болезни ВЧНС
  • К07.60 — синдром болевой дисфункции ВНЧС (синдром Костена)
  • К07.61 — «щелкающая» челюсть
  • К07.62 — рецидивирующий вывих и подвывих ВНЧС
  • К07.63 — боль в ВНЧС не квалифицированная в других рубриках
  • К07.64 — тугоподвижность ВНЧС не квалифицированная в других рубриках
  • К07.65 — остеофит ВНЧС
  • К07.68 — другие уточненные болезни
  • К07.69 — болезнь ВНЧС неуточненная
К08 — другие изменения зубов и их опорного аппарата
  • К08.1 — потеря зубов вследствие несчастного случая, удаления или локализованного пародонтита
  • S03.2 — вывих зуба
  • К08.2 — атрофия беззубого альвеолярного края
  • К08. 3 — оставшийся корень зуба
  • К08.8 — другие уточненные изменения зубов и их опорного аппарата
  • К08.80 — зубная боль БДУ
  • К08.81 — неправильная форма альвеолярного отростка
  • К08.82- гипертрофия альвеолярного края БДУ
  • К08.88 — другие изменения
  • К08.9 — изменения зубов и их опорного аппарата неуточненное
К09 — кисты области рта, не классифицированные в других рубриках
  • К04.8 — корневая киста
  • К11.6 — мукоцеле слюнной железы
  • К09.00 — киста при прорезывании зубов
  • К09.01- киста десны
  • К09.02 — роговая (первичная) киста
  • К09.03 — фолликулярная (одонтогенная) киста
  • К09.04 — боковая периодонтальная киста
  • К09.08 — другие уточненные одонтогенные кисты, образовавшиеся в процессе формирования зубов
  • К09.09 — одонтогенная киста, образовавшаяся в процессе формирования зубов неуточненная
К09.1 — ростовые (неодонтогенные) кисты области рта
  • К09. 10 — глобуломаксиллярная (верхнечелюстной пазухи) киста
  • К09.11 — средненебная киста
  • К09.12 — носонебная (резцового канала) киста
  • К09.13 — небная сосочковая киста
  • К09.18 — другие уточненные ростовые кисты области рта
  • К09.19 — ростовая киста области рта неуточненная
К09.2 — другие кисты челюстей
  • К09.20 — аневризматическая костная киста
  • К09.21 — единая костная (травматическая, геморрагическая) киста
  • К09.22 — зпителиальные кисты челюсти, не индентифицированные как одонтогенные или неодонтогенные
  • К09.28 — другие уточненные кисты челюсти
  • К09.29 — киста челюсти неуточненная
К10 — другие болезни челюстей
  • К10.0 — нарушения развития челюстей
  • К10.00 — торус нижней челюсти
  • К10.01 — торус твердого неба
  • К10.02 — скрытая костная киста
  • К10.08 — другие уточненные нарушения развития челюстей
  • К10.09 — нарушения развития челюстей неуточненные
  • К10. 1 — гигантоклеточная гранулема центральная
К10.2 — воспалительные заболевания челюстей
  • К10.20 — остеит челюсти
  • К10.3 — альвеолит челюстей альвеолярный остеит, сухая лунка
  • К10.21 — остеомиелит челюсти
  • К10.22 — периостит челюсти
  • К10.23 — хронический периостит челюсти
  • К10.24 — неонатальный остеомиелит верхней челюсти
  • К10.25 — секвестр
  • К10.26 — радиационный остеонекроз
  • К10.28 — другие уточненные воспалительные заболевания челюстей
  • К10.29 — воспалительное заболевание челюстей неуточненное
К10.8 — другие уточненные болезни челюстей
  • К10.80 — херувизм
  • К10.81 — односторонняя гиперплазия мыщелкового отростка н/ч
  • К10.82 — односторонняя гипоплазия мыщелкового отростка н/ч
  • К10.83 — фиброзная дисплазия челюсти
  • К10.88 — другие уточненные болезни челюстей, экзостоз челюсти
К11 — болезни слюнных желез
  • К11.0 — атрофия слюнной железы
  • К11. 1 — гипертрофия слюнной железы
  • К11.2 — сиалоадеит
  • К11.3 — абсцесс слюнной железы
  • К11.4 — свищ слюнной железы
  • К11.5 — сиалолитиаз, камни в слюнном протоке
  • К11.6 — мукоцеле слюнной железы ,ранула
  • К11.60 — слизистая ретенционная киста
  • К11.61 — слизистая киста с экссудатом
  • К11.69 — мккоцеле слюнной железы неуточненное
К11.7 — нарушение секреции слюнных желез
  • К11.70 — гипосекреция
  • М35.0 — синдром Шегрена
  • К11.71 — ксеростомия
  • К11.72 — гиперсекреция (птиализм)
  • К11.78 — другие уточненные нарушения секреции слюнных желез
  • К11.79 — нарушение секреции слюнных желез неуточненные
К11.8 — другие болезни слюнных желез
  • К11.80 — доброкачественное лимфоэпителиальное поражение слюнной железы
  • К11.81- болезнь Микулича
  • К11.82 — стеноз (сужение) слюнного протока
  • К11 83 — сиалэктазия
  • К11.84 — сиалоз
  • К11. 85 — некротизирующая сиалометаплазия
К12 — стоматит и родственные поражения
  • А69.0 — острый гангренозный
  • L23.0 — аллергический
  • В37.0 — кандидозный
  • К12.14 — контактный
  • В34.1 — вызванный вирусом Коксаки
  • Т36-Т50 — медикоментозный
  • В37.0 — микотический
  • К13.24 — никотиновый
  • В08.4 — везикулярный с экзантемой
  • К05.00 — стрептококковый гингивостоматит
К12.0 — рецидивирующие афты полости рта
  • К12.00 — резидивирующие (малые) афты, афтозный стоматит, язвенное поражение, афты Микулича, малые афты, рецидивирующие афтозные язвы.
  • К12.01 — рецидивирующий слизисто-некротический периаденит, рубцующийся афтозный стоматит, большие афты, афты Саттона
  • К12.02 — герпетиформный стоматит (герпетиформная сыпь)
  • К12.03 — афты Бернара
  • К12.04 — травматическое изъязвления
  • К12.08 — другие уточненные рецидивирующие афты полости рта
  • К12.09 — рецидивирующие афты полости рта неуточненные
К12.

1 — другие формы стоматита

  • К12.10 — стоматит артефициальный
  • К12.11 — географический стоматит
  • К14.1 — географический язык
  • К12.12 — стоматит, связанный с ношением зубного протеза
  • В37.03 — кандидозный стоматит, связанный с ношением зубного протеза
  • К12.04 — травматическое изъязвление, связанное с ношением зубного протеза
  • К12.13 — папиллярная гиперплазия неба
  • К12.14 — контактный стоматит, стоматит «ватного валика»
  • К12.18 — другие уточненные формы стоматита
  • К12.19 — стоматит неуточненный
К12.2 — флегмона и абсцесс области рта
  • К04.6-К04.7 — периапикальный абсцесс
  • К05.21 — периодонтальный абсцесс
  • J36 — перитонзилярный абсцесс
  • К11.3 — абсцесс слюнной железы
  • К14.00 — абсцесс языка
  • К13 — другие болезни губ и слизистой оболочки полости рта
К13.0 — болезни губ
  • L56.8Х — актинический хейлит
  • Е53.0 — арибофлавиноз
  • К13. 00 — ангулярный хейлит, трещина спайки губ (заеда)
  • В37.0 — заеда вследствие кандидоза
  • Е53.0 — заеда в следствии недостаточности рибофлавина
  • К13.01 — хейлит гранулярный апостематозный
  • К13.02 — хейлит эксфолиативный
  • К13 03 — хейлит БДУ
  • К13.04 — хейлодиния
  • К13.08 — другие уточненные болезни губ
  • К13.09 — болезнь губ неуточненная
  • К13.1 — прикусывание щеки и губ
К13.2 — лейкоплакия и другие изменения эпителия полости рта, включая язык
  • В37.02 — кандидозная лейкоплакия
  • В07.Х2 — очаговая эпителиальная гиперплазия
  • К06.22 — фрикционный кератоз
  • К13.3 — волосатая лейкоплакия
  • К13.20 — лейкоплакия идиопатическая
  • К12.21 – лейкоплакия, связанная с употреблением табака
  • К13.24 — никотиновый лейкокератоз неба
  • К13.24 — небо курильщика
  • К13.22 — эритроплакия
  • К13.23 — лейкодема
  • К13.28 — другие изменения эпителия
  • К13. 29 — неуточненные изменения эпителия
К13.4 — гранулема и гранулемоподобные поражения СОПР
  • К13.40 — пиогенная гранулема
  • К13.41 — эозинофильная гранулема СОПР
  • D76.00 — эозинофильная гранулема кости
  • К13.42 — веррукозная ксантома
  • К13.5 — подслизистый фиброз полости рта
  • К13.6 — гиперплазия СОПР вследствие раздражения
  • К06.23 — гиперплазия, связанная с ношением съемного протеза
  • К13.7 — другие и неуточненные поражения СОПР
  • К13.70 — избыточная меланиновая пигментация, меланоплакия, меланоз курильщика
  • К13.71 — свищ полости рта
  • Т81.8 — ороантральный свищ
  • К13.72 — добровольная татуировка
  • К13.73 — очаговый муциноз полости рта
  • К13.78 — другие уточненные поражения СОПР, белая линия
  • К13.79 — поражения СОПР неуточненные
К14 — болезни языка
  • К14.0 — глоссит
  • К14.42 — атрофический глоссит
  • К14.00 — абсцесс языка
  • К14. 01 — травматическое изъязвление языка
  • К14.08 — другие уточненные глосситы
  • К14.09 — глоссит неуточненный
  • К14.1 — географический язык, эксфолиативный глоссит
  • К14.2 — срединный ромбовидный глоссит
  • К14.3 — гипертрофия сосочков языка
  • К14.30 — обложенный язык
  • К14.31 — «волосатый» язык
  • К14.38 — волосатый язык вследствие приема антибиотиков
  • К14.32 — гипертрофия листовидных сосочков
  • К14.38 — другая уточненная гипертрофия сосочков языка
  • К14.39 — гипертрофия сосочков неуточненная
  • К14.4 — атрофия сосочков языка
  • К14.40 — вызванная привычками очищать язык
  • К14.41 — вызванная системными нарушениями
  • К14.48 — другая уточненная атрофия сосочков языка
  • К14.49 — атрофия сосочков языка неуточненная
  • К14.5 — складчатый, морщинистый, бороздчатый, расщепленный язык
  • К14.6 — глоссодиния
  • К14.60 — глоссопироз (жжение в языке)
  • К14.61 — глоссодиния (боль в языке)
  • R43 — нарушение вкусовой чувствительности
  • К14. 68 — другая уточненная глоссодиния
  • К14.8 — глоссодиния неуточненная
  • К14.8 — другие болезни языка
  • К14.80 — зубчатый язык (язык с отпечатками зубов)
  • К14.81 — гипертрофия языка
  • К14.82 — атрофия языка
  • К14.88 — другие уточненные болезни языка
  • К14.9 — болезнь языка неуточненная
  • К50 — болезнь Крона (региональный энтерит) проявления в полости рта
  • L02 — абсцесс кожи, фурункул и карбункул
  • L03 — флегмона
  • К12.2Х — флегмона рта
  • L03.2 — флегмона лица
  • L04 — острый лимфаденит
  • I88.1 — хронический лимфаденит
  • L08 — другие местные инфекции кожи и подкожной клетчатки
  • L08.0 — пиодермия
L10 — пузырчатка
  • L10.0Х — пузырчатка обыкновенная, проявления в полости рта
  • L10.1 — пузырчатка вегетирующая
  • L10.2 — пузырчатка листовидная
  • L10.5 — пузырчатка вызванная лекарственными средствами
  • L12 — пемфигоид
  • L13 — другие буллезные изменения
  • L23 — аллергический контактный дерматит
  • L40 — псориаз
  • L40. 0 — псориаз обыкновенный
  • L42 — питириаз розовый
  • L43 — лишай красный плоский
  • L43.1 — лишай красный плоский буллезный
L43.8 — другой красный плоский лишай
  • L43.80 — проявления КПЛ папулезные в полости рта
  • L43.81 — проявления КПЛ ретикулярные в полости рта
  • L43.82 — проявления КПЛ атрофические и эрозивные в полости рта
  • L43.83 — проявления КПЛ (типичные бляшки) в полости рта
  • L43.88 — проявления КПЛ уточненные в полости рта
  • L43.89 — проявления КПЛ неуточненные в полости рта
  • L51 — эритема многоформная
  • L51.0 — небуллезная эритема многоформная
  • L51.1 — буллезная эритема многоформная
  • L51.9 — эритема многоформная неуточненная
  • L71 — розацеа
  • L80 — витилиго
  • L81 — другие нарушения пигментации
  • L82 — себорейный кератоз
  • L83 — акантоз негроидный
  • L90 — атрофические поражения кожи
  • L91.0 — келоидный рубец
  • L92. 2 — гранулема лица (эозинофильная гранулема кожи)
  • L92.3 — гранулема кожи и подкожной клетчатки, вызванная инородным телом
  • L93 — красная волчанка
  • L93.0 — дискоидная красная волчанка
  • L94.0 — локализованная склеродермия
  • L98.0 — пиогенная гранулема

Инфекционные артропатии
  • М00 — пиогенный артрит
  • М02 — реактивные артропатии
  • М00.3Х — болезнь Рейтера ВНЧС

Воспалительные полиартропатии
  • М05 — серопозитивный ревматоидный артрит
  • М08 — юношеский (ювенальный) артрит
  • М12.5Х — травматическая артропатия ВНЧС
  • М13 — другие артриты
  • М13.9 — артрит неуточненный

Артрозы
  • М15 — полиартроз
  • М19.0Х — первичный артроз ВНЧС
  • М35.0Х — синдром сухости (синдром Шегрена) проявление в полости рта
  • М79.1 — миалгия
  • М79.2 Х — невралгия и неврит неуточненные головы и шеи
  • М79.5 — остаточное инородное тело в мягких тканях
  • М80. VХ — остеопороз с патологическим переломом челюстей
  • М84.0Х — плохое срастание перелома головы и шеи
  • М84.1Х — несрастание перелома (псевдоартроз) головы и шеи
  • М84.2 Х — замедленное сращение перелома головы и шеи
  • М88 — болезнь Педжета
  • О26.8 — другие уточненные состояния, связанные с беременностью
  • О26.80 — гингивит, связанный с беременностью
  • О26.81 — гранулема, связанная с беременностью
  • О26.88 — другие уточненные проявления в полости рта
  • О26.89 — проявления в полости рта неуточненные

Врожденные аномалии
  • Q85.0 — нейрофиброматоз
  • Q35- Q37- расщелина губы и неба
  • Q75 — врожденные аномалии скуловых и лицевых костей
  • Q18.4 — макростомия
  • Q18.5 — микростомия
  • Q18.6 — макрохейлия
  • Q18.7 — микрохейлия
  • Q21.3Х — тетрада Фалло проявления в полости рта
  • Q38.31 — раздвоение языка
  • Q38.32 — врожденная спайка языка
  • Q38. 33 — врожденная фиссура языка
  • Q38.34 — врожденная гипертрофия языка
  • Q38.35 — микроглоссия
  • Q38.36 — гипоплазия языка
  • Q38.40 — отсутствие слюнной железы или протока
  • Q38.42 — врожденный свищ слюнной железы
  • Q38.51 — высокое небо
  • Q90 — синдром Дауна
  • R06.5 — дыхание через рот (храп)
  • R19.6 — неприятный запах изо рта (зловонное дыхание)
  • R20.0 — анестезия кожи
  • R20.1 — гипестезия кожи
  • R20.2 — парастезия кожи
  • R20.3 — гиперестезия
  • R23.0Х — цианоз проявления в полости рта
  • R23.2 — гиперемия (чрезмерное покраснение)
  • R23.3 — спонтанные экхимозы (перехии)
  • R43 — нарушения обоняния и вкусовой чувствительности
  • R43.2 — парагевзии
  • R47.0 — дисфазия и афазия

Травма
  • S00 — поверхностная травма головы
  • S00.0 — поверхностная травма волосистой части головы
  • S00.1 — ушиб века и подглазничной области (синяк в области глаза)
  • S00. 2 — другие поверхностные травмы века и окологлазничной области
  • S00.3 — поверхностная травма носа
  • S00.4 — поверхностная травма уха
  • S00.50 — поверхностная травма внутренней поверхности щеки
  • S00. 51 — поверхностная травма других областей рта (включая язык)
  • S00.52 — поверхностная травма губы
  • S00.59 — поверхностная травма губы и полости рта неуточненная
  • S00.7 — множественные поверхностные травмы головы
  • S01 — открытая рана головы
  • S01.0 — открытая рана волосистой части головы
  • S01.1 — открытая рана века и окологлазничной области
  • S01.2 — открытая рана носа
  • S01.3 — открытая рана уха
  • S01.4 — открытая рана щеки и височно-нижнечелюстной области
  • S01.5 — открытая рана зубы и полости рта
  • S02.0 — перелом свода черепа
  • S02.1 — перелом основания черепа
  • S02.2 — перелом костей носа
  • S02.3 — перелом дна глазницы
  • S02.40 — перелом альвеолярного отростка верхней челюсти
  • S02. 41 — перелом скуловой кости (дуги)
  • S02.42 — перелом верхней челюсти
  • S02.47 — множественные переломы скуловой кости и верхней челюсти
  • S02.5 — перелом зуба
  • S02.50 — перлом только эмали зуба (откол эмали)
  • S02.51 — перелом коронки зуба без повреждения пульпы
  • S02.52 — перелом коронки зуба без повреждения пульпы
  • S02.53 — перелом корня зуба
  • S02.54 — перелом коронки и корня зуба
  • S02.57 — множественные переломы зубов
  • S02.59 — перелом зуба неуточненный
  • S02.6 — перелом нижней челюсти
  • S02.60 — перелом альвеолярного отростка
  • S02.61 — перелом тела нижней челюсти
  • S02.62 — перелом мыщелкового отростка
  • S02 63 — перелом венечного отростка
  • S02.64 — перелом ветви
  • S02.65 — перелом симфиза
  • S02.66 — перелом угла
  • S02.67 — множественные переломы нижней челюсти
  • S02.69 — перелом нижней челюсти неуточненной локализации
  • S02.7 — множественные переломы костей черепа и лицевых костей
  • S02. 9 — перелом неуточненной части костей черепа и лицевых костей
  • S03 — вывих, растяжение и перенапряжение суставов с связок головы
  • S03.0 — вывих челюсти
  • S03.1 — вывих хрящевой перегородки носа
  • S03.2 — вывих зуба
  • S03.20 — люксация зуба
  • S03.21 — интрузия или экструзия зуба
  • S03.22 — вывих зуба (экзартикуляция)
  • S03.4 — растяжение и перенапряжение сустава (связок) челюсти
  • S04 — травма черепных нервов
  • S04.3 — травма тройничного нерва
  • S04.5 — травма лицевого нерва
  • S04.8 — травма других черепных нервов
  • S04.9 — травма черепного нерва неуточненного
  • S07.0 — размозжение лица
  • S09.1 — травма мышц и сухожилий головы
  • S10 — поверхностная травма шеи
  • S11 — открытая травма шеи
  • Т18.0 — инородное тело во рту
  • Т20 — термические и химические ожоги головы и шеи
  • Т28.0 — термический ожог рта и глотки
  • Т28.5 — химический ожог рта и глотки
  • Т33 — поверхностное отморожение
  • Т41 — отравление анестезирующими средствами
  • Т49. 7 — отравление стоматологическими препаратами, применяемые местно
  • Т51 — токсическое действие алкоголя
  • Т57.0 — токсическое действие мышьяка и его соединений
  • Т78.3 — ангионевротический отек (гигантская крапивница, отек Квинке)
  • Т78.4 — аллергия неуточненная
  • Т88 — шок вызванный анестезией
  • Т81.0 — кровотечение и гематома, осложняющие процедуру, неквалифицированную
  • Т81.2 — случайный прокол или разрыв при выполнении процедуры (случайная перфорация)
  • Т81.3 — расхождение краев операционной раны,
  • Т81.4 – инфекция, связанная с процедурой, не классифицированная в других рубриках
  • Т81.8 — процедуры эмфизема (подкожная) вследствие процедуры
  • Т84.7 — инфекция и воспалительная реакция обусловленные внутренними ортопедическими протезными устройствами, имплантатами трансплантатами
  • Y60 — случайный порез, укол.перфорация или кровотечение при выполнении хирургической и терапевтической процедур
  • Y60. 0 — при проведении хирургической операции
  • Y61 — случайное оставление инородного тела в организме при выполнении хирургической и терапевтической процедур
  • Y61.0 — при проведении хирургической операции

Угловой стоматит — МКБ-10 | Medum.ru

Ниже приведён список действующих веществ, относящихся к коду K12 МКБ-10 (наименования фармакологических групп и перечень торговых названий, связанных с этим кодом).

  • Действующие вещества
  • Аллантоин + Повидон-Йод

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Аллантоин

    Фармакологическая группа: Антикоагулянты

  • Алоэ древовидного листья

    Фармакологические группы: Общетонизирующие средства и адаптогены, Регенеранты и репаранты

  • Амбазон

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Амилметакрезол

    Фармакологические группы: Антисептики и дезинфицирующие средства, Противопаразитарные препараты, Прочие противомикробные, противопаразитарные и противоглистные средства

  • Амилметакрезол + Дихлорбензиловый спирт + Аскорбиновая кислота

    Фармакологические группы: Прочие противомикробные, противопаразитарные и противоглистные средства в комбинации с другими препаратами, Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Амилметакрезол + Дихлорбензиловый спирт + Левоментол

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Амилметакрезол + Дихлорбензиловый спирт + Лидокаин

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Ампициллин

    Фармакологическая группа: Пенициллины

  • Ацетиламинонитропропоксибензол

    Фармакологические группы: Антисептики и дезинфицирующие средства, Противокашлевые препараты, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Бадана корневища

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Бензалкония хлорид + Мяты перечной листьев масло + Тимол + Эвкалипта прутовидного листьев масло + Левоментол

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Бензидамин

    Фармакологические группы: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства, Стоматологические средства

  • Бензидамин + Цетилпиридиния хлорид

    Фармакологические группы: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства, в комбинации с другими препаратами, Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Бензилдиметил [3-(миристоиламино) пропил]аммоний хлорид моногидрат

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Бензокаин + Тиротрицин

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Бензокаин + Цетилпиридиния хлорид

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Бензоксония хлорид

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Бензоксония хлорид + Лидокаин

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Биклотимол

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Брусники листья

    Фармакологическая группа: Диуретики

  • Бутилгидрокситолуол

    Фармакологические группы: Антигипоксанты и антиоксиданты, Прочие противоопухолевые препараты

  • Водорода пероксид

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Гексэтидин

    Фармакологические группы: Антисептики и дезинфицирующие средства, Стоматологические средства

  • Грамицидин С

    Фармакологическая группа: Прочие антибиотики

  • Грамицидин С + Оксибупрокаин + Цетилпиридиния хлорид

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Прочие антибиотики в комбинации с другими препаратами

  • Грамицидин С + Цетилпиридиния хлорид

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Прочие антибиотики в комбинации с другими препаратами

  • Деквалиния хлорид

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Деквалиния хлорид + Лизоцима гидрохлорид

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Диклонин

    Фармакологическая группа: Местные анестетики

  • Дихлоробензиловый спирт

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Дуба кора

    Фармакологические группы: Антисептики и дезинфицирующие средства, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Зверобоя продырявленного трава

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Земляники ягоды
  • Змеевика корневища

    Фармакологическая группа: Противодиарейные препараты

  • Индометацин

    Фармакологические группы: Офтальмологические препараты, НПВС — Производные уксусной кислоты и родственные соединения

  • Йод + [Калия йодид + Глицерол]

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Каланхоэ побегов сок

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Каланхоэ препарат

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Календулы лекарственной цветки

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Календулы лекарственной цветки + Ромашки аптечной цветки + Солодки корни + Череды трехраздельной трава + Шалфея лекарственного листья + Эвкалипта прутовидного листья

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Календулы лекарственной цветков экстракт + Ромашки аптечной цветков экстракт + Тысячелистника обыкновенного травы экстракт

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства, в комбинации с другими препаратами

  • Калины плоды

    Фармакологическая группа: Общетонизирующие средства и адаптогены

  • Калины кора
  • Карбеноксолон

    Фармакологическая группа: Регенеранты и репаранты

  • Кетопрофен

    Фармакологическая группа: НПВС — Производные пропионовой кислоты

  • Лабазника вязолистного цветки
  • Лапчатки прямостоячей корневища

    Фармакологические группы: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства, Регенеранты и репаранты

  • Лидокаин + Ромашки аптечной цветков экстракт

    Фармакологические группы: Местные анестетики в комбинации с другими препаратами, Стоматологические средства в комбинации с другими препаратами

  • Лидокаин + Цетилпиридиния хлорид

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Лизоцим + Пиридоксин

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Лизоамидаза
  • Масло тимьяна
  • Метациклин

    Фармакологическая группа: Тетрациклины

  • Метилурацил + Облепихи масло + Сульфаэтидол

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Регенеранты и репаранты в комбинации с другими препаратами

  • Метронидазол

    Фармакологическая группа: Прочие синтетические антибактериальные средства

  • Метронидазол + Хлоргексидин

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Прочие синтетические антибактериальные средства в комбинации с другими препаратами, Стоматологические средства в комбинации с другими препаратами

  • Мочевины пероксид

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Натрия гидрокарбонат

    Фармакологическая группа: Регуляторы водно-электролитного баланса и КЩС

  • Нитрофурал

    Фармакологическая группа: Прочие синтетические антибактериальные средства

  • Нифлумовая кислота

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Ноготков цветки

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Пенициллин G прокаин

    Фармакологическая группа: Пенициллины

  • Пефлоксацин

    Фармакологическая группа: Хинолоны/фторхинолоны

  • Пиперациллин

    Фармакологическая группа: Пенициллины

  • Пихты сибирской терпены

    Фармакологическая группа: Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Поликрезулен

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Рибонуклеаза

    Фармакологическая группа: Ферменты и антиферменты

  • Рибофлавин

    Фармакологическая группа: Витамины и витаминоподобные средства

  • Ромашки аптечной цветки

    Фармакологические группы: Антисептики и дезинфицирующие средства, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Ромашки аптечной цветков экстракт

    Фармакологические группы: Антисептики и дезинфицирующие средства, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Сангвинарина гидросульфат + Хелеритрина гидросульфат

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Противогрибковые средства в комбинации с другими препаратами

  • Танин

    Фармакологические группы: Дерматотропные средства, Детоксицирующие средства, включая антидоты, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Тетракаин + Хлоргексидин + Аскорбиновая кислота

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Местные анестетики в комбинации с другими препаратами

  • Тетракаин + Хлоргексидин

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Местные анестетики в комбинации с другими препаратами

  • Тетрациклин

    Фармакологические группы: Тетрациклины, Офтальмологические препараты

  • Тимьяна ползучего трава

    Фармакологические группы: Антисептики и дезинфицирующие средства, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства, Секретолитики и стимуляторы моторной функции дыхательных путей

  • Тимьян

    Фармакологическая группа: Секретолитики и стимуляторы моторной функции дыхательных путей

  • Тинидазол + Ципрофлоксацин

    Фармакологические группы: Прочие синтетические антибактериальные средства в комбинации с другими препаратами, Хинолоны/фторхинолоны в комбинации с другими препаратами

  • Транексамовая кислота

    Фармакологическая группа: Ингибиторы фибринолиза

  • Трийодрезорцин

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Триклозан

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Фуразидин

    Фармакологическая группа: Прочие синтетические антибактериальные средства

  • Хлоргексидин

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Хлоргексидин + [Аскорбиновая кислота]

    Фармакологические группы: Антисептики и дезинфицирующие средства в комбинации с другими препаратами, Стоматологические средства в комбинации с другими препаратами

  • Хлоргексидина глюконат

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Холина салицилат

    Фармакологическая группа: НПВС — Производные салициловой кислоты

  • Холина салицилат + Цеталкония хлорид

    Фармакологические группы: Стоматологические средства в комбинации с другими препаратами, НПВС — Производные салициловой кислоты в комбинации с другими препаратами

  • Цетилпиридиния хлорид

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Шалфея лекарственного листьев экстракт

    Фармакологические группы: Антисептики и дезинфицирующие средства, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Шалфея лекарственного листья

    Фармакологические группы: Антисептики и дезинфицирующие средства, Прочие ненаркотические анальгетики, включая нестероидные и другие противовоспалительные средства

  • Эвкалипта листьев экстракт

    Фармакологическая группа: Прочие противомикробные, противопаразитарные и противоглистные средства

  • Эвкалипта прутовидного листьев настойка

    Фармакологическая группа: Прочие противомикробные, противопаразитарные и противоглистные средства

  • Эвкалипта прутовидного листья

    Фармакологическая группа: Прочие противомикробные, противопаразитарные и противоглистные средства

  • Эритромицин

    Фармакологические группы: Макролиды и азалиды, Офтальмологические препараты

  • Этоний

    Фармакологическая группа: Антисептики и дезинфицирующие средства

  • Амилметакрезол + Дихлорбензиловый спирт

    Фармакологическая группа: Антисептики и дезинфицирующие средства в комбинации с другими препаратами

  • Бензилдиметил-миристоиламино-пропиламмоний

    Фармакологические группы: Антисептики и дезинфицирующие средства, Офтальмологические препараты

  • Острый герпетический стоматит

    Герпес — это самая распространенная вирусная инфекция. Около 90% людей на земле инфицированы герпесом. Герпесвирусные инфекции стали одной из значимых медико-социальных проблем в США и странах Западной Европы еще 20 лет назад. Однако в нашей стране эта группа инфекционных заболеваний остается малоизвестной. Это обусловлено тем, что больные наблюдаются у разных специалистов — дерматологов, стоматологов, гинекологов, офтальмологов, терапевтов и др.

