Электрофорез по ратнеру методика: Электрофорез по Ратнеру – методика проведения

Содержание

описание процедуры, показания и противопоказания, действие, отзывы

Электрофорез – это метод безопасного и безболезненного введения медицинских препаратов к очагу повреждения. Под воздействием электрических импульсов лекарственные средства превращаются в мельчайшие частицы, называемые ионами, которые впоследствии доставляются в пораженные области. Препараты хранятся в слоях дермы и постепенно с током крови и лимфы расходятся по всему организму.

Как действует электрофорез

Для электрофореза используется гальванический ток – это электрический ток постоянного невысокого напряжения и небольшой силы. Под его воздействием в кожу и слизистые оболочки вводятся частицы лекарственного средства. Самой большой подвижностью обладают ионы тех лекарств, которые растворяется в воде. Оно попадает в эпидермис и накапливается в верхнем слое дермы. Под действием электрического тока медикаменты углубляются до полутора сантиметров, образуя своеобразное хранилище, из которого поступают в клетки и ткани органов.

Основные преимущества электрофореза

Электрофорез с никотиновой кислотой – это движение в электрическом поле заряженных ионов витамина PP. Проникая в ткани различных органов, лекарственное средство равномерно распределяется в межклеточной жидкости и клетках. При выполнении этой процедуры могут использоваться не только гальванические, но и диадинамические, синусоидальные модулированные, флюктуирующие и выпрямленные токи. Сущность процедуры от этого не меняется – никотиновая кислота доставляется в нужное место с помощью электрического тока. Благодаря этой процедуре под кожей создается и хранится запас лекарства, который постепенно расходуется.

Никотиновая кислота продолжительный период медленно поступает в кровоток, улучшая работу больного органа. Благодаря электрическому току ее действие усиливается, поэтому доза препарата вводится незначительная. Кроме этого, выведение лекарства также происходит медленно. Процедура совершенно не причиняет боли, поэтому очень часто врачи назначают грудничкам электрофорез с никотиновой кислотой.

Особенности применения «Эуфиллина»

«Эуфиллин» представляет собой сложный препарат, который используется для:

  • снятия спазмов бронхов;
  • расслабления гладкой мускулатуры;
  • увеличения диуреза;
  • уменьшения тромбообразования;
  • снижения внутричерепного давления;
  • обезболивания;
  • улучшения кровотока.

Электрофорез с эуфиллином противопоказан при проблемах с печенью, почками, сердцем и непереносимостью препарата. Могут возникнуть побочные реакции в виде головной боли, снижения давления, нарушения сна. В процессе манипуляции наблюдаются небольшие покалывания.

Использование никотиновой кислоты для электрофореза

Никотиновая кислота или ниацин – это витамин PP, способствующий улучшению кровообращения. Он содержится в небольших количествах в рыбе, молоке, крупах и фруктах, дрожжах. Искусственные аналоги витамина выпускаются в таблетках. Раствор никотиновой кислоты для электрофореза способствует:

  • Улучшению углеводного обмена. Его используют при заболеваниях сердца, органов пищеварения, печени и сахарном диабете.
  • Заживлению ран на слизистых оболочках и коже.
  • Расширению сосудов.
  • Разжижению крови.
  • Снижению уровня холестерина крови.

Кроме этого, никотиновая кислота оказывает положительное влияние на работу головного мозга и нормализует артериальное давление.

С эуфиллином и никотинкой

Электрофорез с эуфиллином и никотиновой кислотой нередко используется для лечения детей до года при:

  • травмах малыша во время родов;
  • гидроцефальном синдроме;
  • гипо- или гипертонусе мышц.

Для взрослых электрофорез с этими двумя препаратами применяют при:

  • болях в спине;
  • восстановлении кровообращения головного мозга;
  • болезнях шейного отдела позвоночника;
  • нормализации кровотока в конечностях.

Следует помнить, что длительное введение больших доз никотиновой кислоты опасно возникновением жировой дистрофии печени.

Требования к лекарствам для электрофореза

При электрофорезе используют только те препараты, которые под воздействием электрического тока способны проникать в дерму. Они вводятся самостоятельно и в комплексе с использованием других средств для усиления эффекта. Электрофорез можно проводить, если:

  • лекарственный препарат не содержит примесей;
  • раствор приготовлен перед использованием;
  • для приготовления применялась дистиллированная вода;
  • в случае нерастворимости препарата в воде используется медицинский спирт или «Димексид»;
  • готовится раствор ферментов, то растворителем служат буферы;
  • во время всего курса полярность электродов остается неизменной.

Надо отметить, что использовать в качестве растворителя физиологический раствор нельзя. Количество медицинского препарата, который поступает в организм, зависит от:

  • возраста больного;
  • индивидуальных особенностей организма;
  • состояния кожи;
  • площади поверхности электрода;
  • силы и плотности тока;
  • используемого растворителя;
  • продолжительности процедуры;
  • количества препарата.

Электрофорез с никотиновой кислотой грудничку. Отзывы

Часто при различных родовых травмах, внутриутробных отклонениях или возникших заболеваниях грудничкам назначают процедуру электрофореза с никотиновой кислотой. Она расслабляет мышцы малыша, оказывает противовоспалительное и анальгезирующее действие. Ее назначают при следующих патологических состояниях:

  • кривошея, дисплазия суставов;
  • неврологические расстройства;
  • диатез;
  • переломы, вывихи;
  • нарушение мышечного тонуса;
  • болезни пищеварительной системы;
  • воспаления дыхательной и мочевыделительной системы;
  • стоматит;
  • глазные заболевания;
  • родовые травмы;
  • реабилитация после операции.