    В настоящее время одним из наиболее частых заболеваний в детском возрасте является герпетическая инфекция, что объясняется не только широкой распространенностью вируса простого герпеса (ВПГ), но и особенностями становления иммунной системы в развивающемся организме ребенка.   Герпетическая инфекция в целом относится к числу самых распространенных и плохо контролируемых. По данным ВОЗ, среди вирусных инфекций заболевания, обусловленные ВПГ, занимают второе место после гриппа.

    Инфицированность детей ВПГ в возрасте от 6 месяцев до 5 лет составляет 60%, а к 15 годам — уже 90%. С каждым годом увеличивается заболеваемость детей острым (первичным) герпетическим стоматитом.


    Впервые на роль ВПГ при заболеваниях слизистой оболочки полости рта указал еще в начале XX века Н.Ф. Филатов (1902). Он предположил возможную герпетическую природу самого распространенного среди детей острого афтозного стоматита. Доказательства эти были получены позднее, когда в эпителиальных клетках пораженных участков слизистой оболочки полости рта стали обнаруживать антигены ВПГ.


    По международной классификации болезней и проблем, связанных со здоровьем, последнего (десятого) пересмотра (МКБ 10, Женева, 1995) это заболевание регистрируется как острый герпетический стоматит (ОГС). ОГС не только занимает первое место среди всех поражений слизистой оболочки полости рта, но и входит в лидирующую группу среди всех инфекционных заболеваний детского возраста. При этом у каждого 7-10-го ребенка ОГС рано переходит в хроническую форму с периодическими рецидивами.


    Широкое распространение заболевания у детей от 6 месяцев до 3 лет объясняется тем, что в этом возрасте у детей исчезают антитела, полученные от матери через плаценту, и отсутствием зрелых систем специфического иммунитета. Среди детей старшего возраста заболеваемость значительно ниже вследствие приобретенного иммунитета после перенесенной герпетической инфекции в ее разнообразных клинических формах.

    В развитии герпетической инфекции, проявляющейся преимущественно в полости рта, большое значение имеют структура слизистой оболочки рта у детей в разном возрасте и активность местного тканевого иммунитета. Наибольшая распространенность ОГС в возрасте до 3 лет может быть обусловлена возрастно-морфологическими особенностями, проявляющимися высокой проницаемостью в этот период гистогематических барьеров и низким уровнем реакций клеточного иммунитета вследствие тонкости эпителиального покрова с невысоким уровнем гликогена и нуклеиновых кислот, рыхлости и слабой дифференцировки базальной мембраны и волокнистых структур соединительной ткани (обильная васкуляризация, высокое содержание тучных клеток с их низкой функциональной активностью и т.д.).

    Появлению элементов поражения на слизистой оболочке полости рта предшествует лимфаденит разной степени выраженности.


    При среднетяжелой и тяжелой клинических формах чаще развивается двустороннее воспаление подчелюстных лимфоузлов, но в процесс могут вовлекаться и все группы шейных лимфоузлов. Лимфаденит при ОГС не только предшествует высыпаниям элементов поражения в полости рта, но сопутствует всему течению болезни и сохраняется в течение 7-10 дней после полной эпителизации элементов.


    В устойчивости организма к заболеванию, в его защитных реакциях играют роль как специфические, так и неспецифические факторы иммунитета. Исследования неспецифической иммунологической реактивности при ОГС выявили нарушения защитных барьеров организма, отражающие степень тяжести заболевания и периоды его развития. Среднетяжелая и тяжелая формы стоматита приводили к резкому угнетению естественного иммунитета, который восстанавливался через 7-14 дней после клинического выздоровления ребенка.

    Клиническая картина

    ОГС, как и многие другие инфекционные заболевания, протекает в легкой, среднетяжелой и тяжелой формах. В периоде развития болезни выделяют две фазы — катаральную и высыпания элементов поражения.

    В этот период появляются симптомы поражения слизистой оболочки полости рта. Вначале возникает интенсивная гиперемия всей слизистой оболочки, а через сутки, реже двое, в полости рта, как правило, обнаруживаются элементы поражения. Тяжесть ОГС оценивается по выраженности проявлений токсикоза и характеру поражений слизистой.

    Легкая форма ОГС характеризуется внешним отсутствием симптомов интоксикации организма, продромальный период клинически не проявляется. Болезнь начинается внезапно повышением температуры до 37-37,5°С. Общее состояние ребенка вполне удовлетворительное. У ребенка иногда обнаруживаются незначительные явления воспаления слизистой оболочки полости носа, верхних дыхательных путей.


    Иногда в полости рта возникают гиперемия, небольшой отек, главным образом в области десневого края (катаральный гингивит). Длительность этой фазы 1-2 дня. Стадия везикулы обычно просматривается родителями и врачом, так как пузырек быстро лопается и превращается в афту. Афта — эрозия округлой или овальной формы с ровными краями и гладким дном с ободком гиперемии вокруг.


    В большинстве случаев на фоне усилившейся гиперемии в полости рта появляются одиночные или сгруппированные элементы поражения, число которых обычно не превышает 6. Высыпания однократные. Длительность периода развития болезни 1-2 дня.

    Период угасания болезни более длительный. В течение 1-2 дней элементы приобретают как бы мраморную окраску, края и центр их размываются. Они уже менее болезненны. После эпителизации элементов 2-3 дня сохраняются явления катарального гингивита, особенно в области фронтальных зубов верхней и нижней челюсти.


    У детей с этой формой заболевания, как правило, отсутствуют изменения в крови, иногда только к концу болезни появляется незначительный лимфоцитоз.


    Естественный иммунитет при легкой форме стоматита страдает незначительно, а в период клинического выздоровления защитные силы организма ребенка находятся почти на уровне таковых у здоровых детей, то есть при легкой форме ОГС клиническое выздоровление означает полное восстановление нарушенных защитных сил организма.

    Среднетяжелая форма ОГС характеризуется достаточно четко выраженным токсикозом и поражением слизистой оболочки полости рта во все периоды болезни. Уже в продромальном периоде ухудшается самочувствие ребенка, появляются слабость, капризы, ухудшение аппетита, возможны катаральная ангина или симптомы острого респираторного заболевания. Подчелюстные лимфоузлы увеличиваются, становятся болезненными. Температура повышается до 37-37,5°С.


    По мере нарастания болезни в период развития заболевания (фаза катарального воспаления) температура достигает 38-39°С, появляются головная боль, тошнота, бледность кожных покровов. На пике подъема температуры, усиленной гиперемии и выраженной отечности слизистой оболочки высыпают элементы поражения как в полости рта, так и нередко на коже околоротовой области. В полости рта обычно от 10 до 20-25 элементов поражения. В этот период усиливается саливация, слюна становится вязкой, тягучей.


    Отмечаются ярко выраженное воспаление и кровоточивость десен.


    Высыпания нередко рецидивируют, из-за чего при осмотре полости рта можно видеть элементы поражения, находящиеся на разных стадиях клинического и цитологического развития. После первого высыпания элементов поражения температура тела обычно снижается до 37-37,5°С. Однако последующие высыпания, как правило, сопровождаются подъемом температуры до прежнего уровня. Ребенок не ест, плохо спит, нарастают симптомы вторичного токсикоза.


    СОЭ повышается до 20 мм/ч, чаще отмечается лейкопения, иногда незначительный лейкоцитоз. Уровень палочкоядерных нейтрофилов и моноцитов обычно в пределах верхних границ нормы, выявляются лимфоцитоз и плазмоцитоз. Нарастание титра герпетических комплементсвязывающих антител обнаруживается более часто, чем после легкой формы стоматита.

    Продолжительность периода угасания болезни зависит от степени сопротивляемости организма ребенка, наличия кариозных и разрушенных зубов, рациональности терапии. При неблагоприятных условиях происходит слияние элементов поражения, их последующее изъязвление, развивается язвенный гингивит. Эпителизация элементов поражения затягивается до 4-5 дней. Дольше всего сохраняются гингивит, резкая кровоточивость десен и лимфаденит.

    Тяжелая форма ОГС встречается значительно реже, чем среднетяжелая и легкая. В продромальный период у ребенка имеются все признаки начинающегося острого инфекционного заболевания: апатия, адинамия, головная боль, кожно-мышечная гиперестезия, артралгия и др. Нередки симптомы поражения сердечнососудистой системы: бради- или тахикардия, приглушение тонов сердца, артериальная гипотония. У некоторых детей отмечаются носовые кровотечения, тошнота, рвота, отчетливо выраженный лимфаденит не только подчелюстных, но и шейных лимфоузлов.


    В период развития болезни температура повышается до 39-40°С. У ребенка появляется скорбное выражение губ, обращают на себя внимание страдальческие запавшие глаза. Могут быть нерезко выраженный насморк, покашливание, несколько отечны и гиперемированы конъюнктивы глаз. Губы сухие, яркие, запекшиеся. Слизистая оболочка полости рта отечна, ярко гиперемирована, резко выражен гингивит.


    Через 1-2 суток в полости рта начинают появляться элементы поражения — до 20-25. Часто высыпания в виде типичных герпетических пузырьков возникают на коже околоротовой области, век, конъюнктиве глаз, мочках ушей, на пальцах рук по типу панариция. Высыпания в полости рта рецидивируют и поэтому в разгар болезни у тяжелобольного ребенка их насчитывается около 100.


    Элементы сливаются, образуя обширные участки некроза слизистой оболочки. Поражаются не только губы, щеки, язык, мягкое и твердое небо, но и десневой край. Катаральный гингивит переходит в язвенно-некротический. Отмечается резкий гнилостный запах изо рта, обильное слюнотечение с примесью крови. Усугубляются воспалительные явления на слизистой оболочке полости носа, дыхательных путей, глаз. В секрете из носа и гортани также обнаруживаются прожилки крови, а иногда отмечаются носовые кровотечения.

    В таком состоянии дети нуждаются в активном лечении у педиатра и стоматолога, в связи с чем целесообразна госпитализация ребенка в изолятор педиатрической или инфекционной больницы. Период угасания болезни зависит от своевременности и правильности лечения и от наличия в анамнезе ребенка сопутствующих заболеваний. Несмотря на клиническое выздоровление больного тяжелой формой ОГС, в период реконвалесценции имеются глубокие изменения гомеостаза.

    Диагностика

    Для диагностики ВПГ используют следующие методы исследования:

    • вирусологические методы обнаружения и идентификации вирусов простого герпеса

    • полимеразная цепная реакция (ПЦР)

    • выявление антигенов ВПГ

    • регистрация иммунного ответа к ВПГ

    • цитоморфологические методы

    • оценка иммунного статуса

    Наличие антигенов ВПГ в биологическом материале определяют с помощью серологических методов:

    • реакции нейтрализации (РН)

    • иммуноферментного анализа (ИФА)

    • радиоиммунного анализа (РИА)

    • реакции связывания комплемента (РСК)

    • реакции пассивной геммагглюцинации (РПГА)

    Диагноз ОГС ставится на основании клинической картины заболевания. Использование вирусологических и серологических методов диагностики в практическом здравоохранении затруднено. Это связано прежде всего со сложностью специальных методов исследования. Кроме того, с помощью этих методов можно получить результаты в лучшем случае к концу заболевания или спустя некоторое время после выздоровления. Такая ретроспективная диагностика не может удовлетворить врача-клинициста.

    Программы для пациентов, страдающих заболеваниями полости рта (парадонтит, рецидивирующий кариес, афтозный рецидивирующий стоматит)


    Программы для пациентов, страдающих заболеваниями полости рта (парадонтит, рецидивирующий кариес, афтозный рецидивирующий стоматит)

    Достаточно часто заболевания полости рта связаны с хроническими очагами инфекции ЛОР органов. При хронических заболеваниях ЛОР органов снижается иммунитет, ослабляются защитные свойства слизистой, нарушается микрофлора носоглотки и полости рта. Все это способствует возникновению стоматологических проблем. Поэтому, если вы часты клиент стоматолога, имеет смысл посетить ЛОР врача и проверить состояние ЛОР органов.

    Осмотр ЛОР врача предполагает выявление очагов хронической инфекции ЛОР органов. Их санация способствует улучшению здоровья зубов и десен.

    В результате лечения происходит восстановление микрофлоры слизистой полости рта, повышение местного иммунитета.

    Специалистами нашего ЛОР отделения разработаны программы для пациентов страдающих заболеваниями полости рта. Каждая программа составляется индивидуально, диагностика, виды и количество процедур назначаются врачом в зависимости от характера проблемы, причин и тяжести состояния. Ниже приведены медицинские услуги, являющиеся основными составляющими этих программ:

    Консультация отоларинголога. Консультация зав.отделением, к.м.н, ведущего специалиста.

    Мазок (посев) на флору и чувствительность к антибиотикам из зева (в рамках амбулаторного приема. Посев на флору и чувствительность к антибиотикам (готовится не менее 7 дней) позволяет выделить патогенные микроорганизмы и назначить специфическое лечение.

    Клинический анализ крови.

    Физиотерапия – в зависимости от причин и индивидуальных особенностей могут быть назначены: промывания миндалин, промывания с аппаратом Тонзиллор, КУФ, лазеротерапия. Обычно курс лечения составляет от 5 до 10 процедур.

    Повторная консультация по результатам лечения, с рекомендациями и подбором медикаментозного лечения. Консультация зав. отделением, к.м.н, ведущего специалиста.

    По показаниям может быть назначена рентгенография или компьютерная томография придаточных пазух носа.

    вернуться назад

    причины, симптомы, диагностика и лечение у взрослых – Стоматология в Москве – Клиника ЦКБ РАН


    Ротовая полость покрыта слизистой. Воспаление этого слоя эпителия – и есть стоматит. Заболевание является ответом иммунитета на возникновение неблагоприятных факторов. Раньше стоматит считался исключительно детским заболеванием, однако сегодня оно все чаще поражает взрослых пациентов. Зачастую зонами, которые поражает заболевание, становятся губы, щеки, небо.

    Причины появления стоматита


    Есть несколько причин, провоцирующих стоматит:

    • Присоединение инфекции – вирусы и бактерии, которые очень быстро заселяются, обнаруживая поврежденные участки слизистой.
    • Неправильное питание – если рацион слишком скудный, организму не хватает сил и ресурсов для борьбы с атакующими его возбудителями.
    • Ранки и другие повреждения во рту – это могут быть царапины от острых краев зубов с кариозными полостями, прикушенные щеки, трещины на губах, ожоги.
    • Неправильная гигиена рта – при недостаточном очищении на зуба и языке остается налет, в котором очень быстро размножаются бактерии.
    • Недостаточная гигиена в целом – грязные руки, немытые фрукты, которые становятся источниками бактерий.
    • Последствия стоматологического вмешательства, проведенного с нарушением норм.
    • Использование паст с лаурилсульфатом натрия, сокращающим слюноотделение. В такой ситуации эпителий может пересыхать и, как следствие, недостаточно сопротивляться бактериям.
    • Алкоголь и курение.
    • Хронические заболевания общего характера, влияющие на состояние организма, переваривание пищи, другие жизненно важные процессы.

    О чем может рассказать стоматит


    Появление стоматита может свидетельствовать о появлении в организме некоторых более серьезных патологий. Иногда стоматит является сопутствующим симптомом таких состояний как:

    • Перенесенное ионизирующее излучение или химиотерапия.
    • Онкологические заболевания носоглотки, рта, шеи.
    • Нарушения в работе пищеварительного тракта, кишечные паразиты.
    • ВИЧ инфекция.
    • Длительное обезвоживание.
    • Гормональные нарушения у женщин.
    • Сахарный диабет.
    • Анемия.
    • Бронхиальная астма.

    Виды стоматита

    1. Вирусный. Заражение вирусом Эпштейна-Бара или простого герпеса. Проявляется в виде пузырьков, на месте которых впоследствии возникают эрозии.
    2. Бактериальный. Вызывается размножением стрептококков и стафилококков. Выглядит как гнойнички, переходящие в ранки.
    3. Грибковый. Снижение иммунитета и размножение грибков Candida. Выглядит как небольшие очаги белого налета, после повреждения которых остаются болезненные эрозии.
    4. Химический. Ожоги кислотами и щелочами. Глубокие язвы с формированием рубцов и деформаций слизистой.
    5. Лучевой. Возникающий в результате воздействия ионизирующего излучения. Выражается в виде эрозий и деформации тканей.
    6. Аллергический. Возникает как реакция на лекарство, зубные протезы.

    Симптомы стоматита


    Распознать стоматит можно по ряду симптомов, наиболее частыми из которых являются:

    • Покраснение с отечностью и болезненными ощущениями.
    • Последующее формирование язвочек с ровным краем под тонкой пленкой (при бактериальном стоматите).
    • Жжение и боль в месте поражения.
    • Усиленное отделение слюны, характерный запах изо рта.
    • Кровоточивость десен.
    • Повышение температуры, местное или по всему телу.
    • Появление язвочек зачастую концентрируется на внутренней стороне губ, также возможно поражение зоны под языком, языка и десен, внутренней поверхности щек.

    Лечение стоматита


    Пройти лечение можно в платной стоматологии ЦКБ РАН. Подход к процессу зависит от характера заболевания и причины его возникновения:

    1. Если стоматит катаральный, то есть возникший как следствие несоблюдения гигиенических норм, его вылечить можно довольно просто, за неделю в домашних условиях. Для этого из рациона необходимо исключить раздражающую пищу – кислую, горячую, острую, соленую и т.д. Рот нужно полоскать растворами, которые борются с микробами.
    2. Если есть проявления более серьезные, говорящие об инфекционном поражении, обращение к стоматологу или терапевту – обязательное условие правильной борьбы с заболеванием. На консультации стоматолога, после осмотра и опроса, врач назначит лечение. Это меры по купированию боли, снятию воспаления, борьбы с инфекцией. Применяются как полоскания, местные препараты, так и лекарства общего действия в виде таблеток.
    3. Стоматиты, возникающие вследствие аллергии, не считаются самостоятельным заболеванием. В основе лечения – выявление объекта, вызвавшего аллергию, прием антигистаминных препаратов.
    4. Лечение герпетического стоматита схоже с устранением остальных видов стоматита. Оно заключается в приеме препаратов от отека и боли, аппликация с препаратами и полосканий, противовирусных, антигистаминных, а также средств для восстановления иммунитета.
    5. Стоматит, вызванный грибками Кандида, лечится с применением противогрибковых препаратов орально, локального нанесение средств для борьбы с грибком. Для увеличения эффективности лечения рекомендуется исключить или максимально снизить употребление простых углеводов, так как именно сахара являются основным питанием для грибов.

    Профилактика


    Самая распространенная причина для начала развития заболевания – травмирование слизистой рта. То есть остерегаться в первую очередь стоит повреждений. Острые края зубов, сломанных или некачественно запломбированных, ожоги и другие факторы, которые могут привести к появлению минимальных ранок, должны быть исключены. Кроме этого рекомендуется:

    • Тщательно соблюдать гигиену, как во рту, так и в остальном – мыть продукты перед употреблением, следить за чистотой рук и ногтей.
    • Аккуратно чистить зубы щеткой и зубной нитью, не использовать некачественные пасты.
    • Следить за чистотой зубных протезов, если они имеются.
    • При первых тревожных проявлениях незамедлительно обращаться к стоматологу.
    • Отслеживать общее состояние организма, системы пищеварения.
    • Отказаться от вредных привычек.


    Внимание к своему организму и своевременное посещение стоматологии в Москве на базе ЦКБ РАН поможет избежать заболевания или остановить его в самом начале, избежав осложнений.

    Заболевания со стороны орофациального комплекса коды по МКБ 11

    13 Болезни органов пищеварения

    Нарушения и патология челюстьнолицевого комплекса в рамках класса МКБ 11 заболевания органов пищеварения.

    DA00 Заболевания губ

    DA00.0 Хейлит

    DA00.1 Самоиндуцированная травма губ

    DA00.2 Пигментные аномалии губ

    DA00.3 Губная перепонка

    DA00.Y Другие уточненные заболевания губ

    DA01 Нарушения слизистой оболочки полости рта

    DA01.0 Нарушения устного эпителия

    DA01.00 Лейкоплакия

    DA01.01 Волосяная лейкоплакия

    DA01.02 Блуждающая сыпь во рту

    DA01.0Y Другие уточненные нарушения устного эпителия

    DA01.1 Неинфекционные эрозивные или язвенные нарушения слизистой оболочки полости рта

    DA01. 10 Оральные афты или афтаподобные изъязвления

    DA01.11 Оральный мукозит

    DA01.12 Хронический язвенный стоматит

    DA01.13 Мультиформная эритема с оральным изъязвлением

    DA01.14 Принудительная оральная язва

    DA01.15 Язвы рта

    Исключено:

    • EB40.00 Оральный пемфигус
    • EB13.0 Синдром Стивенса-Джонсона

    DA01.1Y Другие уточненные неинфекционные эрозивные или язвенные нарушения слизистой оболочки полости рта

    DA01.2 Гранулема или гранулемоподобные поражения слизистой оболочки полости рта

    DA01.20 Гигантская клеточная гранулема, центральная

    DA01.21 Орофациальный гранулематоз

    DA01.2Y Другие уточненные гранулемы или гранулемоподобные поражения слизистой оболочки полости рта

    DA01.3 Инфекции губ или слизистой оболочки полости рта

    DA01.30 Целлюлит или абсцесс мягких тканей рта

    Исключено:

    DA0C.4 Абсцесс периодонта

    Исключено:

    • 1F05.0 Энтеровирусный везикулярный стоматит
    • 1F05. 1 Энтеровирусный везикулярный фарингит
    • 1F23.0 Кандидоз губ или слизистых оболочек полости рта
    • 1E82 Бородавки губ или полости рта

    DA01.3Y Другие указанные инфекции губ или слизистой оболочки полости рта

    DA01.4 Раздражающая гиперплазия слизистой оболочки полости рта

    DA01.40 Папиллярная гиперплазия слизистой оболочки полости рта

    DA01.41 Гиперплазия зубного протеза

    DA01.42 Оральный фиброэпителиальный полип

    DA01.4Z Раздражающая гиперплазия слизистой оболочки полости рта неуточненная

    Исключено:

    • EA91.4 Лишайниковые и лихеноидные реакции слизистой оболочки полости рта
    • DA02.2 Оральный подслизистый фиброз
    • EJ90.0 Синдром оральной аллергии
    • DA02.3 Контакт с гингивостоматитом

    DA01.Y Другие уточненные нарушения слизистой оболочки полости рта

    DA02 Разные специфические нарушения губ или слизистой оболочки полости рта

    DA02.0 Генетические или расстройства развития, связанные с губ или слизистой оболочки полости рта

    Исключено:

    • 1F23. 14 Хронический кожно- мышечный кандидоз
    • LD2D.0 Питц -Джегерс синдром
    • LA90.00 Наследственная геморрагическая телеангиэктазия

    DA02.1 Ксеростомия

    DA02.2 Оральный подслизистый фиброз

    DA02.3 Контакт с гингивостоматитом

    DA02.30 Аллергический контакт гингивостоматита

    DA02.31 Раздражающий контакт гингивостоматита

    Исключено:

    • EH54 Лекарственные оральные условия:
    1. DA01.14 Принудительная оральная язва

    DA03 Заболевания языка

    DA03.0 Глоссит

    DA03.1 Географический язык

    DA03.2 Атрофия язычковых сосочков

    DA03.3 Медиана ромбовидного глоссита

    DA03.4 Гипертрофия язычковых сосочков

    DA03.5 Мокраглоссия

    Исключено:

    • LA31.0 Врожденная макроглоссия

    Исключено:

    • BD75.0 Сублингвальные варикоз

    DA03.Y Другие уточненные заболевания языка

    DA04 Заболевания слюнных желез

    DA04.0 Атрофия слюнной железы

    DA04. 1 Гипертрофия слюнной железы

    DA04.2 Сиалоаденит

    DA04.3 Абсцесс слюнной железы

    DA04.4 Сиалолитиаз

    DA04.5 Мукоцеле слюнной железы

    DA04.6 Нарушения секреции слюны

    DA04.7 Сиалофагия

    DA04.8 Сиалошехи

    Исключено:

    • LA14.10 Аплазия слезных или слюнных желез

    DA04.Y Другие уточненные заболевания слюнных желез

    DA04.Z Болезни слюнных желез, неуточненные

    DA05 Кисты полости рта или лица

    DA05.0 Развивающие одонтогенные кисты

    DA05.1. Развитые неодонтогенные кисты полости рта

    DA05.Y Другие указанные кисты полости рта или лица

    DA05.Z Кисты области полости рта или лица, неуточненные

    DA06 Определенные заболевания челюстей

    DA06.0 Воспалительные условия челюстей

    DA06.1 Альвеолит челюсти

    DA06.2 Экзостоз челюсти

    DA06.3 Полость полости нижней челюсти

    DA07 Нарушения развития зуба или извержения

    DA07.0. Плотность или повреждения, связанные с фтором

    DA07. 1 Поверхности безфторидной эмали

    DA07.2 Гипоплазия эмали

    DA07.3 Нарушения в образовании зубов

    DA07.4 Корневая аномалия

    DA07.5. Дисперсия в слизистой оболочке

    DA07.6 Нарушения в извержении зуба

    DA07.60 Синдром прорезывания зубов

    DA07.61 Анкилоз зубов

    DA07.6Y Другие заданные нарушения в извержении зубов

    DA07.6Z Нарушения в извержении зуба, неуказанные

    DA07.7 Встроенные зубы

    DA07.8 Удаленные зубы

    Исключено:

    • LA30.0 Анодонтия
    • LA30.1 Гиподонтия
    • LA30.2 Олигодонтия
    • LA30.3 Полиодонтия
    • LA30.4 Отклонения от размера или формы зубов
    • LA30.6 Амелогенез несовершенный
    • LA30.7 Дисплазия дентина
    • LA30.8 Недостаточность дентиногенеза
    • LA30.9 Недостаточность одонтогенеза

    DA07.Y Другие указанные нарушения развития или извержения зубов

    DA07.Z Нарушения развития зуба или извержения, неуточненные

    DA08 Болезни твердых тканей зубов

    DA08. 0 Стоматологический кариес

    DA08.1 Некоторые определенные заболевания твердых тканей зубов

    DA08.10 Чрезмерное истощение зубов

    DA08.11 Абразив зубов

    DA08.12 Эрозия зубов

    DA08.13 Абфракция

    DA08.14 Патологическая резорбция зубов

    DA08.15 Последующие цветовые изменения твердых тканей зубов

    Исключено:

    • DA07.61 Анкилоз зубов

    DA08.2 Хронические повреждения зубов

    DA08.3 Нетравматический перелом зуба

    DA08.4 Депозиты на зубах

    DA08.Y Другие уточненные заболевания твердых тканей зубов

    DA08.Z Болезни твердых тканей зубов, неуточненные

    DA09 Болезни целлюлозной или периапикальной ткани

    DA09.0 Пульпит

    DA09.1 Некроз целлюлозы

    DA09.2 Абсцесс целлюлозы

    DA09.3 Феникс-абсцесс

    DA09.4 Дегенерация целлюлозы

    DA09.5 Аномальное образование твердой ткани в пульпе

    DA09.6 Периапикальный абсцесс

    DA09.60 Периапикальный абсцесс с участием лица

    DA09. 61 Периапикальный абсцесс с синусом

    DA09.62 Периапикальный абсцесс без синуса

    DA09.6Y Другой назначенный периапикальный абсцесс

    DA09.6Z Периапикальный абсцесс неуточненный

    DA09.7 Периапический пародонтит

    DA09.70 Острый апикальный периодонтит пульпы

    DA09.71 Хронический апикальный пародонтит

    DA09.7Y Другие уточненные периоперационные периодонтиты

    DA09.7Z Периапический пародонтит неуточненный

    DA09.8 Радикальная киста

    DA09.Y Другие уточненные заболевания целлюлозной или периапикальной ткани

    DA09.Z Болезни целлюлозной или периапикальной ткани неуточненные

    DA0A Определенные расстройства зубов или опорных структур

    DA0A.0 Эксфолиация зубов из-за системных причин

    DA0A.1 Потеря зубов из-за несчастного случая, извлечения или местного заболевания периодонта

    DA0A.2 Атрофия аденулярного альвеолярного хребта

    DA0A.3 Сохраненный зубной корень

    Исключено:

    • NA03.2 Вывих зуба

    DA0A. Y Другие уточненные нарушения зубов и опорных структур

    DA0A.Z Неопределенные нарушения зубов и опорных структур

    DA0B Заболевания десен

    DA0B.0 Аллергический гингивит

    DA0B.1 Катаральный гингивит

    DA0B.2 Эвристический гингивит

    DA0B.3 Атрофический старческий гингивит

    DA0B.4 Острые множественные абсцессы десны

    DA0B.5. Развитые или приобретенные деформации или состояния десны

    DA0B.6 Pericoronitis

    DA0B.Y Другие уточненные заболевания десен

    DA0B.Z Заболевания десен, неуточненные

    DA0C Периодонтальная болезнь

    DA0C.0 Острый пародонтит

    DA0C.1 Агрессивный пародонтит

    DA0C.2 Пародонтоз

    DA0C.3 Некротизирующие заболевания периодонта

    DA0C.30 Некротизирующий язвенный пародонтит

    DA0C.31 Noma

    Исключено:

    • 1C1H Некротизирующий язвенный гингивит

    DA0C.3Y Другие уточненные некротизирующие периодонтальные заболевания

    DA0C.3Z Некротизирующие заболевания периодонта, неуточненные

    DA0C. 4 Абсцесс периодонта

    DA0C.5 Линейная десневая эритема

    DA0C.Y Другие уточненные периодонтальные заболевания

    DA0C.Z Периодонтальная болезнь неуточненная

    DA0D Определенные расстройства десен или альдеолярного хребта

    DA0D.0 десневой рецессии

    DA0D.1 расширение десневого

    DA0D.2. Деструктивные или адентичные альвеолярные хребты, связанные с травмой

    DA0D.3. Гипоплазмогенеза

    DA0D.4 Гингивит хлопкового рулона

    DA0D.5 Изъязвление десен

    DA0D.Y Другие уточненные нарушения десневого или альтенолярного хребта

    DA0E Дентофациальные аномалии

    DA0E.0 Основные аномалии размера челюсти

    DA0E.00 Микрогнатия

    DA0E.0Y Другие уточненные основные аномалии размера челюсти

    DA0E.0Z Основные аномалии размера челюсти, неуказанные

    DA0E.1 Аномалии отношения челюстно-краниальной основы

    DA0E.2 Аномалии отношения зубных дуг

    DA0E.3 Аномалии положения зуба

    DA0E.4 Продовольствие

    DA0E. 5 Малоклюзия

    DA0E.50 Недостаточный приход II класса II

    DA0E.51 Угловой класс I

    DA0E.5Y Другой указанный неправильный ввод

    DA0E.5Z Malocclusion, неопределенный

    DA0E.6 Дентофациальные функциональные аномалии

    DA0E.7 Дентофациальные парафунциональные расстройства

    DA0E.8 Нарушения суставов вен

    DA0E.Y Другие уточненные дисфокальные аномалии

    DA0E.Z Дентофациальные аномалии неуточненные

    DA0F Сенсорные нарушения, влияющие на орофациальный комплекс

    DA0F.0 Синдром горения

    Исключено:

    • 8B82.0 Невралгия тройничного нерва
    • MB41.2 Дисгезия

    DA0F.Y Другие уточненные сенсорные нарушения, влияющие на орофациальный комплекс

    DA0F.Z Чувствительные нарушения, влияющие на орофациальный комплекс, неуточненные

    Исключено:

    • LA31 Структурные аномалии развития рта или языка
    • MD90 Симптомы или признаки орофациального комплекса

    DA0Y Другие уточненные заболевания или расстройства орофациального комплекса

    DA0Z Болезни или нарушения орофациального комплекса, неуточненные

    Микробиом полости рта, связанный с протезами, в здоровье и стоматите

    ВВЕДЕНИЕ

    Как здоровье полости рта, так и микробные обитатели полости рта, в частности, все чаще признаются за их роль в общем здоровье и болезнях человека (1). Установлены связи между микробными инфекциями полости рта и многочисленными системными заболеваниями (2), и предполагается, что биопленки полости рта служат резервуаром для возбудителей инфекционных заболеваний (3). Благодаря сочетанию мягких тканей и твердых поверхностей полость рта представляет собой уникальную среду для колонизации микробов.Совместные усилия ряда исследовательских групп привели к всеобъемлющему инвентаризации микроорганизмов полости рта (4–6). Помимо естественных поверхностей полости рта, микроорганизмы могут эффективно образовывать биопленки на искусственных твердых поверхностях, которые вводятся в процессе реставрации зубов. Образование биопленки на реставрационных материалах положительно коррелирует с более высокой шероховатостью поверхности и ее свободной энергией (7). Среди биопленок, заселяющих искусственные твердые поверхности, те, что образуются на зубных имплантатах, привлекли большое внимание в исследованиях.Здоровые имплантаты содержат очень разные микробиоты по сравнению с зубами (8), и в зависимости от исследования было высказано предположение, что разные виды микробов участвуют в развитии болезни вокруг имплантата (9). Напротив, бактериальные сообщества, заселяющие зубные протезы, еще одну важную искусственную поверхность, присутствующую в полости рта значительной части населения, в значительной степени еще предстоит изучить. Несмотря на то, что некоторые исследовательские группы изучали микробиоту, связанную с зубными протезами (10–17), большинство исследований сосредоточено на особых аспектах, включая определенные группы бактерий или влияние чистящих средств.

    Более 20% людей старше 65 лет в США не имеют всех зубов. С увеличением доли пожилых людей в населении эта доля, вероятно, будет расти (18, 19). Зубные протезы, заселяющие бактерии, составляют важную часть микробиома человека, которую необходимо изучить на предмет их роли в поддержании здоровья полости рта у пожилых людей. Ношение протезов связано с рядом микробных заболеваний, в том числе с воспалением слизистой оболочки зубных протезов (стоматит протезов) (20) и неприятным запахом (21).Предполагается, что протезы служат резервуаром для респираторных патогенов (3, 13) и, таким образом, приводят к повышенному риску легочных инфекций (22). Несмотря на то, что микроорганизмы являются очевидными подозреваемыми в большинстве перечисленных заболеваний, связанных с зубными протезами, об их этиологии известно мало. Большинство исследований, посвященных изучению микроорганизмов, связанных с зубными протезами, сосредоточено на колонизации Candida sp., Который считается важным этиологическим агентом стоматита зубных протезов (23), хотя в это заболевание полости рта также причастны различные виды бактерий (11, 16, 24). ).В настоящее время доступны лишь ограниченные сведения о микробном составе биопленок, растущих на зубных протезах. Необходимо провести сравнение с микробиотой, обитающей на естественных поверхностях ротовой полости, чтобы выяснить, как микроорганизмы, колонизирующие протез, формируют микробиоту полости рта и наоборот. Очень немногие исследования оценивали колонизацию бактериального протеза с использованием независимой от культуры библиотеки клонов и подходов в шахматном порядке (10, 14, 15, 17). На сегодняшний день только в одном недавнем исследовании сообщалось об анализе секвенирования следующего поколения, который предоставил первоначальный анализ преимущественно на уровне класса зубных протезов, колонизирующих микробиоту, соответствующих поверхностей слизистой оболочки и выбранных оставшихся зубов (12). Хотя это важный шаг к пониманию бактериального компонента здоровья и болезней у пользователей зубных протезов, недавняя всесторонняя оценка различных участков полости рта на уровне олиготипа подчеркнула важность определения сообществ на более подробных таксономических уровнях, чтобы лучше понять экологические и функциональные аспекты. разнообразие микробиоты, имеющей отношение к здоровью и болезням (25). Этот уровень анализа все еще отсутствует для микробиоты, связанной с зубными протезами, и соответствующих микробных сообществ на оставшихся зубах владельцев зубных протезов.

    В этом исследовании мы выполнили комплексный анализ микробных биопленок, колонизирующих зубные протезы, на основе секвенирования гена 16S рРНК на уровне родов и видов. Сопоставленные образцы зубных протезов и оставшихся зубов здоровых людей и людей со стоматитом зубных протезов, но без других заболеваний полости рта, были использованы для сравнения факторов, связанных с пациентом и поверхностью. Мы исследовали, являются ли биопленки, присутствующие на этих разных поверхностях, разными, можно ли различить сообщества биопленок, связанных со здоровьем и болезнями, и влияют ли микробные сообщества, присутствующие на разных поверхностях у одних и тех же пациентов, друг на друга. Выявление соответствующих факторов и микроорганизмов, связанных с заболеванием, расширит возможности стоматологов по разработке более целенаправленных подходов к лечению заболеваний, связанных с зубными протезами.

    РЕЗУЛЬТАТЫ

    Характеристики пациентов, сбор образцов и секвенирование. Образцы были собраны индивидуально из зубных протезов и оставшихся зубов 10 здоровых носителей зубных протезов и 10 пациентов со стоматитом зубных протезов, которые в остальном не были подвержены микробным заболеваниям полости рта (см. Материалы и методы). Детали).Мы идентифицировали таксономический состав микробиоты полости рта с помощью 454 пиросеквенирования гипервариабельных областей от V1 до V3 генов 16S рРНК в общей сложности для сорока образцов (один образец зубного протеза и один образец зубного протеза на пациента, собранный, как описано в разделе «Материалы и методы»). Мы получили в общей сложности 106 894 считывания со средней длиной считывания 444 п.н. после удаления низкокачественных и коротких последовательностей, а также химерных последовательностей. Один из образцов, взятых из оставшихся зубов пациента со стоматитом, который дал <1500 считываний, был исключен из дальнейшего анализа вместе с подходящим образцом зубного протеза из-за отсутствия достаточной глубины секвенирования.Для каждого образца было проанализировано в среднем 2739 считываний (диапазон от 1692 до 4975), что обеспечивает достаточную глубину секвенирования, чтобы зафиксировать общее разнообразие образцов (см. Рис. S1 в дополнительном материале).

    Структуры сообщества микробиомов, связанных с зубными протезами и зубами, у здоровых и больных зубных протезов очень похожи. Последовательности гена 16S рРНК обрабатывали, как описано в разделе «Материалы и методы». Двадцать шесть различных родов, представляющих в общей сложности 136 различных видов / филотипов, присутствовали по крайней мере у двух субъектов с относительной численностью> 1% (рис.1). Равномерность и богатство микробного сообщества (альфа-разнообразие) на уровне рода были очень похожи между зубными протезами и оставшимися естественными зубами в состоянии здоровья и болезни (рис. 2А). Структура микробного сообщества (бета-разнообразие) статистически значимо не различалась между четырьмя разными группами (зубные протезы — здоровье; зубные протезы — стоматит; оставшиеся зубы — здоровье; оставшиеся зубы — стоматит), независимо от того, какой аспект исследовался (рис. 2B; см. Рис. S2 в дополнительном материале).Затем мы сравнили отдельные таксоны, присутствующие в образцах, полученных от зубных протезов и естественных зубов одного и того же человека с комбинациями зубной протез, зубной протез и зубной протез от разных людей, используя различие Брея-Кертиса, которое, в отличие от UniFrac, не учитывает филогенетическое родство между членами сообщества. Среднее совпадение филотипов в соответствующих образцах зубных протезов, полученных от одних и тех же участников исследования, было значительно больше (более низкий индекс Брея-Кертиса), чем в различных комбинациях образцов, полученных от разных людей (рис.2С). Таким образом, микробная колонизация разных поверхностей внутри человека кажется более похожей, чем одна и та же поверхность (протезы или оставшиеся зубы) у разных людей.

    Рисунок S2

    Бета-разнообразие (анализ главных координат) микробных сообществ, колонизирующих здоровых людей (зеленый) и пациентов со стоматитом (красный), независимо от поверхности (A) и колонизирующих зубные протезы (синий) и оставшихся зубов (черный), независимо от состояние здоровья полости рта, связанное с зубным протезом (B). Скачать Рисунок S2, файл TIF, 0.4 МБ. Авторские права © 2016 Shi et al.

    Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0.
    .

    Рис. 1

    Состав на уровне рода микробиомов, связанных с зубными протезами и зубами, в условиях здоровья и стоматита. Относительная численность на уровне рода в образцах зубных протезов (вверху) и зубов (внизу), собранных у одних и тех же людей, показана в одном порядке (от h2 до h20, от S1 до S6 и от S8 до S10). Слева показаны образцы от здоровых людей, справа — от пациентов со стоматитом.HD, здоровый протез; SD — протез при стоматите; HT — здоровые оставшиеся зубы; ST, стоматит оставшихся зубов. Роды, присутствующие с относительной численностью> 1% по крайней мере в двух образцах пациентов, были включены в анализ и перечислены справа с соответствующей цветовой кодировкой. Роды, присутствующие при относительной численности <1% или только в одной выборке пациентов, были объединены в категорию «Прочие».

    FIG 2

    Анализ структуры микробного сообщества. (A) Альфа-разнообразие (индекс Шеннона) микробного сообщества между зубными протезами и зубами в состоянии здоровья и болезни, (B) Бета-разнообразие (анализ основных координат [PCoA]) микробных сообществ, колонизирующих зубные протезы (синий) или оставшихся зубов (зеленый ) здоровых людей и больных стоматитом (красные — зубные протезы; желтые — оставшиеся зубы) соответственно.(C) Совместная встречаемость филотипов (рассчитанная как несходство Брея-Кертиса) в образцах зубных протезов и оставшихся зубов от здоровых людей (черные полосы) и пациентов со стоматитом (белые полосы). Филотипы, колонизирующие зубные протезы (D) и зубы (T), сравнивались у одних и тех же людей (DT Same Ind. ), Между разными людьми (DT Different Individuals) и между образцами зубных протезов (DT Different Individuals) и зубов (TT Разные люди). от разных людей. *, P <0.05; **, P <0,001.

    Из 26 идентифицированных родов (см. Рис. S3A в дополнительном материале) 25 были обнаружены в зубных протезах, а 24 колонизированных зуба (см. Рис. S3B) соответствовали вышеуказанным критериям исключения. Eikenella и Abiotrophia в значительном количестве отсутствовали на оставшихся зубах, тогда как род Gemella в значительной степени отсутствовал на зубных протезах. Род Actinomyces был наиболее распространен на обеих поверхностях, зубных протезах и оставшихся зубах, за ним следовали Streptococcus , Veillonella , Capnocytophaga , Neisseria , Prevotella , и Prevotella , и Corynebacterium. более половины протестированных образцов независимо от поверхности или состояния здоровья. Другие роды, отвечающие указанным выше критериям отсечения, включали Rothia , « Candidatus TM7» (« Candidatus G-1»), Leptotrichia , Porphyromonas , Selenomonas 000800080007 Campylobacter. Granulicatella , Haemophilus , Kingella , Fusobacterium , Bacteroidales Candidatus G-5»), « Candidatus TM7» (« Candidatus 0008, Candidatus ). Tannerella и Clostridiales Candidatus F-2», « Candidatus G-5»), а также Gemella , Eikenella и Abiotrophia .Ни одно из видимых различий в распространенности или относительной численности не было значительным.

    Рисунок S3 Роды

    , присутствующие в относительной численности> 1% по крайней мере в двух образцах пациентов, были включены в анализ. Показаны распространенность (a) и средняя относительная численность ± SEM (b) всех образцов (средние серые столбцы) (A), дифференцированных на зубные протезы (темно-серые столбцы) и зубы (светло-серые столбцы) (B), а также в состоянии здоровья. (черные полосы) и стоматит (белые полосы) (C). *, P Рисунок S3, файл TIF, 2.5 МБ. Авторские права © 2016 Shi et al.

    Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0.
    .

    Затем мы провели аналогичный анализ, сравнивая образцы, полученные от здоровых субъектов, с образцами, полученными от пациентов со стоматитом, независимо от поверхности, с которой они были взяты (см. Рис. S3C). Микробиомы здоровых людей содержали только 22 из 26 родов, включенных в анализ. Отсутствующие роды: Fusobacterium , Tannerella , « Candidatus TM7» (« Candidatus G-5») и Eikenella .Микробные сообщества, выделенные от больных стоматитом, содержали все роды, за исключением Gemella . Единственный род, который продемонстрировал значительные различия ( P = 0,026) в относительной численности между здоровьем и заболеванием независимо от поверхности, был Fusobacterium (см. Рис. S3C и S4A).

    Рисунок S4

    Состояние здоровья и болезни и поверхностно-зависимая дифференциальная колонизация на уровне рода и филотипа. Показаны средние значения относительной численности Porphyromonas sp.штамм HOT-279, P. gingivalis и другие связанные с заболеванием бактерии Porphyromonas ( P. cantoniae , P. endodontalis и Porphyromonas sp., штамм HOT-275 вместе взятые) (A) и Campylobacter showae, Capnocytophaga sp. штамм HOT-329 и P. melaninogenica (B). Образцы подразделяются на состояние здоровья (черные столбцы), болезни (белые столбцы), зубные протезы (темно-серые столбцы), зубы (светло-серые столбцы), зубные протезы в состоянии здоровья (синие столбцы), зубные протезы от пациентов со стоматитом (красные столбцы), здоровые зубы. (зеленые столбцы) и зубы больных стоматитом (желтые столбцы).*, P Рисунок S4, файл TIF, 1,3 МБ. Авторские права © 2016 Shi et al.

    Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4. 0.
    .

    Для дополнительных сравнений мы дополнительно разделили образцы на образцы, полученные от зубных протезов и зубов здоровых людей и пациентов с зубным стоматитом (рис. 3). Микробиом зубных протезов от больных стоматитом был самым разнообразным и включал 24 различных преобладающих рода, в то время как на протезах здорового человека было обнаружено только 18 родов.В каждом случае, здоровье и болезнь, оставшиеся зубы состояли из 21, хотя и не идентичного, рода. Некоторые из родов, которые встречались в меньшей степени, были преимущественно обнаружены в определенных условиях. Kingella и Gemella в основном колонизировали зубы здоровых носителей зубных протезов, тогда как Bacteroidales Candidatus G-5») отсутствовали. Eikenella была ограничена больными зубными протезами. Род Porphyromonas соответствовал пороговому значению относительной численности в 1% для всех состояний, кроме больных зубных протезов.В Fusobacterium , Tannerella и « Candidatus TM7» (« Candidatus G-5»), которые были обнаружены преимущественно у пациентов с заболеванием, не было обнаружено поверхностно-зависимых различий.

    Рис. 3

    Распространенность рода и средняя относительная численность микробиомов, ассоциированных с зубными протезами и зубами, в состоянии здоровья и при стоматите. В анализ были включены роды, присутствующие с относительной численностью> 1% по крайней мере в двух образцах пациентов. Показаны распространенность (A) и среднее относительное количество ± SEM (B) на зубных протезах в состоянии здоровья (синие столбцы), на зубных протезах пациентов со стоматитом (красные столбцы), на здоровых зубах (зеленые столбцы) и на зубах у пациентов со стоматитом (желтые полосы).Цифры, которым предшествуют буквы G и F, относятся к еще не названным родам и семействам, соответственно, в пределах указанных типов и порядков.

    Определенные виды / филотипы демонстрируют отчетливую поверхностную колонизацию зубов и зубных протезов, связанную со здоровьем и заболеванием. Дополнительный подробный анализ уровня филотипов видов / был проведен для родов, которые встречались по крайней мере в 10% образцов, чтобы исключить влияние филотипы, которые встречаются только в одном или двух образцах с очень высокой относительной численностью и, следовательно, не являются репрезентативными для данного состояния. Этот анализ показал, что Fusobacterium nucleatum subsp. animalis было обнаружено почти исключительно на зубных протезах больных стоматитом ( P = 0,016). F. nucleatum subsp. vincentii , напротив, был обнаружен в основном на оставшихся зубах пациентов со стоматитом ( P = 0,0097) (рис. 4A), тогда как F. nucleatum subsp. polymorphum и F. periodonticum существенно не различались ни по поверхности, ни по состоянию здоровья (данные не показаны).Несмотря на то, что Streptococcus не выделялись как род, несколько видов, включая Streptococcus gordonii ( P = 0,012), S. sanguinis ( P = 0,049) и S. australis ( P = 0,0215). ), колонизировали зубные протезы здоровых носителей зубных протезов на значительно более высоком уровне (рис. 4B). Интересно, что Porphyromonas sp. штамм HOT-279, филотип рода, часто ассоциируемый с заболеваниями полости рта (26), был значительно более распространен здоровьем ( P = 0. 048) (см. Рис. S4A). Большинство других представителей этого рода были прочно связаны с зубами у больных стоматитом, хотя и в относительно небольшом количестве. Поверхностно-зависимые различия независимо от состояния здоровья / заболевания наблюдались для Campylobacter showae ( P = 0,0173), Capnocytophaga sp. штамм HOT-329 ( P = 0,045) и P. melaninogenica ( P = 0,026), причем первые два присутствуют преимущественно на зубах, а последний значительно больше на поверхностях протезов (см.рис.S4B).

    FIG 4

    Дифференциальная колонизация зубных протезов или зубов при здоровье и болезни на уровне рода и филотипа. Показана средняя относительная численность рода Fusobacterium , а также F. nucleatum subsp. animalis и vincentii (A), S. gordonii, S. sanguinis и S. australis (B). Образцы подразделяются на состояние здоровья (черные столбцы), заболевания (белые столбцы), зубные протезы в состоянии здоровья (синие столбцы), зубные протезы от пациентов со стоматитом (красные столбцы), здоровые зубы (зеленые столбцы) и зубы пациентов со стоматитом (желтые столбцы). .*, P <0,05.

    Кроме того, каждый образец зубного протеза оценивали на наличие Candida с помощью ПЦР. В группе пациентов со стоматитом Candida был обнаружен в 90% образцов по сравнению с 50% образцов из здоровой группы (таблица 1). Несколько видов бактерий, включая Atopobium parvulum, Lachnospiraceae sp. штамм HOT-097 и Veillonella atypica в основном присутствовали в образцах протезов, содержащих Candida , а Leptotrichia sp.штамм HOT-212, за исключением одного пациента, присутствовал только в образцах без Candida .

    ТАБЛИЦА 1

    Оценка образцов зубных протезов на наличие Candida с помощью ПЦР и совместное присутствие с видами / филотипами бактерий

    ОБСУЖДЕНИЕ

    Стоматит зубных протезов в значительной степени изучался в контексте грибковых инфекций, и даже несмотря на то, что был Сделанное несколько десятилетий назад предложение Купманса и его коллег «уделять больше внимания бактериальной популяции при стоматите, вызванном зубными протезами, вместо того, чтобы сосредотачиваться только на Candida albicans» (11), с тех пор этого было сделано мало исследований. Подробный анализ библиотеки клонов (10) дал первое представление о разнообразии бактериальных филотипов, связанных с зубными протезами при здоровье и болезни, в то время как недавнее исследование преимущественно на уровне классов и типов (12) представило современные подходы к секвенированию в этой области. Представленные здесь данные представляют собой первый комплексный анализ на уровне родов и видов бактерий, обитающих в биопленках на зубных протезах и оставшихся зубах здоровых пациентов и пациентов со стоматитом. Важно отметить, что сравнение образцов, взятых из зубных протезов и оставшихся зубов одних и тех же людей, позволило нам проанализировать возможное взаимное влияние бактериальных сообществ, колонизирующих эти различные поверхности, в состоянии здоровья и болезни.

    Наш первоначальный анализ на уровне родов показал, что, в отличие от отдельной микробиоты, связанной со здоровьем и заболеванием, о которой ранее сообщалось для других заболеваний полости рта, таких как пародонтит (27–30), бактериальные сообщества, проживающие на зубных протезах и оставшихся зубах в состоянии здоровья и болезни, скорее похожи друг на друга (рис. 1). Отсутствие различий в составе бактериального сообщества также отражалось в соответствующем альфа- и бета-разнообразии (рис. 2A и B; см. Рис. S2). В соответствии с предыдущими данными о больших индивидуально зависимых вариациях микробиома (29, 31, 32), мы обнаружили, что филотипический состав бактериальных сообществ, растущих на зубных протезах, и сообществ, полученных из оставшихся зубов, были значительно более похожи друг на друга (нижняя часть Брея-Кертиса индекс несходства) в образцах, полученных от одного и того же человека, чем в несвязанных зубных протезах и образцах зубов от разных людей (рис.2С). Это также отражено в наших наблюдениях, что только три филотипа видов / продемонстрировали значительную дифференциальную колонизацию поверхности (см. Рис. S4B). Учитывая это очевидное сильное взаимное влияние бактерий, колонизирующих зубные протезы и зубы у одного и того же человека, здоровье и целостность оставшихся зубов могут быть важным фактором здоровья слизистой оболочки носителей зубных протезов, помимо их роли в закреплении реставраций и поддержании целостности кости. Точно так же состояние слизистой оболочки полости рта, связанное с протезом, может сыграть решающую роль в сохранении оставшихся зубов.

    Кроме того, составы бактериальных филотипов, присутствующие в биопленках, собранных с одной и той же поверхности (зубные протезы или оставшиеся зубы) разных пациентов, были значительно менее похожи друг на друга, чем на сообщества, идентифицированные на сопоставленных образцах зубных протезов у ​​тех же пациентов (рис. . 2С). Это интересно, поскольку считается, что образование биопленок в значительной степени зависит от поверхности (7), и, хотя существует перекрытие, различные естественные поверхности в полости рта заселяются разными сообществами (25).Наши результаты показывают, что индивидуальные факторы могут быть более доминирующими детерминантами состава бактериальной биопленки полости рта, чем поверхности. Одним из важных факторов, влияющих на это явление, может быть слюна, которая покрывает доступные естественные, а также искусственные поверхности полости рта так называемой пленкой (33). Слюна может иметь большие различия между людьми (34, 35) и обеспечивает важные адгезионные белки для прикрепления бактерий (36). Кроме того, наше открытие о том, что факторы, возникающие внутри пациента, могут быть более сильными детерминантами состава сообщества бактериальной биопленки, чем разные поверхности, подчеркивает, что группировка и объединение образцов от разных людей может повлиять на результат анализа.

    Предыдущие исследования, посвященные анализу бактерий, колонизирующих зубные протезы при здоровье и болезнях, не являются окончательными. Подобно нашим результатам, недавнее исследование секвенирования (12) и более старые подходы, основанные на культуре (11, 16, 24), не обнаружили различий в видимом микробном составе между здоровыми пациентами и пациентами со стоматитом и отметили только то, что количество накопленных бляшек значительно больше у больных стоматитом. Напротив, независимое от культуры исследование на основе библиотеки клонов (10) показало, что микробиота биопленок, колонизирующих зубные протезы, при здоровье и болезни различна. Кроме того, в отличие от наших результатов, подробно описанных выше, недавно опубликованное исследование секвенирования (12) описало значительную разницу между составами бактериального сообщества, обнаруженными на поверхности зубных протезов, и на оставшихся зубах. Очевидные расхождения между нашими результатами и предыдущими исследованиями секвенирования на основе гена 16S рРНК могут быть вызваны многими факторами, начиная от географических различий между популяциями пациентов и заканчивая сбором образцов, параметрами секвенирования (выбор целевой области 16S рРНК, используемая платформа секвенирования, доступно для чтения длины и глубины секвенирования, среди прочего), или протоколов экстракции ДНК и ПЦР (37).

    Неудивительно, что мы обнаружили, что Actinomyces , Capnocytophaga , Streptococcus , Veillonella и Neisseria являются наиболее распространенными и многочисленными родами, независимо от поверхности или состояния здоровья / болезни, во всех наших образцах. (Рис. 3; см. Рис. S3). Эти роды являются одними из наиболее распространенных в полости рта и были идентифицированы как основные колонизаторы зубных протезов в предыдущих исследованиях, основанных на культуре и не зависящих от культуры (10–12, 16).В частности, роды Actinomyces и Streptococcus считаются ранними колонизаторами ротовой полости, которые легко прикрепляются к доступным поверхностям, а также друг к другу (38, 39). Они обеспечивают возможность колонизации на поверхности других видов микробов, включая Capnocytophaga и Neisseria , посредством физического связывания, а также метаболических взаимодействий, таких как метаболическая взаимозависимость между видами Veillonella и Streptococcus (40, 41).Другие распространенные роды, присутствующие в образцах, проанализированных в нашем исследовании, включают Corynebacterium , Rothia , несколько родов « Candidatus TM7» и Fusobacterium . Большинство предыдущих исследований, сравнивающих зубной налет в состоянии здоровья и болезни, не идентифицировали эти роды (10–12), хотя в исследовании с шахматной доской, сравнивающем модели колонизации естественных зубов и зубных протезов, было обнаружено, что они колонизируют зубные протезы (15). В соответствии с более ранними исследованиями (10, 12, 23, 24, 42, 43), Candida не ограничивался образцами стоматита зубных протезов, с меньшим количеством положительных образцов здоровых образцов (Таблица 1).В то время как предыдущий анализ уровня класса показал, что колонизация Candida положительно коррелировала с лактобактериями и отрицательно коррелировала с Fusobacteria , для анализируемых здесь образцов этого не было. В нашем исследовании мы наблюдали возможную положительную корреляцию для A. parvulum , Lachnospiraceae sp. штамм HOT-097 (« Candidatus G-4»), Veillonella atypica, а Leptotrichia sp. штамм HOT-212 не присутствовал в образцах, содержащих Candida , за исключением одного здорового пациента. Поскольку мало что известно о взаимодействии между этими видами и Candida , необходимы дальнейшие исследования, чтобы подтвердить актуальность этого наблюдения.

    Несмотря на сходство на уровне сообщества биопленок, отдельные роды и виды значительно различались по встречаемости на определенных поверхностях и / или по состоянию здоровья / болезни пациента, связанному с зубными протезами. Все представители рода Fusobacterium имели очень низкие показатели колонизации здоровых зубных протезов и здоровья в целом (рис.4A), даже несмотря на то, что виды Streptococcus gordonii и S. sanguinis, к которым, как известно, прикрепляются фузобактерии (44, 45), присутствовали в значительно повышенном количестве в этом состоянии (рис. 4B). Эти данные показывают, что в сложной биопленочной среде полости рта факторы, помимо способности связываться друг с другом, играют важную роль в динамике и составе микробного сообщества. Среди различных видов и подвидов Fusobacterium F. nucleatum subsp. polymorphum , F.нуклеатум подвид. Ранее отмечалось, что vincentii и F. periodonticum больше увеличиваются на естественных зубах, чем на зубных протезах (15). В нашем исследовании они показали более высокое относительное количество на естественных зубах при заболевании; однако это различие было значимым только для F. nucleatum subsp. vincentii (рис. 4А). Удивительно, но характер колонизации F. nucleatum subsp. animalis полностью отличался от такового для всех других идентифицированных видов и подвидов фузобактерий, с поразительной почти исключительной колонизацией поверхностей зубных протезов у ​​пациентов со стоматитом (рис.4А). Этот конкретный подвид F. nucleatum был идентифицирован как этиологический агент в отчете о случае, связывающем микробиоту полости рта с мертворождением (46), документально подтверждено, что он более распространен при поддесневом налете и раннем периодонтите (47), а также экспериментальном гингивите (48). ). Кроме того, F. nucleatum subsp. animalis является частью микробной сигнатуры при раннем обнаружении колоректального рака (49) и единственным подвидом фузобактерий /, который, как было обнаружено, перекрывается между микроорганизмами, выделенными из пародонтального кармана, и атероматозной бляшкой у пациентов с сердечными заболеваниями (50).Наше открытие сильной ассоциации F. nucleatum subsp. animalis с воспалительным заболеванием слизистой оболочки стоматитом в сочетании с вышеупомянутыми данными других исследовательских групп предполагает, что этот подвид F. nucleatum может быть более патогенным, чем другие.

    В дополнение к заметному различию между F. nucleatum subsp. животных — , что может иметь отношение к этиологии стоматита, другие микроорганизмы демонстрировали несопоставимые модели колонизации, зависящие от поверхности и / или состояния здоровья.Как уже упоминалось выше, определенные виды Streptococcus показали значительно более высокую распространенность и численность на зубных протезах у здоровых пользователей зубных протезов, чем при всех других условиях (рис. 4B). Среди них S. sanguinis и S. gordonii ранее были связаны со здоровьем полости рта (51–53), а недавнее исследование выявило отчетливое видоспецифичное распределение стрептококков на естественных поверхностях полости рта здоровых людей (25). Дополнительное свидетельство важности анализа, выходящего за пределы уровня рода или типа, обеспечивает картину колонизации родов Fusobacterium и Porphyromonas .В то время как их присутствие сильно коррелировало со здоровьем и болезнью независимо от поверхности при анализе на уровне рода (рис. 4A; см. Рис. S4A), подробный анализ на уровне филотипов видов / дал более дифференцированную картину. Как уже обсуждалось выше, различные представители рода Fusobacterium , присутствующие в наших образцах, демонстрировали четкое распределение в зависимости от состояния поверхности и состояния зубных протезов (рис. 4A). Наше открытие, что Porphyromonas , род, обычно связанный с заболеванием (26), демонстрирует значительную независимую от поверхности ассоциацию со здоровьем (см. рис.S4A) представляет собой пример того, как отсутствие таксономического разрешения может повлиять на результаты и интерпретацию данных. Исследование на уровне филотипов показало, что род Porphyromonas преимущественно представлен в наших выборках Porphyromonas sp. штамм HOT-279, филотип, который в изобилии встречается у здоровых людей, участвовавших в проекте Human Microbiome Project (25, 54). Дополнительные, менее многочисленные представители Porphyromonas (P. gingivalis, P.endodontalis , P. catoniae и Porphyromonas sp. штамм HOT-275) демонстрировали «типичную» ассоциацию с заболеванием этого рода, поскольку они достоверно коррелировали с остальными зубными рядами пациентов со стоматитом (см. рис. S4A). Поскольку эти отчетливые паттерны распределения отдельных представителей определенных родов, связанные со здоровьем и болезнями, очевидны только на уровне филотипа / вида, анализа микробиома на уровне рода не всегда достаточно для получения исчерпывающей картины соответствующих участников, и анализ с более высоким разрешением может иметь решающее значение для глубокого понимания микробиома полости рта в отношении здоровья и болезней.

    В заключение, наше исследование предполагает, что бактериальная микробиота на зубных протезах очень похожа на здоровье и болезнь на более широком уровне сообщества. Это также наблюдалось в отношении зубных протезов и оставшихся зубов независимо от состояния здоровья, особенно в образцах, взятых у одних и тех же людей. Филотипический состав бактериальных сообществ, заселяющих зубные протезы и оставшихся зубов одних и тех же людей, в значительной степени отражает друг друга, что указывает на возможное взаимное влияние состояния здоровья зубных протезов на зубной ряд и наоборот.Наблюдаемое отсутствие четкой микробиоты согласуется с большинством предыдущих отчетов о том, что при заболеваниях полости рта, связанных с зубными протезами, общая микробная нагрузка может иметь большее влияние на развитие стоматита, чем фактический микробный состав зубного налета, обращенного к слизистой оболочке. Несмотря на это общее сходство, мы смогли идентифицировать отдельные виды, такие как F. nucleatum subsp. животных и несколько видов Streptococcus , которые были сильно связаны с образцами больных и здоровых протезов, соответственно.Наши выводы о том, что значительные различия в колонизации наблюдались преимущественно на уровне филотипа / видов, подчеркивают важность анализа на уровне видов / филотипов или даже олиготипов (25).

    МАТЕРИАЛЫ И МЕТОДЫ

    Популяция испытуемых и сбор образцов. Двадцать взрослых добровольцев, носящих зубные протезы, с минимум четырьмя оставшимися зубами и одним полным протезом были набраны для этого исследования под контролем институционального наблюдательного совета No. 2012-0004 гг. — в Западно-Китайский университет (Чэнду, Китай).Согласно опубликованным рекомендациям по диагностике стоматита зубных протезов, десять человек были здоровыми носителями зубных протезов и 10 были пациентами с стоматитом, связанным с зубными протезами (55). В группу здоровых носителей зубных протезов вошли пять женщин и пять мужчин, средний возраст 69,8 ± 4,7 года. Аналогичным образом в группу больных стоматитом вошли пять женщин и пять мужчин со средним возрастом 61,1 ± 12,0 года. У участников исследования не было других активных заболеваний полости рта, таких как кариес или пародонтит.Подходящие люди были системно здоровыми и не принимали никаких рецептурных или безрецептурных лекарств в течение как минимум 6 месяцев. Кроме того, участники исследования не использовали какие-либо биоцидные зубные пасты или средства для очистки зубных протезов в течение последних 6 месяцев. Информированное согласие было получено до сбора образцов и подписано участниками исследования, а также клиницистами и исследовательским персоналом, выполняющими оценку состояния полости рта, сбор и обработку образцов.

    Участникам исследования было предложено носить зубные протезы не менее 3 часов и воздерживаться от еды, питья и чистки зубов или зубных протезов перед взятием образцов налета.Образцы зубного налета были собраны обученным стоматологом с частей розовой акриловой поверхности протеза, которые контактировали с поверхностью слизистой оболочки полости рта, путем наложения стерильных зубочисток круговыми движениями. С помощью аналогичных круговых движений стерильные зубочистки также использовались для получения наддесневого налета с оставшихся зубов. Были приняты меры для сбора с щечных поверхностей зубов, которые не имели прямого контакта с поверхностями протезов. Отдельные образцы зубных протезов и зубного налета, а также контрольные зубочистки помещали в отдельные микроцентрифужные пробирки, содержащие 0.5 мл фосфатно-восстановленного физиологического раствора с пониженным содержанием кислорода и немедленно хранить при -20 ° C до экстракции ДНК.

    Экстракция

    ДНК и секвенирование. Геномную ДНК выделяли из собранных образцов бляшек и соответствующих контролей с помощью стерильных зубочисток с помощью набора DNeasy Blood and Tissue (Qiagen Inc., США), как описано ранее (56), с добавлением взбивания шариков для максимальный лизис клеток (29). Качество и количество ДНК определяли на спектрофотометре NanoDrop 2000 (Thermo, США).После выделения геномной ДНК и количественного определения концентрации ДНК в образцах были нормализованы до 2-6 нг / мкл, и амплификация ПЦР была проведена в соответствии с протоколом, разработанным Human Microbiome Project для секвенирования на титановой платформе 454 FLX (54). Вкратце, гипервариабельные области с V1 по V3 генов 16S рРНК были амплифицированы из очищенной геномной ДНК с праймерами 27F (праймер V1, 5’AGAGTTTGATCCTGGCTCAG3 ‘) и 534R (праймер V3, 5’ATTACCGCGGCTGCTGG3’) с индивидуальной последовательностью адаптера. (5’CCATCTCATCCCTGCGTGTCTCCGACTCAG3 ‘) для праймера 534R и адаптера B (5’CCTATCCCCTGTGTGCCTTGGCAGTCTCAG3’) для праймера 27F и объединены для секвенирования.Были сконструированы библиотеки ампликонов гена 16S рРНК, и было выполнено 454 пиросеквенирование в Объединенном технологическом центре института Дж. Крейга Вентера.

    Анализ таксономического состава микробов. 454 данных пиросеквенирования были демультиплексированы в соответствующие образцы на основе индивидуальных штрих-кодов каждого образца. После того, как штрих-коды были обрезаны, процесс очистки данных был применен ко всем образцам с помощью собственной программы Perl. Вкратце, низкокачественные последовательности, содержащие основания со значением качества Phred <20, были обрезаны с концов считывания.Удаляли последовательности с конечной длиной считывания <300 п.н. или с ≥3% неопределенных оснований. Подозреваемые химеры были идентифицированы и удалены с помощью ChimeraSlayer (57). Последовательности 16S рРНК были сгруппированы в операционные таксономические единицы (OTU) на 97% уровне сходства последовательностей с QIIME (58). Затем OTU были аннотированы с таксономическим назначением путем сравнения репрезентативной последовательности каждой OTU со ссылками на базу данных оральных микробов человека (16S рРНК, RefSeq версии 11.0) (59) с помощью BLAST на основе наилучшего совпадения при> 97% идентичности нуклеотидной последовательности более не менее 95% длины запроса (56).Равномерность и богатство микробного сообщества измеряли по альфа-разнообразию, а сходство между отдельными микробными сообществами измеряли по бета-разнообразию. Альфа-разнообразие (индекс Шеннона), бета-разнообразие (взвешенный и невзвешенный UniFrac), анализ главных координат и оценка глубины секвенирования с помощью анализа разрежения были рассчитаны или выполнены с помощью QIIME (58) на уровне OTU. Роды, присутствующие по крайней мере у двух субъектов с относительной численностью> 1%, были включены в дальнейший анализ уровня филотипов родов и видов /.Таксономический состав каждой выборки был обобщен на уровне родов и видов.

    Обнаружение Candida с помощью ПЦР. Наличие или отсутствие Candida в образцах, взятых с зубных протезов, оценивали с помощью универсальных праймеров ITS1 (5 ‘CTTGTTATTTAGAGGAAGTAA 3’) и ITS2 (5 ‘GCTGCGTTCTTCATCATGC 3’) (60) следующие условия цикла: 94 ° C в течение 11 минут, затем 35 циклов 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд и 72 ° C в течение 30 секунд с последним 30-минутным продлением при 72 ° C.

    Статистический анализ. Данные представлены как среднее значение ± стандартная ошибка среднего (SEM), если не указано иное. Все наборы данных были проверены на предмет их свойств распределения с помощью теста Шапиро-Уилка перед анализом. Статистическая проверка различий в относительной численности распределения родов и видов между различными группами выборки была проверена с помощью U-критерия Манна-Уитни для попарных сравнений (протезы против зубов; здоровье против стоматита) и теста Краскела-Уоллиса для сравнения нескольких групп ( зубные протезы против зубов в здоровье и болезни).Различия в распространенности родов и филотипов между несколькими группами оценивали с помощью точного критерия Фишера. Несходство Брея-Кертиса было использовано для оценки совпадения бактериальных филотипов на зубных протезах и зубах, полученных от одних и тех же людей, по сравнению с зубными протезами и зубами от разных людей и только зубными протезами или только зубами от разных людей. Результаты несходства Брея-Кертиса были дополнительно проанализированы с помощью двустороннего непарного теста t и дисперсионного анализа.Вся статистика была проведена с соответствующими функциями в R Studio, Prism и Excel, в то время как непараметрический многомерный анализ anosim в mothur (61) использовался для проверки того, является ли сходство микробиома в группах статистически значимым от сходства между группами. Значения P были скорректированы для многократного тестирования микробных таксонов с p.adjust в R с использованием коэффициента ложного обнаружения (62).

    Доступность данных. Набор данных, подтверждающих выводы этой статьи, доступен в NCBI BioProject под инвентарным номером PRJNA2

    .

    Молекулярное профилирование бактериальной микробиоты, связанной со стоматитом, связанным с зубными протезами

    Демографические данные пациентов

    В исследование были включены 19 пациентов (стоматит зубных протезов (DS) n = 8; стоматит без зубных протезов (NoDS) n = 11). Демографические и клинические данные субъектов представлены в таблице 1. Образцам был присвоен анонимный ссылочный номер (S001-S019). Идентификатор образца включает ссылку на образец сайта; где T обозначает язык, P — слизистую оболочку неба, а D — поверхность, подходящую для протеза ( e . г . S001T, образец языка пациента 1).

    Таблица 1 Демографические данные пациентов, записанные при наборе для каждого отдельного пациента (анонимно).

    Было набрано больше женщин (n = 11), чем мужчин (n = 8), и аналогичный средний возраст 69,64 года (± 13,84) и 64,88 года (± 7,14) был очевиден для обоих полов, соответственно. Из набранных пациентов восемь (42,1%) были курильщиками.

    Восемь пациентов имели СД в различной степени (женщины n = 6; мужчины n = 2), тогда как 11 человек не имели признаков СД (женщины n = 5; мужчины n = 6).

    Обнаружение

    Candida видов с помощью культивирования и ПЦР

    Обнаружение Candida подробно описано в таблице 2. Пациенты, которые были положительными на Candida либо с помощью агаризованной культуры, либо с помощью вложенной ПЦР, были включены в анализ профилирования бактериального сообщества.

    Таблица 2 Наличие Candida и предполагаемая идентификация посевом и ПЦР.

    Несколько образцов, которые не показали роста Candida на агаровой культуре, дали положительный результат на Candida методом вложенной ПЦР.Это были образцы S003D, S006P, S006D, S007T, S007D, S008T, S008P, S013D, S014P, S015D. В этих примерах описания D, P и T обозначают зубные протезы, нёбо и язык соответственно. И наоборот, Candida не был обнаружен молекулярным тестированием образца S014T, но был обнаружен посевом.

    Из каждого типа образцов ( i . e . Язык, небо или зубной протез) на SDA несколько типичных колоний пересевали на агар CHROMagar® Candida . Чашки с агаром инкубировали в течение 48 часов, после чего наблюдали бирюзово-зеленый цвет колоний, что указывает на предполагаемую идентификацию C . Альбиканс .

    Вложенная ПЦР в реальном времени была использована для идентификации Candida в образцах до уровня вида. Ампликоны наблюдались в канале pan- Candida для многочисленных образцов, но не обнаруживались в C . glabrata или C . krusei зондирующих каналов, что исключает присутствие этих видов. Эти результаты, если рассматривать их вместе с результатами культивирования, указали на присутствие Candida , предположительно C . albicans во всех протестированных образцах и последующие тесты на зародышевые трубочки подтвердили способность изолятов образовывать гифы в присутствии сыворотки.

    Метатаксономическое профилирование видов бактерий, присутствующих в образцах мазков

    Из 57 собранных образцов 55 были обработаны для секвенирования ДНК. Пять не смогли получить ампликоны на первичной стадии, поэтому оставшиеся 50 образцов были использованы в последующих анализах. Всего было получено 2 194 967 считываний последовательностей, а после этапов контроля качества общее количество окончательных считываний составило 1 864 575.Для нормализации между выборками OTU были подвергнуты подвыборке до наименьшего количества считываний (S019P) из 10 995 считываний.

    Пациенты были сгруппированы по статусу болезни и . и . наличие или отсутствие клинических симптомов DS (DS или NoDS, соответственно) и проанализированы. Всего было идентифицировано 2411 OTU, 353 из которых имели более десяти считываний последовательностей. В анализ были включены роды и виды бактерий с десятью или более прочтениями последовательностей.

    Дублирующиеся виды бактерий (которые могут возникать из-за вариации последовательности штаммов) при филотипической классификации были объединены вместе с данными об их ОТЕ и относительной доле.Таким образом, общее количество уникальных видов бактерий было меньше, чем количество обнаруженных OTU. Оба рассматривались независимо для целей настоящего исследования.

    Различия в бактериальной микробиоте пациентов с СД и без СД

    Количества и относительные пропорции бактериальных родов сравнивались на участках выборки (например, DS по сравнению с NoDS в образцах языка, неба и поверхности, подходящей для протезирования), а также между участками отбора проб , например (язык DS по сравнению с небом DS по сравнению с протезом DS).Никаких существенных различий ( P > 0,05) не было обнаружено при сравнении внутри или между участками выборки для количества родов при рассмотрении пациентов, сгруппированных по состоянию болезни и участку выборки (рис. 1A). Точно так же не было обнаружено значимых ( P = 0,191) различий при анализе пациентов, сгруппированных только по статусу заболевания (рис. 1B).

    Рисунок 1

    График разброса количества уникальных родов бактерий, сгруппированных по участку образца ( A ) и состоянию DS, и только состоянию DS ( B ).Количество родов бактерий для каждого пациента, сгруппированное как по участку образца, так и по состоянию DS, и только по состоянию DS, с отображением разброса и столбцов ошибок представляет стандартное отклонение. Сходное среднее количество родов бактерий было очевидным во всех группах без статистически значимых различий.

    Количество уникальных OTU определялось для каждой выборки (индекс Чао) (рис. 2). Количество уникальных OTU в образцах поверхности, прилегающей к зубному протезу (рис. 2A), не показало значительных различий ( P = 0.806) между пациентами DS и NoDS. Точно так же образцы слизистой оболочки неба (рис. 2B) у тех же пациентов показали небольшое увеличение количества уникальных видов бактерий для пациентов с NoDS, но это не было статистически значимым ( P = 0,104). Тем не менее, значительное ( P = 0,007) увеличение количества уникальных видов бактерий наблюдалось в образцах с языка (рис. 2C) у пациентов с NoDS по сравнению с пациентами с DS.

    Рис. 2

    График в виде прямоугольников и усов, показывающий анализ индекса Чао для каждого участка отбора проб.Количество уникальных бактериальных операционных таксономических единиц (OTU) для пациентов с DS (синий) по сравнению с пациентами без DS (красный) в образцах ( A ) поверхности протезирования, ( B ) поверхности слизистой оболочки неба и () C ) язычок. Значительное ( P = 0,007) уменьшение количества обнаруженных OTU наблюдалось в образцах с языка пациентов с DS, но наблюдались сильные сходства в образцах поверхности, подходящей для протезирования, и неба.

    Рассчитан индекс Шеннона (рис.3) в качестве показателя численности и равномерности распределения OTU, чтобы указать на разнообразие в выборках. Никаких существенных различий ( P > 0,05) не наблюдалось между пациентами с DS и NoDS для любого участка выборки. Это свидетельствовало о том, что частота OTU была более равномерно распределена по всей популяции, чем кластеры с более высокой относительной численностью, связанные с меньшей группой конкретных видов бактерий. Для образцов NoDS со слизистой оболочки неба наблюдался немного более высокий индекс Шеннона, чем для образцов DS, что указывает на то, что различия в равномерности распределения между частотой встречаемости видов бактерий могли присутствовать, но различия были незначительными и незначительными.

    Рис. 3

    График в виде прямоугольников и усов, показывающий анализ индекса Шеннона для каждого участка отбора проб. Богатство и равномерность распределения связаны с обилием бактериальных операционных таксономических единиц (OTU) у пациентов с DS (синий) по сравнению с пациентами без DS (красный) в образцах ( A ) поверхности, подходящей для протезирования, ( B ) ) поверхность слизистой оболочки неба и ( C ) язык. Общее увеличение индекса Шеннона для каждого участка выборки указывает на большее разнообразие и более равномерное распределение численности в выборках от пациентов без клинических проявлений СД по сравнению с пациентами с СД.

    Сообщества микроорганизмов могут быть сгруппированы по общему сходству бактериальной микробиоты и представлены графически, чтобы показать, являются ли кластеры отдельными или нет. Если группы образцов перекрываются, они не считаются разнородными. Неметрические графики многомерного масштабирования были созданы для каждого участка выборки (рис. 4). Распространение точек данных и тенденции, обозначенные эллипсами групп пациентов с DS и NoDS, значительно перекрывались в этом анализе для всех участков выборки.Это указывало на то, что бактериальная микробиота в целом не считалась отдельной, но как таковая показывала большее общее сходство между здоровым и болезненным состояниями. Разброс результатов указывает на некоторые различия между образцами и врожденную вариабельность между пациентами.

    Рисунок 4

    Графики неметрической многомерной шкалы (NMDS) для стоматита, связанного с зубными протезами (DS), по сравнению с группами без DS (NoDS). Метод ординации NMDS: анализ образцов в группах DS и NoDS для каждого участка выборки для выявления отдельных кластеров групп.( A ) Поверхность, подходящая к протезу, ( B ) поверхность слизистой оболочки неба и ( C ) язык. Наблюдались перекрывающиеся группы образцов, поэтому общая бактериальная микробиота не была различима.

    Наличие и различия в относительной численности бактерий, проанализированных на уровне родов и видов

    Несмотря на отсутствие очевидных различий в родовой микробиоте при совокупном рассмотрении (рис. 5) при анализе различий относительной численности между DS и NoDS в каждом образце site, были обнаружены поразительные отличия.Данные, представленные на рис. 5 (с соответствующими конкретными числовыми пропорциями, представленными в дополнительных таблицах S1 – S3) демонстрируют долю каждого обнаруженного рода как среднее значение для всех участников в этой выборочной группе, где наблюдались многие существенные различия. В образцах поверхности, подходящей для протезирования (рис. 5A, B), наблюдался ряд сдвигов, особенно в родах, связанных с 15 ведущими родами по средней численности. В образцах, связанных с DS, было очевидным увеличение относительной численности Streptococcus , Pseudomonas и Stenotrophomonas с уменьшением относительной численности Actinomyces , Serratia и Rhizobium .

    Рисунок 5

    Графические представления круговой диаграммы, показывающие среднюю относительную численность родов бактерий на каждом участке отбора проб. Топ-15 бактериальных родов (по средней численности) в образцах поверхности, подходящей для протезирования от пациентов ( A ) с DS и ( B ) без DS, образцы неба от пациентов ( C ) с DS и ( D ) без DS, а также образцы языка пациентов ( E ) с DS и ( F ) без DS.

    Сдвиги в относительной численности родов также наблюдались в образцах из других участков, включая значительное увеличение относительной численности, наблюдаемое у Streptococcus , Masillia и Acinetobacter в образцах неба (рис. 5C, D) и Streptococcus и Enterococcus в образцах языка (рис. 5E, F). Значительное уменьшение количества родов, включая Serratia , Lactobacillus и Flavobacterium , было очевидным в образцах неба, и аналогичным образом снижение у Serratia и Flavobacterium наблюдалось в образцах языка.

    При рассмотрении микробиоты на уровне видов, относительная доля различных видов бактерий значительно варьировалась между образцами и пациентами (рис. 6; дополнительные таблицы S4–6). В целом, 25 основных видов бактерий по средней численности составляли более 85% от общей численности видов бактерий, а в случае образцов со слизистой оболочки неба у пациентов с DS — 98% от общей численности.

    Рисунок 6

    Средняя относительная численность 10 основных видов бактерий, общих для групп пациентов с DS (синий) и NoDS (красный), в образцах поверхности, подходящей для протезирования ( A ), ( B ) неба, и ( C ) язычок.

    Сотни уникальных видов бактерий были обнаружены в каждом из образцов. Многие виды были уникальными для пациентов с DS или NoDS и могут способствовать возникновению DS. Однако среди видов бактерий, обнаруженных как у пациентов с DS, так и у пациентов с NoDS, были обнаружены некоторые существенные различия в относительной численности (рис. 6).

    В образцах поверхностей, прилегающих к зубным протезам пациентов с NoDS (рис. 6A), относительные доли Acinetobacter johnsonii и Streptococcus mitis были почти в три раза выше по сравнению с пациентами с DS, а доля Actinomyces odontolyticus были почти в шесть раз выше.Также наблюдались дополнительные различия, но в меньшей степени. Они включали снижение присутствия Pseudomonas putida , A . lwoffii , Lactobacillus salivarius и небольшое уменьшение A . lingnae в образцах от пациентов с NoDS. Более того, два из трех наиболее распространенных видов бактерий в образцах прилегающей поверхности протеза были уникальными для группы DS. К ним относятся неизвестные виды в пределах рода Myroides и Pseudomonas fluorescens с относительной численностью около 8.5% и 7,2% соответственно. Присутствие Myroides не было обнаружено ни на одном другом участке отбора проб.

    Дальнейшие различия наблюдались для микробиоты слизистой оболочки неба (рис. 6B). Pseudomonas fluorescens. был бактериальным видом с наибольшей представленностью у пациентов с DS, но также был обнаружен у пациентов с NoDS. Тем не менее, была существенная разница в средней относительной численности с уменьшением с 19,99% у пациентов с DS до 2,34% у пациентов с NoDS.Это была самая большая разница для всех видов бактерий, независимо от места отбора пробы. Кроме того, было очевидным более чем шестикратное увеличение доли Brevundimonas vesicularis у пациентов с NoDS по сравнению с пациентами с DS. И наоборот, снижение на S . oralis , Chrysobacterium spp., B . terrae и небольшое уменьшение A . johnsonii наблюдались у пациентов с NoDS. Как было также очевидно на образцах посадочной поверхности зубных протезов, в группах DS и NoDS был обнаружен ряд уникальных видов бактерий.

    Streptococcus salivarius был обнаружен с наибольшей относительной численностью в образцах с языка (рис. 6C). Небольшое снижение наблюдалось между пациентами с DS и NoDS примерно на 3% (DS = 18,41%, NoDS = 15,37%), но численность все еще была выше, чем у всех других бактерий, обнаруженных в образцах языка пациентов с DS или NoDS. Большие различия наблюдались в доле P . fluorescens между DS (12,48%) и NoDS (2,06%) и S . mitis (DS = 6,09%, NoDS = 11,18%). Меньшие различия наблюдались с другими видами бактерий, общими между пациентами с DS и NoDS, но их пропорциональный вклад в микробиоту составлял примерно 2% или меньше, поэтому степень различий была менее очевидной.

    Когда пациенты были разделены на подгруппы по статусу курения, были очевидны некоторые четкие различия в относительной численности OTU. Сильное сходство в количестве ОТЕ, обнаруженных в образцах поверхности, подходящей для протезирования, было очевидным между курильщиками и некурящими, независимо от состояния СД (рис.7А). Однако в образцах из биотических участков (рис. 7B, C) у курильщиков с DS было значительно меньшее количество обнаруженных OTU, чем во всех других группах ( P <0,05 по сравнению с некурящими с DS и некурящими без DS. , и P <0,01 по сравнению с курильщиками с DS), так что в образцах с языка (рис. 7C).

    Рис. 7

    Ящики и усы, показывающие анализ индекса Чао, с образцами, сгруппированными по участку отбора пробы, состоянию DS и подгруппам по статусу курения. Значительное снижение наблюдалось у курильщиков с DS по сравнению с некурящими с DS и некурящими без DS ( P <0.05) и курильщики без DS ( P <0,01) в образцах языка, но не наблюдали значительных различий в образцах поверхности, прилегающей к зубному протезу. Образцы неба показали сходную тенденцию с образцом языка, но не имели статистической значимости.

    Микробиота слизистой оболочки и слюны, ассоциированная с рецидивирующим афтозным стоматитом | BMC Microbiology

  • 1.

    Aas JA, Paster BJ, Stokes LN, Olsen I., Dewhirst FE. Определение нормальной бактериальной флоры полости рта.J Clin Microbiol. 2005; 43: 5721–32.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 2.

    Скалли С., Феликс Д.Х. Оральная медицина — обновление для практикующего стоматолога. Афтозные и другие распространенные язвы. Бр Дент Дж. 2005; 199: 259–64.

    CAS
    Статья
    PubMed

    Google ученый

  • 3.

    Слебиода З., Шпонар Э., Ковальска А. Этиопатогенез рецидивирующего афтозного стоматита и роль иммунологических аспектов: обзор литературы.Arch Immunol Ther Exp (Warsz). 2014; 62: 205–15.

    CAS
    Статья

    Google ученый

  • 4.

    Гувер К.И., Олсон Дж. А., Гринспен Дж. С.. Гуморальные ответы и перекрестная реактивность на стрептококки viridans при рецидивирующем афтозном изъязвлении. J Dent Res. 1986; 65: 1101-4.

  • 5.

    Riggio MP, Lennon A, Ghodratnama F, Wray D. Отсутствие ассоциации между Streptococcus oralis и рецидивирующим афтозным стоматитом. J Oral Pathol Med.2000; 29: 26–32.

    CAS
    Статья
    PubMed

    Google ученый

  • 6.

    Хасан А., Чайлдерстон А., Первин К., Шинник Т., Мидзусима Ю., Ван дер Зи Р. и др. Распознавание уникального пептидного эпитопа микобактериального антигена белка теплового шока человека 65-60 Т-клетками пациентов с рецидивирующими язвами полости рта. Clin Exp Immunol. 1995; 99: 392–7.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 7.

    Адлер I, Муйно А., Агуас С., Харада Л., Диас М., Ленс А. и др. Helicobacter pylori и патология полости рта: связь с инфекцией желудка. Мир J Gastroenterol. 2014; 20: 9922–35.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 8.

    Mansour-Ghanaei F, Asmar M, Bagherzadeh AH, Ekbataninezhad S. Инфекция Helicobacter pylori в поражениях полости рта у пациентов с рецидивирующим афтозным стоматитом. Med Sci Monit. 2005; 11: CR576–9.

    PubMed

    Google ученый

  • 9.

    Marchini L, Campos MS, Silva AM, Paulino LC, Nobrega FG. Бактериальное разнообразие афтозных язв. Устные Microbiol Immunol. 2007. 22: 225–31.

    CAS
    Статья
    PubMed

    Google ученый

  • 10.

    Ваврика С.Р., Шопфер А., Шарл М., Лакатос П.Л., Наварини А., Роглер Г. Внекишечные проявления воспалительного заболевания кишечника.Воспаление кишечника. 2015; 21: 1982–92.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 11.

    Саид Х.С., Суда В., Накагоме С., Чинен Х., Осима К., Ким С. и др. Дисбиоз микробиоты слюны при воспалительном заболевании кишечника и его связь с оральными иммунологическими биомаркерами. ДНК Res. 2014; 21: 15–25.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 12.

    Хиджази К., Лоу Т., Мехарг С., Берри С.Х., Фоли Дж., Держи ГЛ. Микробиом слизистой оболочки у пациентов с рецидивирующим афтозным стоматитом. J Dent Res. 2015; 94: 87С – 94С.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 13.

    Bankvall M, Sjöberg F, Gale G, Wold A, Jontell M, Östman S. Микробиота полости рта пациентов с рецидивирующим афтозным стоматитом. J Oral Microbiol. 2014; 6: 25739.

    PubMed

    Google ученый

  • 14.

    Сеуди Н., Бергмайер Л.А., Дробневски Ф., Пастер Б., Форчун Ф. Микробное сообщество слизистой оболочки полости рта и слюны при синдроме Бехчета и рецидивирующем афтозном стоматите. J Oral Microbiol. 2015; 7: 27150.

    PubMed

    Google ученый

  • 15.

    Chun J, Kim KY, Lee JH, Choi Y. Анализ микробных сообществ ротовой полости мышей дикого типа и мышей с дефицитом toll-подобного рецептора 2 с использованием пиросеквенатора 454 GS FLX Titanium. BMC Microbiol. 2010; 10: 101.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 16.

    Laheij AM, de Soet JJ, Veerman EC, Bolscher JG, van Loveren C. Влияние бактерий полости рта на миграцию эпителиальных клеток in vitro. Медиаторы Inflamm. 2013; 2013: 154532.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 17.

    Сегата Н., Хааке С.К., Маннон П., Лимон К.П., Уолдрон Л., Геверс Д. и др.Состав бактериального микробиома пищеварительного тракта взрослого человека на основе семи образцов поверхностей рта, миндалин, горла и стула. Genome Biol. 2012; 13: R42.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 18.

    Wolfgang WJ, Passaretti TV, Jose R, Cole J, Coorevits A, Carpenter AN, et al. Neisseria oralis sp. nov., выделенный из здорового десневого налета и клинических образцов. Int J Syst Evol Microbiol. 2013; 63: 1323–8.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 19.

    Chaudhary HJ, Peng G, Hu M, He Y, Yang L, Luo Y, et al. Генетическое разнообразие эндофитных диазотрофов дикого риса Oryza alta и идентификация нового диазотрофа Acinetobacter oryzae sp. ноя Microb Ecol. 2012; 63: 813–21.

    CAS
    Статья
    PubMed

    Google ученый

  • 20.

    Vos M, Velicer GJ. Изоляция по расстоянию в спорообразующей почвенной бактерии Myxococcus xanthus. Curr Biol. 2008; 18: 386–91.

    CAS
    Статья
    PubMed

    Google ученый

  • 21.

    Зейферт Х., Дейксхорн Л., Гернер-Смидт П., Пельцер Н., Тьернберг И., Ваничут М. Распространение видов Acinetobacter на коже человека Сравнение методов фенотипической и генотипической идентификации. J Clin Microbiol. 1997; 35: 2819–25.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 22.

    Turton JF, Shah J, Ozongwu C, Pike R. Распространенность видов Acinetobacter, отличных от A. baumannii, среди клинических изолятов Acinetobacter: данные о новых видах. J Clin Microbiol. 2010; 48: 1445–9.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 23.

    Joossens M, Huys G, Cnockaert M, De Preter V, Verbeke K, Rutgeerts P, et al. Дисбиоз фекальной микробиоты у пациентов с болезнью Крона и их здоровых родственников.Кишечник. 2011; 60: 631–7.

    Артикул
    PubMed

    Google ученый

  • 24.

    Willing BPDJ, Halfvarson J, Andersson AF, Lucio M, Zheng Z, Jarnerot G, et al. Исследование пиросеквенирования у близнецов показывает, что микробный профиль желудочно-кишечного тракта зависит от фенотипа воспалительного заболевания кишечника. Гастроэнтерология. 2010; 139: 1844–54.

    Артикул
    PubMed

    Google ученый

  • 25.

    Murad CF, Sassone LM, Faveri M, Hirata Jr R, Figueiredo L, Feres M. Микробное разнообразие устойчивых инфекций корневых каналов исследовано с помощью гибридизации ДНК-ДНК в шахматном порядке. Дж. Эндод. 2014; 40: 899–906.

    CAS
    Статья
    PubMed

    Google ученый

  • 26.

    Li A, Tambyah P, Chan D, Leong KK. Capnocytophaga sputigena empyema. J Clin Microbiol. 2013; 51: 2772–4.

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 27.

    Gomez-Garces JL, Alos JI, Sanchez J, Cogollos R. Бактериемия, вызванная множественной лекарственной устойчивостью Capnocytophaga sputigena. J Clin Microbiol. 1994; 32: 1067–9.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 28.

    Гриффен А.Л., Билл С.Дж., Кэмпбелл Дж.Х., Файерстоун Н.Д., Кумар П.С., Ян З.К. и др. Отчетливые и сложные бактериальные профили пародонтита и здоровья человека, выявленные пиросеквенированием 16S. ISME J. 2012; 6: 1176–85.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 29.

    Хансен Р., Рассел Р.К., Рейфф К., Луи П., Макинтош Ф., Берри С.Х. и др. Микробиота педиатрической ВЗК de novo: увеличение Faecalibacterium prausnitzii и снижение бактериального разнообразия при болезни Крона, но не при язвенном колите. Am J Gastroenterol. 2012; 107: 1913–22.

    CAS
    Статья
    PubMed

    Google ученый

  • 30.

    Ye Y, Carlsson G, Agholme MB, Wilson JA, Roos A, Henriques-Normark B, et al. Динамика бактериального сообщества полости рта у педиатрических пациентов со злокачественными новообразованиями в отношении мукозита полости рта, связанного с химиотерапией — проспективное исследование.Clin Microbiol Infect. 2013; 19: E559–67.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 31.

    Huber T, Faulkner G, Hugenholtz P. Bellerophon: программа для обнаружения химерных последовательностей при множественном выравнивании последовательностей. Биоинформатика. 2004; 20: 2317–9.

    CAS
    Статья
    PubMed

    Google ученый

  • 32.

    Чун Дж., Ли Дж. Х., Юнг Й, Ким М., Ким С., Ким Б. К. и др.EzTaxon: веб-инструмент для идентификации прокариот на основе последовательностей гена 16S рибосомной РНК. Int J Syst Evol Microbiol. 2007; 57: 2259–61.

    CAS
    Статья
    PubMed

    Google ученый

  • 33.

    Hamady M, Lozupone C, Knight R. Fast UniFrac: обеспечение высокопроизводительного филогенетического анализа микробных сообществ, включая анализ данных пиросеквенирования и PhyloChip. ISME J. 2010; 4: 17–27.

    CAS
    Статья
    PubMed
    PubMed Central

    Google ученый

  • 34.

    Консорциум проекта по микробиому человека. Структура, функции и разнообразие микробиома здорового человека. Природа. 2012; 486: 207–14.

    Артикул

    Google ученый

  • 35.

    Шин Дж, Джи С., Чой Й. Способность бактерий полости рта индуцировать разрушающие ткань молекулы нейтрофилов человека. Oral Dis. 2008. 14: 327–34.

    CAS
    Статья
    PubMed

    Google ученый

  • 36.

    Ким И, Джо АР, да Джанг Х, Чо Й Дж, Чун Дж, Мин Б.М. и др. Toll-подобный рецептор 9 опосредует индуцированную бактериями полости рта экспрессию IL-8 в эпителиальных клетках десен. Immunol Cell Biol. 2012; 90: 655–63.

    CAS
    Статья
    PubMed

    Google ученый

  • 37.

    Park NH, Min BM, Li SL, Huang MZ, Cherick HM, Doniger J. Иммортализация нормальных кератиноцитов ротовой полости человека вирусом папилломы человека 16 типа. Канцерогенез. 1991; 12: 1627–31.

    CAS
    Статья
    PubMed

    Google ученый

  • Какова роль микробной инфекции в этиологии афтозного стоматита (язвы)?

  • Crivelli MR, Aguas S, Adler I, Quarracino C, Bazerque P. Влияние социально-экономического статуса на распространенность поражения слизистой оболочки полости рта у школьников. Community Dent Oral Epidemiol . 1988 16 февраля (1): 58-60. [Медлайн].

  • Шульман ЖД.Исследование точечной, годовой и продолжительности жизни для характеристики рецидивирующего афтозного стоматита у детей и подростков в США. Дж. Орал Патол Мед . 2004 Октябрь 33 (9): 558-66. [Медлайн].

  • Axéll T, Henricsson V. Возникновение рецидивирующих афтозных язв у взрослого населения Швеции. Acta Odontol Scand . 1985 Май. 43 (2): 121-5. [Медлайн].

  • Embil JA, Стивенс Р.Г., Мануэль FR. Распространенность рецидивов герпеса на губах и афтозных язв среди молодых людей на шести континентах. Кан Мед Ассо Дж. . 1975, 4 октября. 113 (7): 627-30. [Медлайн].

  • Axéll T. Исследование распространенности поражений слизистой оболочки полости рта среди взрослого населения Швеции. Odontol Revy Suppl . 1976. 36: 1-103. [Медлайн].

  • Робледо-Сьерра Дж., Матссон Ю., Сведенстен Т., Йонтелл М. Заболеваемость поражениями слизистой оболочки полости рта у взрослого населения Швеции. Med Oral Patol Oral Cir Bucal . 2013 г. 1. 18 (5): e766-72. [Медлайн].

  • Cebeci AR, Gülşahi A, Kamburoglu K, Orhan BK, Oztaş B.Распространенность и распространение поражений слизистой оболочки полости рта среди взрослого населения Турции. Med Oral Patol Oral Cir Bucal . 2009 г., 1. 14 (6): E272-7. [Медлайн].

  • Mumcu G, Cimilli H, Sur H, Hayran O, Atalay T. Распространенность и распределение поражений полости рта: перекрестное исследование в Турции. Устные сообщения . 2005 марта 11 (2): 81-7. [Медлайн].

  • Сафади РА. Распространенность рецидивирующих афтозных язв у стоматологических пациентов в Иордании. BMC Oral Health . 2009 22 ноября, 9:31. [Медлайн].

  • Davatchi F, Tehrani-Banihashemi A, Jamshidi AR, et al. Распространенность орального афтоза среди нормального населения в Иране: исследование COPCORD ВОЗ-ILAR. Арч Иран Мед . 2008 марта 11 (2): 207-9. [Медлайн].

  • Абдулла MJ. Распространенность рецидивов афтозных язв у пациентов, посещающих стоматологическое отделение Piramird в городе Сулаймани. J Clin Exp Dent .2013 г. 1. 5 (2): e89-94. [Медлайн].

  • Бхатнагар П., Рай С., Бхатнагар Дж., Каур М., Гоэль С., Прабхат М. Исследование распространенности поражений слизистой оболочки полости рта, вариантов слизистой оболочки и лечения, необходимого для пациентов, поступающих в стоматологическую школу в Северной Индии: в соответствии с рекомендациями ВОЗ. J Family Community Med . 2013 20 января (1): 41-8. [Медлайн].

  • Thangadurai M, Andamuthu Y, Srinivasan A, Abikshyeet P, Kumar SJS, Vilvanathan V. Распространенность и семейный анамнез рецидивирующего афтозного стоматита среди студентов стоматологического учреждения на юге Индии. J Indian Acad Dental Specialist Researchers . 2014. 1 (2): 53-55.

  • Field EA, Brookes V, Tyldesley WR. Рецидивирующие афтозные язвы у детей — обзор. Int J Paediatr Dent . 1992 апр. 2 (1): 1-10. [Медлайн].

  • Lopez-Jornet P, Camacho-Alonso F, Martos N. Гематологическое исследование пациентов с афтозным стоматитом. Инт Дж Дерматол . 2014 Февраль 53 (2): 159-63. [Медлайн].

  • Sun A, Chen HM, Cheng SJ, Wang YP, Chang JY, Wu YC и др.Значительная связь дефицита гемоглобина, железа, витамина B12 и фолиевой кислоты и высокого уровня гомоцистеина с рецидивирующим афтозным стоматитом. Дж. Орал Патол Мед . 2015 Апрель 44 (4): 300-5. [Медлайн].

  • Gallo Cde B, Mimura MA, Sugaya NN. Психологический стресс и рецидивирующий афтозный стоматит. Клиники (Сан-Паулу) . 2009. 64 (7): 645-8. [Медлайн]. [Полный текст].

  • Huling LB, Baccaglini L, Choquette L, Feinn RS, Lalla RV.Влияние стрессовых жизненных событий на возникновение и продолжительность рецидивирующего афтозного стоматита. Дж. Орал Патол Мед . 2012 Февраль 41 (2): 149-52. [Медлайн]. [Полный текст].

  • Макфейл Л.А., Гринспен Д., Фейгал Д.В., Леннетт И.Т., Гринспен Дж. С.. Рецидивирующие афтозные язвы, связанные с ВИЧ-инфекцией. Описание типов язв и анализ субпопуляций Т-лимфоцитов. Oral Surg Oral Med Oral Pathol . 1991 июн. 71 (6): 678-83. [Медлайн].

  • Бертон-Ки Дж. Э., Моубрей Дж. Ф., Ленер Т.Различные перекрестно реагирующие циркулирующие иммунные комплексы при синдроме Бехчета и рецидивирующих язвах полости рта. Дж. Лаборатория Клин Мед. . 1981, апр. 97 (4): 559-67. [Медлайн].

  • Эглин Р.П., Ленер Т., Субак-Шарп Дж. Х. Обнаружение РНК, комплементарной вирусу простого герпеса, в мононуклеарных клетках пациентов с синдромом Бехчета и рецидивирующими язвами полости рта. Ланцет . 1982, 18 декабря. 2 (8312): 1356-61. [Медлайн].

  • Йориццо JL. Болезнь Бехчета.Фридберг И.М., Эйзен А.З., Вольф К. и др., Ред. Дерматология в общей медицине . Нью-Йорк: McGraw-Hill Professional; 1999. Vol 2: 2161-5.

  • Сакане Т., Такено М., Сузуки Н., Инаба Г. Болезнь Бехчета. N Engl J Med . 1999, 21 октября. 341 (17): 1284-91. [Медлайн].

  • Studd M, McCance DJ, Lehner T. Обнаружение ДНК HSV-1 у пациентов с синдромом Бехчета и у пациентов с рецидивирующими язвами полости рта с помощью полимеразной цепной реакции. J Med Microbiol . 1991, январь, 34 (1): 39-43. [Медлайн].

  • Adisen E, Aral A, Aybay C, Gürer MA. Уровни эпидермального фактора роста слюны при болезни Бехчета и рецидивирующем афтозном стоматите. Дерматология . 2008. 217 (3): 235-40. [Медлайн].

  • Hazzaa HH, Rashwan WA, Attia EA. Полиморфизм гена IL-18 при афтозном стоматите против болезни Бехчета в когорте пациентов из Египта. Дж. Орал Патол Мед . 2014 ноябрь43 (10): 746-53. [Медлайн].

  • Фергюсон М.М., Рэй Д., Кармайкл Х.А., Рассел Р.И., Ли Ф.Д. Целиакия, связанная с рецидивирующими афтами. Кишечник . 1980 21 марта (3): 223-6. [Медлайн].

  • Фергюсон Р., Басу М.К., Асквит П., Кук В.Т. Аномалии слизистой оболочки тощей кишки у пациентов с рецидивирующими афтозными язвами. Br Med J . 1976 г. 3 января (6000): 11-13. [Медлайн].

  • Рэй Д. Рецидивирующий афтозный стоматит, чувствительный к глютену. Dig Dis Sci . 1981 26 августа (8): 737-40. [Медлайн].

  • Yasar S, Yasar B, Abut E, Asiran Serdar Z. Клиническое значение целиакии у пациентов с рецидивирующим афтозным стоматитом. Турок Дж. Гастроэнтерол . 2012 23 февраля (1): 14-8. [Медлайн].

  • де Карвальо Ф. К., де Кейруш А. М., Безерра да Силва Р. А., Савамура Р., Бахманн Л., Безерра да Силва Л. А. и др. Оральные аспекты у детей с глютеновой болезнью: клиническая и химическая оценка зубной эмали. Oral Surg Oral Med Oral Pathol Oral Radiol . 2015 июн.119 (6): 636-43. [Медлайн].

  • Zunt S. Тяжелые / частые рецидивирующие афтозные язвы и выделение слюны. Oral Surg, Oral Med, Oral Pathol и Oral Rad . 2004. 98 (2):

  • Миллер М.Ф., Гарфанкель А.А., Рам С, Корабль II. Особенности наследования при рецидивирующих афтозных язвах: данные о близнецах и родословных. Oral Surg Oral Med Oral Pathol . 1977 июнь 43 (6): 886-91.[Медлайн].

  • Slebioda Z, Szponar E, Kowalska A. Рецидивирующий афтозный стоматит: генетические аспекты этиологии. Постэпы дерматол Алергол . 2013 Апрель 30 (2): 96-102. [Медлайн].

  • Бидоки А.З., Харсини С., Садр М., Солтани С., Мохаммадзаде М., Наджафи С. и др. Полиморфизм гена NLRP3 у иранских пациентов с рецидивирующим афтозным стоматитом. Дж. Орал Патол Мед . 2015 28 мая. [Medline].

  • Наджафи С., Юсефи Х., Мохаммадзаде М., Бидоки А.З., Фирузе Мокадам И., Фархади Е. и др.Изучение ассоциации однонуклеотидных полиморфизмов семейства интерлейкина-1 и гена интерлейкина-6 при рецидивирующем афтозном стоматите. Инт Дж. Иммуногенет . 2015 Декабрь 42 (6): 428-31. [Медлайн].

  • Wilhelmsen NS, Weber R, Monteiro F, Kalil J, Miziara ID. Корреляция между антигенами гистосовместимости и рецидивирующим афтозным стоматитом у населения Бразилии. Браз Дж Оториноларингол . 2009 май-июнь. 75 (3): 426-31. [Медлайн].

  • Kozlak ST, Walsh SJ, Lalla RV.Уменьшение потребления витамина B12 и фолиевой кислоты с пищей у пациентов с рецидивирующим афтозным стоматитом. Дж. Орал Патол Мед . 7 февраля 2010 г. [Medline].

  • Carrozzo M. Витамин B12 для лечения рецидивирующего афтозного стоматита. Вмятина на основе Evid . 2009. 10 (4): 114-5. [Медлайн].

  • Baccaglini L, Lalla RV, Bruce AJ, Sartori-Valinotti JC, Latortue MC, Carrozzo M, et al. Городские легенды: рецидивирующий афтозный стоматит. Устные сообщения .2011 17 ноября (8): 755-70. [Медлайн]. [Полный текст].

  • Ясуи К., Курата Т., Яширо М., Цуге М., Оцуки С., Моришима Т. Влияние аскорбата на незначительный рецидивирующий афтозный стоматит. Acta Paediatr . 2009 10 декабря. [Medline].

  • Khabbazi A, Ghorbanihaghjo A, Fanood F, Kolahi S, Hajialiloo M, Rashtchizadeh N. Сравнительное исследование уровней витамина D в сыворотке крови у пациентов с рецидивирующим афтозным стоматитом. Египетский ревматол .2015. 37 (3): 133-37.

  • Sun A, Chu CT, Wu YC, Yuan JH. Механизмы подавления активности естественных клеток-киллеров при рецидивирующих афтозных язвах. Clin Immunol Immunopathol . 1991 июль 60 (1): 83-92. [Медлайн].

  • Lewkowicz N, Kur B, Kurnatowska A, Tchorzewski H, Lewkowicz P. Экспрессия генов, связанных с Th2 / Th3 / Th4 / Th27, в рецидивирующих афтозных язвах. Arch Immunol Ther Exp (Warsz) . 2011 Октябрь 59 (5): 399-406. [Медлайн].

  • Тейлор Л.Дж., Бэгг Дж., Уокер Д.М., Питерс Т.Дж.Повышенная продукция фактора некроза опухоли лейкоцитами периферической крови у пациентов с рецидивирующими афтозными язвами в полости рта. Дж. Орал Патол Мед . 1992 21 января (1): 21-5. [Медлайн].

  • Хасан А., Чилдерстон А., Первин К. и др. Распознавание уникального пептидного эпитопа микобактериального антигена белка теплового шока человека 65-60 Т-клетками пациентов с рецидивирующими язвами полости рта. Clin Exp Immunol . 1995 Март 99 (3): 392-7. [Медлайн].

  • Миямото NT младший, Borra RC, Abreu M, Weckx LL, Franco M.Иммунная экспрессия HSP27 и IL-10 при рецидивирующем афтозном изъязвлении. Дж. Орал Патол Мед . 2008 Сентябрь 37 (8): 462-7. [Медлайн].

  • Альбаниду-Фармаки Э., Пулопулос А.К., Эпиватианос А., Фармакис К., Карамузис М., Антониадис Д. Повышенный уровень тревоги и высокие концентрации кортизола в слюне и сыворотке у пациентов с рецидивирующим афтозным стоматитом. Тохоку Дж. Эксп. Мед. . 2008 апр. 214 (4): 291-6. [Медлайн].

  • Borra RC, de Mesquita Barros F, de Andrade Lotufo M, Villanova FE, Andrade PM.Активность толл-подобных рецепторов при рецидивирующем афтозном изъязвлении. Дж. Орал Патол Мед . 2009 Март 38 (3): 289-98. [Медлайн].

  • Арикан С., Дурусой С., Акалин Н., Хаберал А., Секин Д. Окислительный / антиоксидантный статус при рецидивирующем афтозном стоматите. Устные сообщения . 2009 октября 15 (7): 512-5. [Медлайн].

  • Баган Дж., Саез Дж., Тормос С., Гавальда С., Санчис Дж. М., Баган Л. и др. Окислительный стресс и рецидивирующий афтозный стоматит. Clin Oral Investigation .2014 18 ноября (8): 1919-23. [Медлайн].

  • Оздемир И.Ю., Калка О., Карадаг А.С., Акдениз Н., Озтурк М. Аутоиммунитет щитовидной железы, связанный с рецидивирующим афтозным стоматитом. J Eur Acad Dermatol Venereol . 2012 26 февраля (2): 226-30. [Медлайн].

  • Ghodratnama F, Wray D, Bagg J. Обнаружение сывороточных антител против цитомегаловируса, вируса ветряной оспы и вируса герпеса человека 6 у пациентов с рецидивирующим афтозным стоматитом. Дж. Орал Патол Мед .1999, 28 января (1): 12-5. [Медлайн].

  • Педерсен А., Хорнслет А. Рецидивирующие афтозные язвы: возможное клиническое проявление реактивации ветряной оспы или цитомегаловирусной инфекции. Дж. Орал Патол Мед . 1993 22 февраля (2): 64-8. [Медлайн].

  • Ли Л., Гу Х., Чжан Г. Связь между рецидивирующим афтозным стоматитом и инфекцией Helicobacter pylori: метаанализ. Clin Oral Investigation . 2014 июл.18 (6): 1553-60.[Медлайн].

  • Альбаниду-Фармаки Э., Джаннулис Л., Маркопулос А. и др. Результат лечения Helicobacter pylori у пациентов с рецидивирующим афтозным стоматитом. Устные сообщения . 2005 11 января (1): 22-6. [Медлайн].

  • Бирек С., Гранди Р., Макнил К., Зингер Д., Фикарра Г., Боуден Г. Обнаружение Helicobacter pylori в афтозных язвах полости рта. Дж. Орал Патол Мед . 1999 Май. 28 (5): 197-203. [Медлайн].

  • Эльшейх М.Н., Махфуз М.Э.Распространенность ДНК Helicobacter pylori в рецидивирующих афтозных изъязвлениях в лимфоидных тканях глотки, связанных со слизистой оболочкой. Arch Otolaryngol Head Neck Surg . 2005 сентябрь 131 (9): 804-8. [Медлайн].

  • Mansour-Ghanaei F, Asmar M, Bagherzadeh AH, Ekbataninezhad S. Инфекция Helicobacter pylori при поражениях полости рта у пациентов с рецидивирующим афтозным стоматитом. Медицинский научный мониторинг . 2005 г., 11 (12): CR576-9. [Медлайн].

  • Портер СР, Баркер Г.Р., Скалли С., Макфарлейн Дж., Бейн Л.Антитела IgG в сыворотке крови к Helicobacter pylori у пациентов с рецидивирующим афтозным стоматитом и другими заболеваниями полости рта. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 1997 г., 83 (3): 325-8. [Медлайн].

  • Хиджази К., Лоу Т., Мехарг С., Берри С.Х., Фоли Дж., Держи ГЛ. Микробиом слизистой оболочки у пациентов с рецидивирующим афтозным стоматитом. J Dent Res . 2015 Март 94 (3 доп.): 87С-94С. [Медлайн].

  • Hay KD, Reade PC. Применение элиминационной диеты при лечении рецидивирующих афтозных язв ротовой полости. Oral Surg Oral Med Oral Pathol . 1984 Май. 57 (5): 504-7. [Медлайн].

  • Shim YJ, Choi JH, Ahn HJ, Kwon JS. Влияние лаурилсульфата натрия на рецидивирующий афтозный стоматит: рандомизированное контролируемое клиническое исследование. Устные сообщения . 2012 октября 18 (7): 655-60. [Медлайн].

  • Герлофсон BB, Баркволл П. Лаурилсульфат натрия и рецидивирующие афтозные язвы. Предварительное исследование. Acta Odontol Scand . 1994 Октябрь 52 (5): 257-9.[Медлайн].

  • Хасан А.А., Чиансио С. Связь между приемом нестероидных противовоспалительных препаратов и появлением афтозных язв. J Int Acad Periodontol . 2009 11 (1): 155-9. [Медлайн].

  • Скалли С., Горский М., Лозада-Нур Ф. Диагностика и лечение рецидивирующего афтозного стоматита: консенсусный подход. J Am Dent Assoc . 2003 Февраль 134 (2): 200-7. [Медлайн].

  • Самаранаяке ЛПК, Чунг Л.Samaranayake YH. Кандидоз и другие грибковые заболевания ротовой полости. Дерматол Тер . 2001. 15: 251-69.

  • Абахусейн О. Изъязвление при ревматической болезни. Matucci-Cerinic M, Furst D, Fiorentino E, eds. Кожные проявления при ревматических заболеваниях . 1-е изд. Нью-Йорк, штат Нью-Йорк: Спрингер-Верлаг; 2014. 63-70.

  • Дейли Т.Д., Армстронг Дж. Э. Устные проявления заболеваний ЖКТ. Банка Дж Гастроэнтерол . 2007 апр.21 (4): 241-4. [Медлайн].

  • Коэн PR. Синдром Свита — подробный обзор острого фебрильного нейтрофильного дерматоза. Орфанет J Редкие диски . 26 июля 2007 г. 2:34. [Медлайн].

  • Боксер L, Дейл округ Колумбия. Нейтропения: причины и последствия. Семин Гематол . 2002 апр. 39 (2): 75-81. [Медлайн].

  • Паде С., Стоффман Н., Беркун Ю. Периодическая лихорадка, сопровождающаяся афтозным стоматитом, фарингитом и синдромом цервикального аденита (синдром PFAPA) у взрослых. Isr Med Assoc J . 2008 май. 10 (5): 358-60. [Медлайн].

  • Cantarini L, Vitale A, Bartolomei B, Galeazzi M, Rigante D. Диагностика синдрома PFAPA применена к когорте из 17 взрослых с необъяснимыми рецидивирующими лихорадками. Clin Exp Rheumatol . 2012 март-апрель. 30 (2): 269-71. [Медлайн].

  • Имаи Х., Мотеги М., Мизуки Н., Отани Х., Комацуда А., Хамай К. и др. Язвы во рту и гениталиях с воспаленным хрящом (синдром MAGIC): отчет о болезни и обзор литературы. Am J Med Sci . 1997 ноябрь 314 (5): 330-2. [Медлайн].

  • Ramírez-Amador V, Esquivel-Pedraza L, Sierra-Madero J, Anaya-Saavedra G, González-Ramírez I, Ponce-de-León S. Изменяющийся клинический спектр заболеваний полости рта, связанных с вирусом иммунодефицита человека (ВИЧ) 1000 последовательных пациентов: 12-летнее исследование в справочном центре в Мексике. Медицина (Балтимор) . 2003, январь 82 (1): 39-50. [Медлайн].

  • Кимура С., Курода Дж., Акаоги Т., Хаяси Х., Кобаяси Ю., Кондо М.Трисомия 8 участвует в миелодиспластических синдромах как фактор риска кишечных язв и тромбозов — синдрома Бехчета. Лимфома лейк . 2001 июн. 42 (1-2): 115-21. [Медлайн].

  • Давачи Ф. Диагностика / критерии классификации болезни Бехчета. Патолог Res Int . 2012. 2012: 607921. [Медлайн].

  • О’Нил Т.В., Ригби А.С., Силман А.Дж., Барнс К. Валидация критериев Международной исследовательской группы для болезни Бехчета. Br J Ревматол . 1994 Февраль 33 (2): 115-7. [Медлайн].

  • Таппуни А.Р., Ковачевич Т., Ширлав П.Дж., Чалакомб С.Дж. Клиническая оценка степени тяжести заболевания при рецидивирующем афтозном стоматите. Дж. Орал Патол Мед . 2013 Сентябрь 42 (8): 635-41. [Медлайн].

  • Challacombe SJ, Alsahaf S, Tappuni A. Рецидивирующий афтозный стоматит: к доказательному лечению ?. Curr Oral Health Rep . 2015. 2: 158-67.

  • Ekiz O, Balta I, Sen BB, Rifaioglu EN, Ergin C, Balta S, et al.Средний объем тромбоцитов при рецидивирующем афтозном стоматите и болезни Бехчета. Ангиология . 2014 Февраль 65 (2): 161-5. [Медлайн].

  • Rogers RS 3-й, Хаттон КП. Скрининг дефицита крови у пациентов с рецидивирующим афтозным стоматитом. Australas J Dermatol . 1986, 27 декабря (3): 98-103. [Медлайн].

  • Alidaee MR, Taheri A, Mansoori P, Ghodsi SZ. Прижигание нитрата серебра при афтозном стоматите: рандомизированное контролируемое исследование. Br J Dermatol . 2005 Сентябрь 153 (3): 521-5. [Медлайн].

  • Brice SL. Клиническая оценка использования ультразвука низкой интенсивности в лечении рецидивирующего афтозного стоматита. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 1997, январь 83 (1): 14-20. [Медлайн].

  • Brocklehurst P, Tickle M, Glenny AM, Lewis MA, Pemberton MN, Taylor J, et al. Системные вмешательства при рецидивирующем афтозном стоматите (язвах во рту). Кокрановская база данных Syst Rev . 2012 сентября. 9: CD005411. [Медлайн].

  • Лю Ц., Чжоу Ц., Лю Г, Ван Ц., Чен Дж, Ван Л. и др. Эффективность и безопасность мази с дексаметазоном при рецидивирующих афтозных изъязвлениях. Am J Med . 2012 Март 125 (3): 292-301. [Медлайн].

  • Мэн В., Дун И, Лю Дж, Ван З, Чжун Х, Чен Р. и др. Клиническая оценка пероральных адгезивных пленок амлексанокса в лечении рецидивирующего афтозного стоматита и сравнение с пероральными таблетками амлексанокса: рандомизированное, плацебо-контролируемое, слепое, многоцентровое клиническое исследование. Испытания . 2009 6 мая. 10:30. [Медлайн].

  • Khandwala A, Van Inwegen RG, Charney MR, Alfano MC. Пероральная паста с 5% амлексаноксом, новое средство для лечения рецидивирующих мелких афтозных язв: II. Фармакокинетика и демонстрация клинической безопасности. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 1997 Февраль 83 (2): 231-8. [Медлайн].

  • Bonitsis NG, Altenburg A, Krause L, Stache T, Zouboulis CC. Современные концепции лечения болезни Адамантади-Бехчета. Наркотики будущего . 2009. 34: 749–63.

  • Чаван М., Джайн Х., Диван Н., Хедкар С., Шете А., Дуркар С. Рецидивирующий афтозный стоматит: обзор. Дж. Орал Патол Мед . 2012 Сентябрь 41 (8): 577-83. [Медлайн].

  • Альтенбург А., Абдель-Насер М.Б., Сибер Х., Абдалла М., Зубулис С.С. Практические аспекты лечения рецидивирующего афтозного стоматита. J Eur Acad Dermatol Venereol . 2007 сентября 21 (8): 1019-26. [Медлайн].

  • Elad S, Epstein JB, von Bültzingslöwen I, Drucker S, Tzach R, Yarom N.Актуальные иммуномодуляторы для лечения состояний слизистой оболочки полости рта, систематический обзор; Часть II: разные агенты. Экспертное заключение Emerg Drugs . 2011 марта 16 (1): 183-202. [Медлайн].

  • Belenguer-Guallar I, Jiménez-Soriano Y, Claramunt-Lozano A. Лечение рецидивирующего афтозного стоматита. Обзор литературы. J Clin Exp Dent . 2014 Апрель 6 (2): e168-74. [Медлайн].

  • Шарки К.Э., Хельми Р.М., Ноаими А.А., Кадхом А.А., Аль-Хаяни Р.К.Терапевтическая роль изотретиноина в лечении рецидивирующего афтозного стоматита (одно-слепое контролируемое терапевтическое исследование). J Косметика, дерматологические науки и приложения . 2015. 5: 15-21.

  • Горский М., Эпштейн Дж., Рабенштейн С., Елишов Х., Яром Н. Местные полоскания миноциклином и тетрациклином при лечении рецидивирующего афтозного стоматита: рандомизированное перекрестное исследование. Dermatol Online J . 2007 1. Май 13 (2): 1. [Медлайн].

  • Клементе Родригес де Ривера Э, Родригес де Ривера Кампильо Э, Э.Джане Салас, Альбукерке Р., Лопес Дж. Л. O10364 Эффективность Bexident Post в лечении рецидивирующего афтозного стоматита. Oral Surg Oral Med Oral Pathol Oral Rad . 2014. 117 (5): e382.

  • Descroix V, Coudert AE, Vigé A, Durand JP, Toupenay S, Molla M и др. Эффективность местного 1% лидокаина при симптоматическом лечении боли, связанной с травмой слизистой оболочки полости рта или незначительной афтозной язвой в полости рта: рандомизированное двойное слепое плацебо-контролируемое исследование однократной дозы в параллельных группах. Дж. Orofac Pain . 2011 Осень. 25 (4): 327-32. [Медлайн].

  • Buchsel PC. Гель поливинилпирролидон-гиалуронат натрия (Gelclair): биоадгезивный пероральный гель для лечения мукозита полости рта и других болезненных поражений полости рта. Экспертное заключение Drug Metab Toxicol . 2008 г., 4 (11): 1449-54. [Медлайн].

  • Ладлоу Дж. Б., Катчер М. Дж., Самуэльсон А. Интраоральная цифровая визуализация, документирующая заживление рецидивирующей афтозной язвы в 2-октилцианоакрилате по сравнению с ложно обработанными поражениями. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 2000 апр. 89 (4): 425-31. [Медлайн].

  • Кампизи Г., Спадари Ф., Сальвато А. [Сукральфат в одонтостоматологии. Клинический опыт. Минерва Стоматол . 1997 июн. 46 (6): 297-305. [Медлайн].

  • Ricer RE. Сукральфат по сравнению с плацебо для лечения афтозных язв: проспективное клиническое испытание, двойное слепое. Fam Pract Res J . 1989 Осень-Зима. 9 (1): 33-41.[Медлайн].

  • Халашински Т. Лечение язв в полости рта и синдрома жжения во рту. Вадивелу Н., Вадивелу А., Кайе А.Д., ред. Орофациальная боль: руководство для врача . Чам, Швейцария: Шпрингер; 2014. 103-14.

  • Пинто А, Линдемейер Р.Г., Сольесито ТП. Синдром PFAPA в оральной медицине: дифференциальная диагностика и лечение. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 2006 июл.102 (1): 35-9. [Медлайн].

  • Femiano F, Buonaiuto C, Gombos F, Lanza A, Cirillo N.Пилотное исследование рецидивирующего афтозного стоматита (РАС): рандомизированное плацебо-контролируемое исследование сравнительных терапевтических эффектов системного преднизона и системного монтелукаста у субъектов, не отвечающих на местную терапию. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 2010 Март 109 (3): 402-7. [Медлайн].

  • Кац Дж., Лангевиц П., Шемер Дж., Барак С., Ливне А. Профилактика рецидивирующего афтозного стоматита с помощью колхицина: открытое испытание. J Am Acad Dermatol .1994 31 сентября (3, часть 1): 459-61. [Медлайн].

  • Dixon AJ, Wall GC. Вероятная нейтропения, вызванная колхицином, не связанная с преднамеренной передозировкой. Энн Фармакотер . 2001 Февраль 35 (2): 192-5. [Медлайн].

  • Коричневый RS, Боттомли WK. Комбинированная терапия иммунодепрессантами и местными стероидами для лечения рецидивирующих основных афт. Отчет о болезни. Oral Surg Oral Med Oral Pathol . 1990, январь 69 (1): 42-4. [Медлайн].

  • de Abreu MA, Hirata CH, Pimentel DR, Weckx LL.Лечение рецидивирующего афтозного стоматита клофазимином. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 2009 ноябрь 108 (5): 714-21. [Медлайн].

  • Фемиано Ф., Гомбос Ф., Скалли С. Рецидивирующий афтозный стоматит, не реагирующий на местные кортикостероиды: исследование сравнительных терапевтических эффектов системного преднизона и системного сулодексида. Инт Дж Дерматол . 2003 май. 42 (5): 394-7. [Медлайн].

  • Якобсон Дж. М., Гринспен Дж. С., Спритцлер Дж., Кеттер Н., Фэйи Дж. Л., Джексон Дж. Б. и др.Талидомид для лечения афтозных язв в полости рта у пациентов с инфекцией вируса иммунодефицита человека. Группа клинических исследований СПИДа Национального института аллергии и инфекционных заболеваний. N Engl J Med . 1997 22 мая. 336 (21): 1487-93. [Медлайн].

  • Thornhill MH, Baccaglini L, Theaker E, Pemberton MN. Рандомизированное двойное слепое плацебо-контролируемое исследование пентоксифиллина для лечения рецидивирующего афтозного стоматита. Arch Dermatol .2007 апр. 143 (4): 463-70. [Медлайн].

  • Hamdy AA, Ibrahem MA. Лечение афтозных язв с помощью местного кверцетина: рандомизированное клиническое исследование. J Contemp Dent Pract . 2010 г. 1. 11 (4): E009-16. [Медлайн].

  • Mostafa AAE, Ibrahem MAE. Лечение афтозных язв с помощью местного кверцетина. Cairo Dental J . 2009. 25 (1):

  • .

  • Аль-Мавери С.А., Алайзари Н., Альхарби А.А., Алотайби С.А., Аль-Кухал А., Альмутаири Б.Ф. и др.Эффективность куркумина при рецидивирующем афтозном стоматите: систематический обзор. J Dermatolog Treat . 2020 сен 9. 1-6. [Медлайн].

  • Аггур Р.Л., Махмуд С.Х., Абдельваб А. Оценка эффекта лепешек с пробиотиками при лечении рецидивирующего афтозного стоматита: рандомизированное контролируемое клиническое исследование. Clin Oral Investigation . 20 августа 2020 г. [Medline].

  • Pedersen AML, Bukkehave KH, Bennett EP, Twetman S. Влияние леденцов, содержащих Lactobacillus reuteri, на тяжесть рецидивирующих афтозных язв: пилотное исследование. Пробиотики, антимикробные белки . 2020 Сентябрь 12 (3): 819-823. [Медлайн].

  • Аль-Мавери С.А., Хальбуб Э., Ашраф С., Алкутаиби А.Ю., Каид Н.М., Яхья К. и др. Однократное применение актуального доксициклина в лечении рецидивирующего афтозного стоматита: систематический обзор и метаанализ имеющихся данных. BMC Oral Health . 2020 24 августа. 20 (1): 231. [Медлайн].

  • Альбрексон М., Хедстрём Л., Берг Х. Рецидивирующий афтозный стоматит и лечение боли с помощью низкоуровневой лазерной терапии: рандомизированное контролируемое исследование. Oral Surg Oral Med Oral Pathol Oral Radiol . 2014 май. 117 (5): 590-4. [Медлайн].

  • Деметриадес Н., Хэнфорд Х., Ласкаридес С. Общие проявления синдрома Бехчета и успех CO2-лазера в лечении поражений полости рта: обзор литературы и описание случая. J Mass Dent Soc . Осень 2009 г. 58 (3): 24-7. [Медлайн].

  • Arikan OK, Birol A, Tuncez F, Erkek E, Koc C. Проспективное рандомизированное контролируемое исследование для определения того, может ли криотерапия уменьшить боль у пациентов с малой формой рецидивирующего афтозного стоматита. Oral Surg Oral Med Oral Pathol Oral Radiol Endod . 2006 Январь 101 (1): e1-5. [Медлайн].

  • Eversole LR, Shopper TP, Chambers DW. Влияние предполагаемых возбудителей пищевых продуктов на этиологию рецидивирующего афтозного стоматита. Oral Surg Oral Med Oral Pathol . 1982 июл.54 (1): 33-8. [Медлайн].

  • Hay KD, Reade PC. Применение элиминационной диеты при лечении рецидивирующих афтозных язв ротовой полости. Oral Surg Oral Med Oral Pathol . 1984 Май. 57 (5): 504-7. [Медлайн].

  • Райт А., Райан Ф. П., Виллингем С. Е. и др. Пищевая аллергия или непереносимость тяжелых рецидивирующих афтозных язв во рту. Br Med J (Clin Res Ed) . 1986 10 мая. 292 (6530): 1237-8. [Медлайн].

  • Lalla RV, Choquette LE, Feinn RS, Zawistowski H, Latortue MC, Kelly ET, et al. Мультивитаминная терапия рецидивирующего афтозного стоматита: рандомизированное плацебо-контролируемое исследование с двойной маской. J Am Dent Assoc . 2012 Апрель 143 (4): 370-6. [Медлайн].

  • Axell T, Henricsson V. Связь между рецидивирующими афтозными язвами и табачными привычками. Scand J Dent Res . 1985 июн. 93 (3): 239-42. [Медлайн].

  • Биттоун Р. Рецидивирующие афтозные язвы и никотин. Med J Aust . 1991 г., 1. 154 (7): 471-2. [Медлайн].

  • Sawair FA. Действительно ли курение защищает от рецидивирующего афтозного стоматита ?. Ther Clin Risk Manag . 2010 22 ноября. 6: 573-7. [Медлайн]. [Полный текст].

  • Hill SC, Stavrakoglou A, Coutts IR. Заместительная никотиновая терапия как лечение сложного афтоза. J Dermatolog Treat . 2009 13 октября. [Medline].

  • Противовирусная активность доксициклина против вируса везикулярного стоматита in vitro | Письма о микробиологии FEMS

    Доксициклин (Dox) представляет собой производное тетрациклина с широким спектром антимикробной активности, которое используется в качестве эффекторного вещества в индуцибельных системах экспрессии генов.Мы исследовали противовирусную активность Dox против инфекции вируса везикулярного стоматита (VSV) в культивируемых клетках h2299. Dox в концентрациях 1,0–2,0 мкг / мл -1 значительно ингибировал репликацию VSV и вызванный VSV цитопатический эффект дозозависимым образом, что позволяет предположить, что Dox может обладать более широкой активностью в ингибировании репликации вирусов в дополнение к его четко выраженному бактериостатическому действию. Мероприятия. Докс проявлял свой противовирусный эффект на ранней и средней стадии инфекции VSV, предполагая, что он не влиял на инфекционность VSV, адсорбцию или проникновение в клетки-мишени.Эти результаты показывают, что Dox может подавлять инфекцию VSV и, следовательно, может иметь потенциальное применение для лечения вирусных инфекций.

    ВВЕДЕНИЕ

    Доксициклин (Dox) представляет собой производное тетрациклина с противомикробным действием широкого спектра действия (Pulverer 1969; Michalopoulos 1973) и противовоспалительным действием (Krakauer and Buckley 2003; Cazalis et al .2008). Докс в настоящее время является предпочтительным эффекторным веществом, используемым в индуцибельных системах экспрессии генов для исследований биологии эукариотических клеток.В этой системе транскрипция интересующих генов обратимо включается (Tet-on) или выключается (Tet-off) в ответ на стимуляцию Dox (Gossen and Bujard 1992; Zhou et al .2006).

    Опухолевый супрессор p53 — хорошо известный белок, который играет важную роль в регуляции клеточной активности, включая апоптоз, остановку клеточного цикла, дифференцировку и противоопухолевый ответ (Yonish-Rouach et al. . 1991; Shaw et al. , 1992; эль-Дейри и др. .1993).Недавние исследования показали роль p53 в противовирусном ответе хозяина на ряд вирусов, включая вирус везикулярного стоматита (VSV) (Takaoka et al .2003), вирус гриппа (Turpin et al .2005) и другие вирусы (Rivas , Ааронсон и Муньос-Фонтела 2010). Чтобы расширить противовирусный спектр p53, мы создали стабильную клеточную линию с индуцируемой экспрессией p53 на основе системы Tet-on, используя Dox в качестве эффекторного вещества. Мы протестировали ингибирующий эффект Dox-индуцированного p53 на репликацию VSV и вируса японского энцефалита (JEV) в этой стабильной клеточной линии.Неожиданно сам Dox также ингибировал репликацию VSV и JEV в этой стабильной клеточной линии с Dox-индуцируемой экспрессией p53.

    Несмотря на его способность подавлять репликацию ретровирусов и вируса денге (DNV), противовирусной активностью Dox в значительной степени пренебрегали (Sturtz 1998; Yang et al .2007). VSV является прототипом семейства Rhabdoviridae и вызывает везикулярный стоматит у лошадей и других животных (Hanson 1952; Watson 1981). В этом исследовании мы продемонстрировали противовирусную активность Dox в отношении репликации VSV, модельной системы, широко используемой для изучения инфекции и репликации РНК-вирусов.

    МАТЕРИАЛЫ И МЕТОДЫ

    Вирус, клетки, антитела и введение Dox

    VSV размножали в клетках BHK-21 почек детенышей хомячка, а штамм JEV (SH-JEV01) (Deng et al .2011) выращивали в клетках C6 / 36. Количество вирусов определяли с помощью анализа бляшек с использованием клеток BHK-21. Клеточная линия немелкоклеточной карциномы легких человека h2299 (p53-null) и клетки BHK-21 поддерживали в среде Игла, модифицированной Дульбекко (DMEM) (Invitrogen, Carlsbad, CA, USA), с добавлением 10% фетальной бычьей сыворотки (FBS). .Клетки эпителия легких человека A549 (A549) и клетки C6 / 36 поддерживали в питательной смеси F-12K (модификация Kaighn) и среде RPMI 1640 (Invitrogen), соответственно. Все клетки были приобретены из банка клеток коллекции типовых культур Китайской академии наук (Шанхай, Китай). Коммерческие моноклональные антитела против p53 (DO-1, Santa Cruz Biotechnology, Санта-Крус, Калифорния, США), моноклональные антитела против β-актина (Proteintech Group, Чикаго, Иллинойс, США) и конъюгированные с Alexa Fluor 488 антимышиные IgG использовались вторичные антитела (Invitrogen).

    Dox (чистота ≥98%), закупленный у Sigma-Aldrich (Сент-Луис, Миссури, США), растворяли в сверхчистом H 2 O в концентрации 1 мкг мкл -1 и хранили при -20 ° C. во тьме. Dox в указанных концентрациях добавляли к культуральной среде и инкубировали в течение указанного времени. Контроли получали эквивалентные количества сверхчистого H 2 O.

    Получение стабильной линии клеток h2299 с Dox-индуцируемой экспрессией p53

    Tet-on 3G индуцируемые системы экспрессии, включая pCMV-Tet3G, pTRE3G, pTRE3G-Luc и линейный маркер пуромицина, были приобретены у Clontech Laboratories, Inc (Маунтин-Вью, Калифорния, США).Плазмида pTRE-p53 была сконструирована путем вставки полноразмерного человеческого p53 в вектор pTRE3G. Клетки h2299 трансфицировали плазмидой pCMV-Tet3G и отбирали с помощью 400 мкг мл -1 G418 в течение 2 недель. Колонии отбирали и тестировали с помощью люциферазного анализа с использованием трансфекции pTRE3G-Luc и индукции Dox. Устойчивую к G418 колонию с наибольшей кратной индукцией размножали и трансфицировали плазмидой pTRE-p53 и линейным маркером селекции пуромицина. Трансфектанты отбирали с 1 мкг мл -1 пуромицина в течение 2 недель.Двадцать четыре колонии были выделены и идентифицированы индукцией Dox. Пуромицин / G418-устойчивые колонии с высокой экспрессией р53 и транскрипционной активностью под индукцией Dox размножали и назвали p53-Tet h2299.

    Вирусная инфекция и анализ

    клеток h2299 и A549 высевали из расчета 1 × 10 5 клеток на лунку на 24-луночные планшеты. Культуры инокулировали VSV при множественности инфицирования (MOI) 0,01 или JEV при MOI 0,1 и инкубировали в течение 1 часа.Культуры дважды промывали фосфатно-солевым буфером и дополнительно инкубировали в среде с 2% FBS в течение указанного времени. Титры вирусов в супернатантах определяли с помощью анализа 50% инфекционной дозы культуры ткани (TCID 50 ) в клетках BHK-21 и рассчитывали по методу Reed и Muench (Duivenvoorden, Hirte and Singh 1997).

    Анализ цитотоксичности

    Анализы цитотоксичности проводили с использованием реагента для пролиферации клеток WST-1 (Roche Applied Science, Penzberg, Germany) в соответствии с протоколом производителя.Вкратце, клетки h2299 высевали из расчета 2 × 10 4 клеток на лунку на 96-луночный планшет и культивировали в течение 24 часов. Затем среду заменяли на DMEM, содержащую 10% FBS и серийные разведения Dox в диапазоне от 0,01 до 4,0 мкг / мл -1 . После инкубации в течение 24 ч культуральную среду удаляли и заменяли свежей средой, содержащей 10% FBS и 10 мкл реагента пролиферации клеток WST-1 в каждой лунке, и инкубировали при 37 ° C в атмосфере 5% CO 2 в увлажненном инкубаторе. за 2 ч. Оптическую плотность измеряли на микропланшет-ридере при 450/655 нм и рассчитывали процент цитотоксичности (жизнеспособность клеток).Значение 50% цитотоксической концентрации (CC 50 ) определяли как концентрацию Dox, которая снижает поглощение обработанных клеток на 50% по сравнению с контрольными лунками без Dox.

    Противовирусный анализ

    Клеток высевали по 2 × 10 4 клеток на лунку на 96-луночный планшет и инкубировали в течение 24 часов. Затем клетки инокулировали VSV при 0,01 MOI или JEV при 0,1 MOI и инкубировали в течение 1 часа. После вирусной адсорбции инокулят заменяли культуральной средой, содержащей Dox в различных концентрациях, и инкубировали в течение 24 часов.Для определения стадии, на которой Dox ингибирует репликацию VSV, Dox 2 мкг / мл -1 добавляли к клеткам h2299 в различные моменты времени до вирусной инфекции и во время вирусной инфекции. Титр вируса в каждой группе определяли с помощью анализа TCID 50 . Жизнеспособность клеток в каждой группе анализировали с помощью анализа цитотоксичности и рассчитывали.

    Анализы ингибирования образования бляшек

    Конфлюэнтных монослойных клеток BHK-21, культивированных в шестилуночном планшете для тканевых культур (5 × 10 5 клеток / лунку), инфицировали 10, 60 или 360 БОЕ VSV в течение 1 часа. Через 2 часа адсорбции вируса раствор удаляли. и клетки дважды промывали предварительно нагретой средой MEM и заменяли верхней средой (1% агарозы с низкой температурой плавления, 2% FBS и 1.0 мкг мл -1 Dox или 0 мкг мл -1 Dox). После инкубации культур в течение 4 дней при 37 ° C с 5% CO 2 монослои фиксировали 4% раствором формальдегида в течение 30 минут, затем агарозу удаляли проточной водой и окрашивали 1% (мас. / Об.) Кристаллическим фиолетовым. решение.

    Количественная полимеразная цепная реакция с обратной транскрипцией, иммунофлуоресценция и вестерн-блоттинг

    Количественный анализ обратной транскрипции – полимеразной цепной реакции (qRT – PCR) выполняли, как описано ранее (Zhu et al .2014). Ген глицеральдегид-3-фосфатдегидрогеназы (GAPDH) «домашнего хозяйства» был взят в качестве внутреннего контроля. Последовательности праймеров перечислены в таблице S1 (дополнительная информация). Иммунофлуоресценция и вестерн-блоттинг выполняли, как описано ранее (Wang et al .2012).

    Статистический анализ

    Измеренные значения представлены как среднее ± стандартное отклонение (SD). Достоверность определялась с помощью тестов Стьюдента t .Значение P <0,05 считалось статистически значимым.

    РЕЗУЛЬТАТЫ

    Создание стабильной клеточной линии h2299 (p53-Tet h2299) с Dox-индуцируемой экспрессией p53

    Стабильная линия клеток с Dox-индуцируемой экспрессией p53 была создана путем трансфекции p53-нулевых клеток h2299 плазмидой pCMV-Tet3G и pTRE3G-p53 с последующим отбором с помощью G418 и пуромицина. Экспрессия p53 в созданной клеточной линии (p53-Tet h2299) была обнаружена с помощью вестерн-блоттинга.Докс индуцировал экспрессию p53 (фиг. 1A), которая преимущественно локализовалась в ядре, как обнаружено с помощью иммунофлуоресцентного анализа (фиг. 1B). Это согласуется с предыдущими наблюдениями (Шаульский и др. . 1990; Априкян и др. . 1994). Фактор транскрипции p53 транскрипционно усиливает экспрессию своих генов-мишеней p21 , TLR3 и BAX (el-Deiry et al .1993; Chipuk et al .2004; Taura et al .2008 г.). Эти гены-мишени p53 были значительно активированы в ответ на стимуляцию Dox (рис. 1C). Взятые вместе, эти данные указывают на то, что была установлена ​​стабильная линия клеток h2299 с Dox-индуцируемой экспрессией p53.

    Рисунок 1.

    Получение стабильной линии клеток h2299 с Dox-индуцируемой экспрессией p53. Нулевые по р53 клетки h2299 трансфицировали плазмидами pCMV-Tet3G и pTRE-p53 и отбирали с помощью G418 и пуромицина соответственно. Созданная линия клеток (p53-Tet h2299) обрабатывалась 1 мкг мл -1 Dox и инкубировалась в течение 24 часов.( A ) Dox-индуцированная экспрессия p53 определялась вестерн-блоттингом ( B ) и локализовалась с помощью иммунофлуоресцентного анализа (зеленый). Клетки окрашивали на ДНК 4 -6-диамидино-2-фенилиндолом (синий). ( C ) Экспрессию генов-мишеней p53 ( TLR3 , p21 и BAX ) определяли с помощью анализа qRT – PCR. + Dox, клетки, обработанные Dox; −Dox, клетки, имитирующие обработку эквивалентным H 2 O. ** P <0,01 между группами + Dox и −Dox, проанализированными с помощью теста Стьюдента t .

    Рисунок 1.

    Получение стабильной линии клеток h2299 с Dox-индуцируемой экспрессией p53. Нулевые по р53 клетки h2299 трансфицировали плазмидами pCMV-Tet3G и pTRE-p53 и отбирали с помощью G418 и пуромицина соответственно. Созданная линия клеток (p53-Tet h2299) обрабатывалась 1 мкг мл -1 Dox и инкубировалась в течение 24 часов. ( A ) Dox-индуцированная экспрессия p53 определялась вестерн-блоттингом ( B ) и локализовалась с помощью иммунофлуоресцентного анализа (зеленый). Клетки окрашивали на ДНК 4 -6-диамидино-2-фенилиндолом (синий).( C ) Экспрессию генов-мишеней p53 ( TLR3 , p21 и BAX ) определяли с помощью анализа qRT – PCR. + Dox, клетки, обработанные Dox; −Dox, клетки, имитирующие обработку эквивалентным H 2 O. ** P <0,01 между группами + Dox и −Dox, проанализированными с помощью теста Стьюдента t .

    Ингибирующее действие Dox на репликацию VSV и JEV

    Мы исследовали противовирусную активность Dox-индуцированного p53 в клетках p53-Tet h2299, инфицированных VSV, в присутствии 1 мкг / мл -1 Dox.Репликацию VSV определяли с помощью анализа TCID 50 . Известно, что р53 ингибирует репликацию VSV (Takaoka et al. , 2003). Как и ожидалось, титр VSV в клетках p53-Tet h2299 был значительно снижен в присутствии Dox (+ Dox) по сравнению с отсутствием Dox (-Dox) (фиг. 2A). Однако также наблюдалась значительная разница в титрах VSV между контрольными клетками h2299 с Dox и без него, титры VSV в клетках с Dox (+ Dox) были значительно ниже, чем в клетках, обработанных имитацией (-Dox) (рис.2А). Подобные результаты наблюдались в контрольных клетках h2299, инфицированных JEV (фиг. 2B). Эти наблюдения предполагают, что Dox сам ингибирует репликацию VSV и JEV. Чтобы исключить возможность того, что ингибирующие эффекты Dox на репликацию VSV и JEV были вызваны цитотоксичностью Dox, мы проанализировали цитотоксичность Dox, инкубируя клетки h2299 с концентрациями Dox в диапазоне от 0,01 до 32,0 мкг / мл -1 в течение 24 часов, затем CC 50 измеряли с использованием регента WST-1. CC 50 Докса было примерно 8.45 мкг мл -1 (рис. 2C), намного больше, чем 1 мкг мл -1 , который не имел значительной цитотоксичности in vitro и in vivo (Curci et al. . 2000; Baxter et al. .2002; Скидмор и др. .2003). 1,0 мкг мл -1 Dox значительно снижал репликацию VSV и JEV (фиг. 2A и B) без значительных цитотоксических эффектов (фиг. 2C). Эти результаты предполагают, что Dox оказывает ингибирующее действие на репликацию VSV и JEV.

    Рисунок 2.

    Dox ингибировал репликацию VSV и JEV. Клетки p53-Tet h2299 и h2299 были инфицированы VSV с MOI 0,01 ( A ) или JEV с MOI 0,1 ( B ) соответственно. После адсорбции в течение 1 часа клетки обрабатывали Dox в концентрации 1 мкг / мл -1 и инкубировали в течение 24 часов. Титры вирусов в супернатантах культур определяли с помощью анализа TCID 50 . ( C ) Анализ цитотоксичности Dox. Клетки h2299 обрабатывали указанными концентрациями Dox в течение 24 часов, и цитотоксичность Dox анализировали с использованием реагента для пролиферации клеток WST-1.Жизнеспособность клеток рассчитывали и наносили на график. 50% цитотоксическую концентрацию (CC 50 ) анализировали с использованием анализа аппроксимации кривой нелинейной регрессии в программе GraphPad Prism. Данные представлены как среднее ± стандартное отклонение из трех независимых экспериментов. * P <0,05 по сравнению с клетками, имитирующими обработку эквивалентным H 2 O. + Dox, клетками, обработанными Dox; -Dox, клетки, имитирующие обработку эквивалентным H 2 O.

    Рисунок 2.

    Dox ингибировал репликацию VSV и JEV.Клетки p53-Tet h2299 и h2299 были инфицированы VSV с MOI 0,01 ( A ) или JEV с MOI 0,1 ( B ) соответственно. После адсорбции в течение 1 часа клетки обрабатывали Dox в концентрации 1 мкг / мл -1 и инкубировали в течение 24 часов. Титры вирусов в супернатантах культур определяли с помощью анализа TCID 50 . ( C ) Анализ цитотоксичности Dox. Клетки h2299 обрабатывали указанными концентрациями Dox в течение 24 часов, и цитотоксичность Dox анализировали с использованием реагента для пролиферации клеток WST-1.Жизнеспособность клеток рассчитывали и наносили на график. 50% цитотоксическую концентрацию (CC 50 ) анализировали с использованием анализа аппроксимации кривой нелинейной регрессии в программе GraphPad Prism. Данные представлены как среднее ± стандартное отклонение из трех независимых экспериментов. * P <0,05 по сравнению с клетками, имитирующими обработку эквивалентным H 2 O. + Dox, клетками, обработанными Dox; -Dox, клетки, имитирующие обработку эквивалентным H 2 O.

    Dox ингибирует репликацию VSV дозозависимым образом

    Чтобы подтвердить ингибирующий эффект Dox на репликацию VSV, клетки h2299 инфицировали VSV в присутствии Dox в концентрациях от 0.01 до 2,0 мкг мл -1 в течение 24 ч, что было меньше значения CC 50 и проявляло небольшую цитотоксичность. Титры VSV постепенно снижались с увеличением концентрации Dox, что указывает на дозозависимый эффект (фиг. 3A). Основываясь на снижении титра VSV при обработке с различной концентрацией Dox, рассчитанная эффективная концентрация 50% (EC 50 ) составляла около 0,18 мкг / мл -1 (рис. 3B), но значительное снижение титров VSV наблюдалось при концентрациях 1 .0–2,0 мкг мл –1 Dox (рис. 3A). Чтобы исключить возможность того, что противовирусная активность Dox зависит от типа клеток, мы также исследовали ингибирующий эффект Dox на репликацию VSV в клетках A549. Обработка Dox также значительно снижала репликацию VSV в клетках A549 дозозависимым образом (рис. 3C).

    Рисунок 3.

    Dox ингибировал репликацию VSV дозозависимым образом. Клетки h2299 ( A ) и клетки A549 ( C ) были инфицированы VSV при 0.01 MOI и обработали Dox в указанных концентрациях. Титры вирусов в супернатантах определяли с помощью анализа TCID 50 через 24 часа после инфицирования. ( B ) Снижение титра вируса в клетках h2299 из фиг. 3A рассчитывали и наносили на график с использованием кривой нелинейной регрессии в программе GraphPad Prism. Ось x имеет логарифмическую шкалу с основанием 2. ( D ) Клетки h2299, инфицированные VSV и обработанные Dox в указанных концентрациях, визуализировали под световым микроскопом через 24 часа после инфицирования.( E ) Клетки h2299, инфицированные VSV и обработанные Dox в указанных концентрациях, анализировали с помощью анализа цитотоксичности через 24 часа после инфицирования. Жизнеспособность клеток рассчитывали и наносили на график. Данные представлены как среднее значение ± стандартное отклонение для трех независимых экспериментов. ** P <0,01 по сравнению с клетками, имитирующими обработку эквивалентным H 2 O (0 мкг мл -1 Dox). ( F ) Ингибирующее действие Dox на образование бляшек, вызванное VSV. Клетки BHK-21 в шестилуночном планшете инфицировали 10, 60 или 360 БОЕ VSV в течение 1 часа, затем покрывали 1% гелем агарозы, содержащим 1.0 мкг мл -1 Dox. После инкубации культур в течение 4 дней монослои фиксировали 4% раствором формальдегида в течение 30 мин и окрашивали 1% (мас. / Об.) Раствором кристаллического фиолетового.

    Рисунок 3.

    Dox ингибировал репликацию VSV дозозависимым образом. Клетки h2299 ( A ) и клетки A549 ( C ) инфицировали VSV при 0,01 MOI и обрабатывали Dox в указанных концентрациях. Титры вирусов в супернатантах определяли с помощью анализа TCID 50 через 24 часа после инфицирования.( B ) Снижение титра вируса в клетках h2299 из фиг. 3A рассчитывали и наносили на график с использованием кривой нелинейной регрессии в программе GraphPad Prism. Ось x имеет логарифмическую шкалу с основанием 2. ( D ) Клетки h2299, инфицированные VSV и обработанные Dox в указанных концентрациях, визуализировали под световым микроскопом через 24 часа после инфицирования. ( E ) Клетки h2299, инфицированные VSV и обработанные Dox в указанных концентрациях, анализировали с помощью анализа цитотоксичности через 24 часа после инфицирования.Жизнеспособность клеток рассчитывали и наносили на график. Данные представлены как среднее значение ± стандартное отклонение для трех независимых экспериментов. ** P <0,01 по сравнению с клетками, имитирующими обработку эквивалентным H 2 O (0 мкг мл -1 Dox). ( F ) Ингибирующее действие Dox на образование бляшек, вызванное VSV. Клетки BHK-21 в шестилуночном планшете инфицировали 10, 60 или 360 БОЕ VSV в течение 1 часа, затем покрывали 1% гелем агарозы, содержащим 1,0 мкг мл -1 Dox. После инкубации культур в течение 4 дней монослои фиксировали 4% раствором формальдегида в течение 30 мин и окрашивали 1% (мас. / Об.) Раствором кристаллического фиолетового.

    Репликация

    VSV оказывает цитопатический эффект (CPE) в клетках h2299. Чтобы определить, влияет ли Dox на CPE VSV, мы инфицировали клетки h2299 VSV в присутствии Dox в концентрациях 0,1–2,0 мкг / мл -1 и визуализировали вызванный VSV CPE под световым микроскопом через 24 часа после заражения. . Тяжелый CPE был виден в VSV-инфицированных клетках h2299 в отсутствие Dox (0 мкг мл -1 Dox), но обработка Dox ингибировала CPE дозозависимым образом (фиг. 3D). Жизнеспособность VSV-инфицированных клеток h2299 определяли с помощью анализа цитотоксичности.Жизнеспособность клеток постепенно увеличивалась с увеличением концентрации Dox (рис. 3E). Обработка Dox в дозе 1,0–2,0 мкг / мл –1 обеспечила клетки h2299 с 83–85,7% защитой от смерти, вызванной инфекцией VSV. Чтобы дополнительно определить ингибирующий эффект Dox на VSV-индуцированный CPE, образование бляшек в VSV-инфицированных клетках BHK-21 измеряли в присутствии 1,0 мкг / мл -1 Dox или без Dox, растворенных в агарозном геле. По сравнению с контрольными лунками без обработки Dox, вирусные бляшки стали меньше и меньше в лунках, обработанных Dox (рис.3F). Эти результаты показывают, что Dox ингибировал репликацию VSV и CPE, индуцированный VSV.

    Dox ингибирует репликацию VSV

    in vitro на ранней и средней стадии вирусной инфекции

    клеток h2299 обрабатывали Dox в концентрации 2,0 мкг / мл -1 в различные моменты времени до инфицирования VSV и во время инфицирования VSV (фиг. 4A). Титры вирусов в супернатантах каждой группы анализировали для определения стадии, на которой Dox ингибировал репликацию VSV.Как показано на фиг. 4B, значительного ингибирующего эффекта на репликацию VSV не наблюдалось в группах, получавших Dox до вирусной инфекции (Pre 2, 5 и 10 часов) или во время периода вирусной адсорбции (Ad 0 h), что позволяет предположить, что Dox действительно не препятствуют инфицированию VSV, адсорбции или проникновению в клетки-мишени. Однако Dox, вводимый на ранней стадии (после 1 и 2 часа) или на средней стадии (после 5 часов) инфекции VSV, показал значительный ингибирующий эффект на репликацию VSV. Наиболее эффективное ингибирование репликации VSV наблюдалось через 2 часа после инфицирования (после 2 часов).Докс, введенный на поздней стадии инфекции VSV (после 10 ч), не оказывал противовирусной активности. Взятые вместе, эти результаты предполагают, что Dox ингибировал репликацию VSV in vitro на ранней и средней стадии инфекции VSV.

    Рисунок 4.

    Dox ингибировал репликацию VSV на ранней и средней стадии вирусной инфекции. ( A ) Схематическое изображение экспериментальной конструкции. Клетки h2299 обрабатывали Dox в концентрации 2,0 мкг / мл -1 в указанные моменты времени.( B ) Титры вирусов определяли через 24 ч после инфицирования с помощью анализа TCID 50 и наносили на график. Данные представлены как среднее значение ± стандартное отклонение для трех независимых экспериментов. * P <0,05 и ** P <0,01 по сравнению с клетками, имитирующими обработку эквивалентным H 2 O (0 мкг мл -1 Dox).

    Рисунок 4.

    Dox ингибировал репликацию VSV на ранней и средней стадии вирусной инфекции. ( A ) Схематическое изображение экспериментальной конструкции.Клетки h2299 обрабатывали Dox в концентрации 2,0 мкг / мл -1 в указанные моменты времени. ( B ) Титры вирусов определяли через 24 ч после инфицирования с помощью анализа TCID 50 и наносили на график. Данные представлены как среднее значение ± стандартное отклонение для трех независимых экспериментов. * P <0,05 и ** P <0,01 по сравнению с клетками, имитирующими обработку эквивалентным H 2 O (0 мкг мл -1 Dox).

    ОБСУЖДЕНИЕ

    Dox — полусинтетический структурный изомер семейства тетрациклинов и один из наиболее широко используемых в клинической практике антибиотиков широкого спектра действия (Bobbio 1969; Misra et al .1969; Мита и др. . 1977; Кэйтон и Райан 2011). Он проявляет внутриклеточное проникновение и бактериостатическую активность у многих бактерий, препятствуя синтезу белка (Семенков Ю. и др. , 1982). Противовирусная активность Dox была впервые продемонстрирована значительным снижением титров ретровирусов в культивируемых клетках, обработанных Dox (Sturtz 1998). Впоследствии было показано, что Dox ингибирует инфекцию DNV (Yang et al , 2007). Эти наблюдения предполагают, что Dox может иметь более широкую активность в подавлении репликации вирусов в дополнение к его четко определенной бактериостатической активности.

    В этом исследовании Dox значительно ингибировал репликацию VSV in vitro дозозависимым образом. И титры вируса, и CPE инфекции VSV были значительно снижены при лечении Dox. Ингибирующий эффект на репликацию VSV не зависел от типа клеток, поскольку аналогичные ингибирующие эффекты наблюдались в клетках h2299, A549 и BHK-21, инфицированных VSV. Мы исключили возможность того, что ингибирующий эффект Dox на репликацию VSV и JEV был результатом цитотоксичности Dox.Этот результат согласуется с предыдущими наблюдениями, согласно которым 0,01–2,0 мкг мл -1 Dox не обладают очевидной цитотоксичностью in vitro (Kees и др. , 1990; Beringer и др. .2012; Rothan и др. , 2014). ). Взятые вместе, наши результаты продемонстрировали новую роль Dox в подавлении репликации VSV, дополнительно усиливая концепцию, что Dox может подавлять вирусную инфекцию. Однако Dox не оказал влияния на титры вируса у мышей, инфицированных вирулентным вирусом гриппа h4N2 (Ng et al .2012). Следовательно, противовирусная активность Dox может зависеть от вида вируса. Необходимы дальнейшие исследования для уточнения противовирусного спектра Докс.

    Механизмы, посредством которых Dox ингибирует репликацию вирусов, плохо изучены. Dox подавляет распространение DNV типа 2, вероятно, нарушая конформационные изменения белка DNV E, который необходим для проникновения вируса (Yang et al .2007). Помимо ингибирования проникновения вируса, Dox также ингибирует сериновую протеазу NS2B-NS3 вируса и постинфекционную репликацию DNV (Rothan et al .2014). В текущем исследовании Dox проявлял свою противовирусную активность на ранней и средней стадии инфекции VSV, предполагая, что он не влиял на проникновение VSV в клетки-мишени, а также на инфекционность или адсорбцию вируса. Однако необходимы дальнейшие исследования, чтобы определить точные механизмы, посредством которых Dox ингибирует репликацию VSV.

    Dox является предпочтительным эффекторным веществом, используемым в индуцибельной системе экспрессии генов для исследований биологии эукариотических клеток. Однако это исследование неожиданно продемонстрировало анти-VSV активность Dox в стабильной клеточной линии p53-Tet h2299 с Dox-индуцируемой экспрессией p53.Dox также демонстрирует различные биоактивности, включая ингибирование матриксных металлопротеаз (Dursun et al , 2001), уменьшение воспаления (Angadi 2012) и остановку клеточного цикла в фазе G1 (Duivenvoorden, Hirte and Singh 1997). Поэтому следует уделять пристальное внимание экспрессии Dox-индуцируемых генов, чтобы избежать неправильной интерпретации экспериментальных результатов.

    В заключение, ингибирующее действие Dox на репликацию VSV было неожиданно обнаружено при изучении противовирусной функции p53 в клетках p53-Tet h2299.Анти-VSV активность Dox, дополнительно оцененная на клетках h2299, A549 и BHK-21, показала, что Dox значительно ингибировал репликацию VSV и VSV-индуцированный CPE дозозависимым образом. Докс проявлял свою противовирусную активность in vitro на ранней и средней стадии заражения VSV, предполагая, что он не влиял на проникновение VSV в клетки-мишени, а также на инфекционность или адсорбцию вируса. Эти результаты предоставляют доказательства в поддержку способности Dox подавлять вирусную инфекцию и предполагают потенциальное применение Dox для лечения вирусных инфекций.

    ДОПОЛНИТЕЛЬНЫЕ ДАННЫЕ

    Дополнительные данные.

    ФИНАНСИРОВАНИЕ

    Это исследование спонсировалось Национальным фондом естественных наук Китая (№ 81371814 и 81171547).

    Конфликт интересов. Не заявлено.

    ССЫЛКИ

    Ангади

    PV

    Комбинированный гель монокарпина и доксициклина может быть эффективным для лечения лабиального герпеса

    J Evid Based Dent Pract

    2012

    12

    218

    9

    Априкян

    AG

    Саркис

    AS

    ярмарка

    WR

    и другие.

    Иммуногистохимическое определение ядерной аккумуляции белка р53 при аденокарциноме предстательной железы

    J Урология

    1994

    151

    1276

    80

    Бакстер

    BT

    Пирс

    WH

    Waltke

    EA

    и другие.

    Длительное назначение доксициклина пациентам с небольшими бессимптомными аневризмами брюшной аорты: отчет о проспективном (фаза II) многоцентровом исследовании

    J Vasc Surg

    2002

    36

    1

    12

    Берингер

    PM

    Оуэнс

    H

    Нгуен

    А

    и другие.

    Фармакокинетика доксициклина у взрослых с муковисцидозом

    Антимикробные агенты Ch

    2012

    56

    70

    4

    Боббио

    А.

    Клинические результаты применения доксициклина в лечении острых стоматологических инфекций

    Rev Assoc Paul Cir Dent

    1969

    23

    14

    23

    Катон

    Дж

    Райан

    ME

    Клинические исследования по лечению заболеваний пародонта с использованием субантимикробных доз доксициклина (SDD)

    Pharmacol Res

    2011

    63

    114

    20

    Казалис

    Дж

    Бодет

    С

    Ганьон

    г

    и другие.

    Доксициклин снижает индуцированную липополисахаридами секрецию медиатора воспаления в макрофагах и ex vivo Модели цельной крови человека

    J Периодонтол

    2008

    79

    1762

    8

    Чипук

    JE

    Кувана

    т

    Bouchier-Hayes

    л

    и другие.

    Прямая активация Bax p53 опосредует проницаемость митохондриальной мембраны и апоптоз

    Наука

    2004

    303

    1010

    4

    Curci

    JA

    Мао

    D

    Бонер

    DG

    и другие.

    Предоперационное лечение доксициклином снижает экспрессию стенки аорты и активацию матриксных металлопротеиназ у пациентов с аневризмами брюшной аорты

    J Vasc Surg

    2000

    31

    325

    42

    Дэн

    XF

    Ши

    ZX

    Ли

    SQ

    и другие.

    Характеристика неструктурного белка 3 нейровирулентного штамма вируса японского энцефалита, выделенного от свиньи

    Вирол J

    2011

    8

    209

    Duivenvoorden

    WC

    Hirte

    HW

    Сингх

    г

    Использование тетрациклина в качестве ингибитора активности матриксной металлопротеиназы, секретируемой раковыми клетками, метастазирующими в кости человека

    Invas Metast

    1997

    17

    312

    22

    Дурсун

    D

    Ким

    MC

    Соломон

    А

    и другие.

    Лечение устойчивых рецидивирующих эрозий роговицы ингибиторами матриксной металлопротеиназы-9, доксициклином и кортикостероидами

    Am J Ophthalmol

    2001

    132

    8

    13

    Эль-Дейри

    WS

    Токино

    т

    Велкулеску

    ВЭ

    и другие.

    WAF1, потенциальный медиатор подавления опухоли p53

    Ячейка

    1993

    75

    817

    25

    Госсен

    м

    Bujard

    H

    Жесткий контроль экспрессии генов в клетках млекопитающих с помощью тетрациклин-чувствительных промоторов

    P Natl Acad Sci USA

    1992

    89

    5547

    51

    Hanson

    RP

    Естественное течение везикулярного стоматита

    Бактериол Ред.

    1952

    16

    179

    204

    Кес

    Ф

    Денер

    R

    Диттрих

    Вт

    и другие.

    Биодоступность доксициклина

    Arznei-Forschung

    1990

    40

    1039

    43

    Кракауэр

    т

    Бакли

    м

    Доксициклин обладает противовоспалительным действием и подавляет цитокины и хемокины, индуцированные стафилококками экзотоксином

    Антимикробные агенты Ch

    2003

    47

    3630

    3

    Михалопулос

    А.

    Клиническое и лабораторное исследование доксициклина («вибрамицин»): антибиотика широкого спектра действия

    Curr Med Res Opin

    1973

    1

    445

    55

    Мисра

    RC

    Саксена

    SN

    Гупта

    SM

    и другие.

    Клинико-бактериологическая оценка доксициклина, нового антибиотика

    Химиотерапия

    1969

    14

    54

    9

    Мита

    т

    Obe

    А

    Сугимото

    м

    и другие.

    Лабораторные и клинические исследования доксициклина внутривенно (авторский перевод)

    Jpn J Antibiot

    1977

    30

    258

    65

    Нг

    HH

    Нарасараджу

    т

    Фун

    MC

    и другие.

    Лечение доксициклином уменьшает острое повреждение легких у мышей, инфицированных вирулентным вирусом гриппа h4N2: участие матриксных металлопротеиназ

    Опыт Мол Патол

    2012

    92

    287

    95

    Pulverer

    г

    Доксициклин — антибиотик широкого спектра действия тетрациклинового ряда

    Мед Клин

    1969

    64

    1033

    7

    Ривас

    С

    Ааронсон

    SA

    Munoz-Fontela

    С

    Двойная роль p53 в врожденном противовирусном иммунитете

    Вирусов

    2010

    2

    298

    313

    Ротан

    HA

    Мохамед

    Z

    Пайдар

    м

    и другие.

    Ингибирующее действие доксициклина на репликацию вируса денге in vitro

    Arch Virol

    2014

    159

    711

    8

    Семенков

    ЮП

    Макаров

    EM

    Махно

    VI

    и другие.

    Кинетические аспекты действия тетрациклина на акцепторный (A) сайт рибосом Escherichia coli

    FEBS Lett

    1982

    144

    125

    9

    Шаульский

    г

    Голдфингер

    N

    Бен-Зеев

    А

    и другие.

    Ядерное накопление белка p53 опосредуется несколькими сигналами ядерной локализации и играет роль в онкогенезе

    Mol Cell Biol

    1990

    10

    6565

    77

    Шоу

    Бови

    R

    Поздно

    S

    и другие.

    Индукция апоптоза р53 дикого типа в клеточной линии, полученной из опухоли толстой кишки человека

    P Natl Acad Sci USA

    1992

    89

    4495

    9

    Скидмор

    R

    Ковач

    R

    Уокер

    С

    и другие.

    Влияние доксициклина в субантимикробных дозах при лечении акне средней степени тяжести

    Дерматол Arch

    2003

    139

    459

    64

    Sturtz

    FG.

    Антимуриновый ретровирусный эффект доксициклина

    Метод Find Exp Clin

    1998

    20

    643

    7

    Такаока

    А

    Хаякава

    S

    Янаи

    H

    и другие.

    Интеграция передачи сигналов интерферона-альфа / бета в ответы p53 в подавлении опухоли и противовирусной защите

    Природа

    2003

    424

    516

    23

    Таура

    м

    Эгума

    А

    Suico

    MA

    и другие.

    p53 регулирует экспрессию и функцию Toll-подобного рецептора 3 в линиях эпителиальных клеток человека

    Mol Cell Biol

    2008

    28

    6557

    67

    Турпин

    E

    Луки

    К

    Джонс

    Дж

    и другие.

    Инфекция вирусом гриппа увеличивает активность p53: роль p53 в гибели клеток и репликации вирусов

    J Вирол

    2005

    79

    8802

    11

    Ван

    XD

    Дэн

    XF

    Ян

    WJ

    и другие.

    Стабилизация p53 в клетках, инфицированных вирусом гриппа A, связана с нарушением MDM2-опосредованного убиквитинирования p53

    Дж Biol Chem

    2012

    287

    18366

    75

    Уотсон

    WA

    Везикулярные болезни: последние достижения и концепции борьбы

    Can Vet J

    1981

    22

    311

    20

    Ян

    JM

    Чен

    YF

    Вт

    ГГ

    и другие.

    Комбинаторные вычислительные подходы для идентификации производных тетрациклина как ингибиторов флавивирусов

    PLoS One

    2007

    2

    e428

    Йониш-Руах

    E

    Резницкий

    D

    Лотем

    Дж

    и другие.

    Р53 дикого типа индуцирует апоптоз миелоидных лейкемических клеток, который ингибируется интерлейкином-6

    Природа

    1991

    352

    345

    7

    Чжоу

    Х

    Винк

    м

    Клавер

    В

    и другие.

    Оптимизация системы Tet-On для регулируемой экспрессии генов посредством вирусной эволюции

    Джин Тер

    2006

    13

    1382

    90

    Чжу

    ZX

    Ян

    YF

    Вэй

    JC

    и другие.

    Опосредованный интерфероном иммунный ответ типа I против вируса гриппа A ослабляется в отсутствие p53

    Biochem Bioph Res Co

    2014

    454

    189

    95

    клинических исследований | Рецензирование

    Индекс Коперника Значение: 87,45

    Идентификатор Pubmed NLM: 101663073

    Номер ISSN: 2386-5180

    Импакт-фактор журнала: 1.89 * (5-летний импакт-фактор)

    Annals of Clinical and Laboratory Research (ACLR) — это международный рецензируемый журнал с открытым доступом, который обеспечивает быструю публикацию статей во всех областях клинических и лабораторных наук. Цель этого журнала — предоставить ученым и исследователям со всего мира платформу для продвижения, обмена и обсуждения различных инновационных идей и разработок в области лабораторной медицины и клинического опыта для улучшения качества здоровья людей и животных.Тематические области, подходящие для публикации, включают, но не ограничиваются следующими областями: клиническая биохимия, гематология, микробиология, иммунология, клиническая патология, медицинская генетика, фармацевтические исследования, клинические исследования и исследования на лабораторных животных.

    Отправьте свою рукопись на https://www.imedpub.com/submissions/annals-clinical-laboratory-research.html или отправьте нам свою рукопись по адресу [электронная почта защищена]

    Клинические лабораторные исследования

    Клинические исследования — это отрасль науки о здоровье, которая определяет безопасность и эффективность лекарств, устройств, диагностических продуктов и схем лечения, предназначенных для использования людьми.Их можно использовать для профилактики, лечения, диагностики или для облегчения симптомов заболевания.

    Связанные журналы клинических и лабораторных исследований

    Архивы клинической микробиологии, клинической педиатрии и дерматологии, клинической психиатрии, взглядов на клиническую неврологию, журнала клинической и экспериментальной нефрологии, Международного журнала фармацевтических и клинических исследований, журнала СПИДа и клинических исследований, Азиатского журнала фармацевтических и клинических исследований, груди рак Фундаментальные и клинические исследования, клинические исследования и нормативно-правовые вопросы

    Лабораторные исследования

    Лаборатория — это объект, который обеспечивает контролируемые условия, в которых могут проводиться научные или технологические исследования, эксперименты и измерения.

    Родственные журналы лабораторных исследований

    Архивы медицины, Insights in Biomedicine, Журнал клинической и молекулярной эндокринологии, Медицинские и клинические обзоры, Клиники в лабораторной медицине, Критические обзоры в клинических лабораторных науках, текущие протоколы по основным лабораторным методам, Международный журнал лабораторной гематологии, Журнал клинической лаборатории Анализ

    Клиническая биохимия

    Клиническая биохимия — это особая отрасль медицины, занимающаяся измерением и интерпретацией физико-химического состояния и динамики у здоровых и больных людей, что способствует патофизиологическому пониманию и, таким образом, профилактике, диагностике, терапии, прогнозированию и исследованию болезней

    Родственные журналы по клинической биохимии

    Журнал биохимии и молекулярной биологии, химическая информатика, Журнал органической и неорганической химии, Тенденции в зеленой химии, структурная химия и связь с кристаллографией, Анналы клинической биохимии, Клиническая биохимия, Бюллетень клинической биохимии, Индийский журнал клинической биохимии, Журнал клинической Биохимия и питание

    Клиника и диагностика

    Диагноз, устанавливаемый на основании медицинских признаков и симптомов, сообщаемых пациентом, а не диагностических тестов.Лабораторная диагностика. Диагноз основывается в значительной степени на лабораторных отчетах или результатах анализов, а не на физическом обследовании пациента.

    Клинические и диагностические журналы, связанные с

    Двойная диагностика, Журнал редких Diorders: Диагностика и терапия, Клиническая педиатрия и дерматология, Архив воспаления, Журнал клинических и диагностических исследований, Журнал клинической диагностики, Молекулярная диагностика и терапия, Мнение экспертов по медицинской диагностике, Экспертный обзор молекулярной диагностики

    Исследуемое новое лекарство

    Программа нового исследуемого препарата (IND) — это средство, с помощью которого фармацевтическая компания получает разрешение на перевозку экспериментального препарата через границы штата (обычно клиническим исследователям) до того, как заявка на маркетинг препарата будет одобрена.FDA рассматривает заявку IND на предмет безопасности, чтобы гарантировать, что объекты исследования не будут подвергаться необоснованному риску. Если заявка одобрена, лекарство-кандидат обычно попадает на Фазу 1 клинических испытаний.

    Связанные журналы исследуемого нового лекарства

    Международный журнал по разработке и исследованиям лекарственных средств, Журнал злоупотребления наркотиками, молекулярной энзимологии и наркологических целей, Закон о пищевых продуктах и ​​лекарствах, Индийские лекарства, инфекции и устойчивость к лекарствам, инфекционные заболевания — мишени для лекарств, воспаление и аллергия — мишени для лекарств, International Drug Discovery

    Клиническое исследование

    Клинические испытания — это исследования, призванные ответить на научные вопросы и найти более эффективные способы лечения или профилактики заболеваний.Понимание того, что они из себя представляют, может помочь вам решить, подойдет ли вам клиническое испытание. Или, может быть, у вас есть друг или член семьи, больной раком, и вам интересно, подходит ли им клиническое исследование.

    Связанные журналы клинических испытаний

    Translation Biomedicine, международный журнал разработки и исследований лекарственных средств, международный журнал совместных исследований в области внутренней медицины и общественного здравоохранения, журнал анестезии и клинических исследований, журнал клинических испытаний с открытым доступом, обзоры последних клинических испытаний, клинических испытаний, достижений в клинической практике. и экспериментальная медицина

    Медицинские исследования

    Клинические испытания — это эксперименты, проводимые в рамках клинических исследований.Такие проспективные биомедицинские или поведенческие исследования на людях предназначены для ответа на конкретные вопросы о биомедицинских или поведенческих вмешательствах, включая новые методы лечения (такие как новые вакцины, лекарства, диетический выбор, диетические добавки и медицинские устройства) и известные вмешательства, требующие дальнейшего изучения. и сравнение.

    Связанные журналы медицинских исследований

    Insights in Biomedicine, Insights in Medical Physics, Journal of Pancreas, Journal of Hospital and Medical Management, Biomedical Research, Journal of Medical Biotechnology, Biomedical and Pharmacology Journal, Biomedical Engineering, Biomedical Microdevices

    Anesthesia Research

    Анестетик — это агент, вызывающий анестезию.Больной под воздействием наркоза находится под наркозом. Анестезиолог — это врач, который проводит анестезию. Анестезия позволяет безболезненно выполнять медицинские процедуры, которые могут вызвать сильную или непереносимую боль у ненанестезированного пациента.

    Связанные журналы анестезиологических исследований

    Медицинские архивы, журнал анестезии и клинических исследований, журнал беременности и здоровья ребенка, журнал клинической анестезии, индийский журнал анестезии, саудовский журнал анестезии, журнал анестезиологии, клиническая фармакология

    Управление клиническими данными

    Управление клиническими данными (CDM) — это критический этап клинических исследований, который приводит к получению высококачественных, надежных и статистически обоснованных данных по результатам клинических испытаний.Это помогает значительно сократить время от разработки лекарства до маркетинга.

    Журналы, связанные с управлением клиническими данными

    Качество первичной медико-санитарной помощи, Журнал компьютерных наук и системной биологии, международный журнал инноваций в компьютерной и коммуникационной инженерии, международный журнал клинических исследований и биоэтики, База данных: журнал биологических баз данных и курирования, международный журнал интеллектуального анализа данных и биоинформатики, BioData Mining

    Исследования иммунологии

    Иммунология — это отрасль биомедицинских наук, занимающаяся всеми аспектами иммунной системы всех многоклеточных организмов.Он имеет дело с физиологическим функционированием иммунной системы как при состоянии здоровья, так и при заболеваниях; сбои в работе иммунной системы при иммунологических нарушениях.

    Родственные журналы по иммунологии

    Журнал аутоиммунных заболеваний, Журнал гепатита, Журнал ВИЧ и ретро-вирусов, Журнал инфекционных заболеваний и лечения, Репродуктивная иммунология, Исследовательский журнал иммунологии, Результаты в иммунологии, Скандинавский журнал иммунологии, Семинары по иммунологии, Иммунология трансплантологии, Тенденции в иммунология

    Исследование биомаркеров

    Биомаркеры — это ключевые молекулярные или клеточные события, которые связывают конкретное воздействие окружающей среды с последствиями для здоровья.Биомаркеры играют важную роль в понимании взаимосвязи между воздействием химических веществ в окружающей среде, развитием хронических заболеваний человека и выявлением подгрупп, подверженных повышенному риску заболевания.

    Связанные журналы исследований биомаркеров

    Biomarkers Journal, Журнал молекулярных биомаркеров и диагностики, Международный журнал нейрореабилитации, исследования иммуномов, Open Biomarkers Journal, Biomarker Insights, биомаркеры и геномная медицина, биомаркеры в медицине, биомаркеры рака

    Лабораторные исследовательские компании

    Маркетинговые исследования — это любые организованные усилия по сбору информации о целевых рынках или клиентах.Это очень важная составляющая бизнес-стратегии. Этот термин обычно заменяют термином «маркетинговые исследования»; тем не менее, специалисты-практики могут пожелать провести различие в том, что маркетинговые исследования касаются конкретно маркетинговых процессов, в то время как исследования рынка касаются конкретно рынков.

    Родственные журналы лабораторных исследований

    Архивы клинической микробиологии, клинической педиатрии и дерматологии, клинической психиатрии, взглядов на клиническую неврологию, журнала клинической и экспериментальной нефрологии, клинической лаборатории, клинической лабораторной науки, журнала клинического лабораторного анализа, журнала Американской ассоциации лабораторных исследований животных, лаборатории Животные

    Гинекологические исследования

    Гинекология — это медицинская практика, занимающаяся вопросами здоровья женской репродуктивной системы (влагалища, матки и яичников) и груди.Буквально вне медицины это означает «наука о женщинах». Его аналог — андрология, которая занимается медицинскими проблемами, характерными для мужской репродуктивной системы.

    Связанные журналы гинекологических исследований

    Центр акушерства и гинекологии, Гинекология и акушерство, Журнал беременности и здоровья детей, Гинекологическая эндокринология, Журнал андрологии, Андрология, Андрология, Журнал исследований акушерства и гинекологии

    Некротические заболевания пародонта | DermNet NZ

    Автор: Dr Delwyn Dyall-Smith FACD, дерматолог, Австралия, 2010 г.


    Что такое некротизирующее заболевание пародонта?

    Некротизирующее заболевание пародонта — это термин, используемый для описания группы относительно редких инфекций, поражающих ротовую полость, при которых язвы с некрозом являются обычным явлением. Некроз — это термин, используемый для описания отмирания тканей.

    Существует три основных формы:

    1. Некротический (язвенный) гингивит — поражает только десны
    2. Некротизирующий (язвенный) периодонтит — включает потерю специальной ткани, которая окружает и прикрепляет зубы
    3. Некротический стоматит — при котором происходит более обширная потеря слизистой и костной ткани за пределами десен и тканей, окружающих и поддерживающих зубы.Стоматит означает боль во рту.

    Этим состояниям дано много других названий, включая некротизирующий гингивостоматит, раковую опухоль яичка, ному, траншейный рот, гингивостоматит Винсента, острый перепончатый гингивит, болезнь Бержерона, фузоспиральную инфекцию / гингивит, фагеденический гингивит, острый септический гингивит.

    У кого возникает некротизирующее заболевание пародонта и почему?

    Некротизирующее заболевание пародонта возникает из-за накопления зубного налета, связанного с плохой гигиеной полости рта.

    Однако факторы хозяина также важны, позволяя этим некротизирующим условиям развиваться из зубного налета. Хорошо известные факторы хозяина, которые, как известно, предрасполагают к некротизирующему заболеванию пародонта, включают:

    • Иммунодефицит — ВИЧ-инфекция, лейкемия, нейтропения / агранулоцитоз, сахарный диабет, иммунодепрессанты
    • Недоедание
    • Психологические и физические нагрузки
    • Курение — часто присутствует в сочетании с одним из других факторов
    • Также может потребоваться генетическая предрасположенность.

    Некротизирующее заболевание пародонта распространено среди ВИЧ-инфицированных (у которых это может указывать на инфекцию) и в раннем детстве в развивающихся странах (из-за недоедания), но считается редким за пределами этих групп.

    Некротический гингивит обычно является первой стадией. Он может прогрессировать до некротизирующего пародонтита или некротизирующего стоматита, особенно у пациентов с ослабленным иммунитетом.

    Некротизирующее заболевание пародонта включает в себя смесь многих различных микроорганизмов, большинство из которых находится в нормальной полости рта:

    Они проникают в слизистую оболочку полости рта, сначала в десны, а затем в ткани, поддерживающие зубы и / или где-либо еще в полости рта. слизистая рта.

    Клинические признаки некротизирующего пародонта

    1. Некротизирующий гингивит

    Некротизирующий гингивит определяется как инфекция десен, при которой кончики десен, видимые между зубами (десневые сосочки), теряются с сопутствующим кровотечением и болью.

    Основными постоянными симптомами, отмеченными пациентом, являются:

    • Боль — постоянная, от легкой до умеренной по степени тяжести, усиливающаяся при надавливании, например, при жевании
    • Кровотечение — может возникать самопроизвольно, при чистке зубов или жевании

    Реже можно отметить следующее:

    • Низкая температура
    • Галитоз (неприятный запах изо рта)

    Пациенты, у которых уже был предыдущий эпизод, могут сообщать о продромальных симптомах, таких как жжение десен, перед внезапным началом типичного гингивита.

    Признаки, видимые при осмотре:

    • Изъязвление и некроз края десны между зубами, первоначально с потерей кончика десны, обычно видимым между двумя зубами. В основном поражается край десны, что приводит к потере структуры десны.
    • Над некротической областью (-ами) можно увидеть белую псевдомембрану. Попытка удаления приводит к кровотечению.
    • Увеличенные болезненные или болезненные лимфатические узлы, обычно под подбородком и нижней челюстью, особенно при тяжелом некротизирующем гингивите у детей.
    • ВИЧ-инфицированные пациенты обычно также имеют другие заболевания полости рта, связанные с ВИЧ, такие как волосатая лейкоплакия полости рта, кандидоз полости рта или саркома Капоши полости рта.

    Эпизод некротического гингивита может привести к:

    • Самопроизвольному заживлению без остаточных признаков инфекции
    • Стойкие язвы или кратеры, которые могут быстро перейти в новый эпизод некротического гингивита
    • Прогресс в некротизирующий периодонтит с возможным поражением костей и расшатыванием, а затем потерей зубов
    • Развитие некротического стоматита с поражением обширных участков слизистой оболочки полости рта и костей

    2.Некротизирующий пародонтит

    Инфекция включает специализированные прикрепляющие ткани, окружающие один или несколько зубов, и возникающее в результате воспаление является более разрушительным и более глубоким, чем при некротическом гингивите. Пораженный зуб расшатывается. Кость обнажается и иногда разрушается с возможной потерей пораженного зуба. Утрата прикрепления зубов и костей может происходить быстро и длиться всего несколько месяцев, а не обычные годы.

    Симптомы и признаки включают:

    • Сильная глубокая боль — основной симптом
    • Самопроизвольное кровотечение обычное
    • Галитоз (неприятный запах изо рта) — обычный
    • Множественные очаги некроза десен — обычные
    • Потеря альвеолярной кости — обычная
    • Образование псевдомембран — очень часто
    • Увеличение лимфатических узлов — общее
    • Низкая температура — обычная

    3.Некротический стоматит

    Инфекция и воспаление распространяется по поверхности, поражая слизистую оболочку рта за пределы десен. Он также может проникать глубоко, поражая многие зубы. Поскольку поверхностная слизистая оболочка потеряна, подлежащая кость может обнажиться с последующей потерей костной массы. Это может привести к деформации рта и быть опасным для жизни, если не лечить.

    Как диагностируется некротизирующее заболевание пародонта?

    Некротизирующая болезнь пародонта — это клинический диагноз. Микробиологический мазок покажет смешанные микроорганизмы.Биопсия обычно бесполезна, поскольку выявляет неспецифическое воспаление. Специальные пятна продемонстрируют смешанную инфекцию. При некротизирующем периодонтите и некротизирующем стоматите может потребоваться рентгенография.

    Очень важно сдавать анализы крови на предрасполагающие заболевания, такие как лейкемия, нейтропения / агранулоцитоз или ВИЧ-инфекция. У большинства ВИЧ-положительных пациентов с некротизирующим заболеванием пародонта количество CD4 + Т-клеток составляет менее 200 клеток / мм3, поэтому это заболевание полости рта может быть маркером ВИЧ-статуса и ухудшения состояния.Однако у большинства ВИЧ-положительных пациентов с таким уровнем числа CD4 некротизирующее заболевание пародонта не развивается.

    Лечение некротизирующего заболевания пародонта

    Лечение некротического гингивита может быть успешным, если его лечить на ранней стадии и при отсутствии предрасполагающих системных заболеваний.

    1. Экстренное лечение в острой фазе может включать:

    • обезболивание — парацетамол или нестероидные противовоспалительные препараты
    • обработка некротической ткани десны
    • ополаскиватели антисептические — хлоргексидин или гипертонический раствор
    • регулярная тщательная чистка зубов и использование зубной нити
    • пероральные антибиотики в тяжелой форме или с признаками системной инфекции
    • противогрибковые средства — для пациентов с ослабленным иммунитетом, принимающих антибиотики

    2.Лечите любое предрасполагающее заболевание или триггер. Очень важно бросить курить.

    3. Хирургическая коррекция оставшихся дефектов, например кратеров:

    • гингивэктомия
    • гингивопластика

    4. Поддерживайте хорошую гигиену полости рта и хорошее здоровье, чтобы снизить риск рецидива.

    Однако, когда есть предрасполагающее состояние, такое как СПИД, рецидивы или рецидивы являются обычным явлением.

    Добавить комментарий

    Ваш адрес email не будет опубликован.