Электрофорез с никотиновой кислотой для детей является безопасной процедурой и переносится лучше, чем инъекции, но ее нельзя проводить при:

  • почечной и сердечной недостаточности;
  • склонности к аллергии;
  • плохой свертываемости крови;
  • наличии новообразований;
  • бронхиальной астме;
  • гнойничковых высыпаниях;
  • непереносимости электротока;
  • повышенной температуре;
  • повреждениях кожных покровов.

Для грудничков часто используют никотиновую кислоту совместно с эуфиллином. Это дает положительный эффект при нарушении тонуса мышц, родовых травмах и гидроцефалии. Перед процедурой доктор проводит обследование малыша и выявляет противопоказания.

Мнения родителей, детям которых был назначен электрофорез с никотиновой кислотой, неоднозначны. Одни из них считают, что процедуры имеют хороший эффект. Груднички быстрее восстанавливались после родовых травм, особенно если был поврежден шейный отдел. Малыши начали держать головку, переворачиваться и ползать. Другие отмечают, что после нескольких процедур электрофореза с никотиновой кислотой, дети становятся беспокойными, отказываются от груди, у них нарушается сон, появляется аллергическая реакция на коже. Малышам старше четырех месяцев тяжело пролежать без движения весь сеанс.

На самом деле, электрофорез является полезной и безопасной процедурой для грудничков. Лекарство доставляется прямо в пораженные зоны, и ребенок не получает нагрузки на внутренние органы, что очень важно для неокрепшего организма.

Как проводится процедура?

Электрофорез выполняется в физиотерапевтическом кабинете специально подготовленным медицинским персоналом. Для лечения детей раннего возраста, как правило, назначается десять сеансов, каждый из которых длится от 5 до 25 минут. Перед процедурой (за полчаса до нее) ребенок должен быть накормлен. Проводят манипуляцию следующим образом:

  • Ребенок находится в горизонтальном положении. В исключительных случаях разрешают держать его на руках.
  • Марлевую салфетку смачивают в составе лекарственного средства и накладывают на область поражения, фиксируя тканевой повязкой.
  • Электроды помещают на салфетку, включают электрический ток и следят за реакцией малыша. Он испытывает легкие покалывания.
  • После завершения сеанса кожу протирают чистой салфеткой и смазывают детским кремом.

В случае необходимости повторный курс лечения проводится не раньше, чем через месяц. А также существуют и другие методики электрофореза с никотиновой кислотой:

  1. Полостная – в полость больного органа (влагалище или прямую кишку) вводят лекарство и один электрод, а второй оставляют на внутренней поверхности тела. Метод применяется при болезнях органов малого таза и толстого кишечника.
  2. Ванночковая – емкость наполняют медикаментозным средством и погружают в нее поврежденную конечность.
  3. Внутритканевая – при помощи инъекции вводят препарат и на эту же область накладывают электроды. Этот метод дает хороший эффект при заболеваниях дыхательной системы: бронхите и ларингите.

Электрофорез шейно-воротниковой зоны

Безопасность и высокая эффективность лечения токами приобрела большую популярность. Электрофорез с никотиновой кислотой на воротниковую зону используется при повреждении челюстно-лицевых мышц. Он нормализует поврежденные ткани и восстанавливает работу мышц.

Для проведения процедуры используют специальный прибор, генерирующий ток. На пациента надевают специальную прокладку, которая закрывает плечи, шею и лопатки. Под нее кладут фильтровальную бумагу, смоченную теплым раствором никотиновой кислоты. Температура раствора доводится до 38 градусов. Один электрод закрепляют на прокладке, а другой кладут между поясницей и крестцом. Расчет дозировки для проведения электрофореза с никотиновой кислотой на воротниковую зону делается индивидуально для каждого пациента. При этом учитывают:

  • плотность тока;
  • размер прокладки;
  • время проведения процедуры;
  • концентрацию кислоты;
  • способность препарата распадаться на ионы;
  • индивидуальные особенности организма к воздействию электрического тока.

Плотность тока зависит от величины прокладки и находится в обратно пропорциональной зависимости. Во время процедуры сила тока постепенно увеличивается. Курс лечения состоит из 15–20 процедур. При необходимости его можно повторить спустя месяц.

Техника электролечения

Для лечения электрофорезом применяют разные техники, имеющие большую эффективность для лечения определенных заболеваний. Вот несколько из них:

  • По Бургиньону (глазнично-затылочный) – на глаз поверх закрытых век кладут маленькую прокладку, пропитанную лекарственным средством. Вторую – помещают на задней поверхности шеи. Манипуляция продолжается полчаса, сила тока 4 мА. Такое лечение действенно при неврите тройничного или лицевого нерва, при воспалениях и травмах сосудов головного мозга.
  • По Ратнеру – применяют при сбое кровообращения в отделе шеи, ДЦП Особенно широко используется электрофорез по Ратнеру с никотиновой кислотой для лечения послеродовых травм у детей.
  • Назальный – тампон с лекарством вставляют в обе ноздри и прикладывают электрод. Второй размещают на задней стороне шеи с прокладкой 8 х 10. При силе тока в 2 мА манипуляция длится от 10 до 20 минут. Этот электрофорез эффективен для лечения головного мозга с сосудистыми, воспалительными и травматическими патологиями, а также при сбое обменных процессов и язвенных поражениях желудка.

Использование электрофореза для лечения глазных заболеваний

В офтальмологической практике нередко применяют электрофорез на закрытые веки по Бургиньону. Этот щадящий метод лечения используется сразу после травм или операций, при изменениях эпителия роговицы, воспалительных процессах, кровоизлияниях в среде глазного яблока. Особенно часто дети в школьном возрасте страдают миопией. Большая зрительная нагрузка во время учебного процесса и постоянная работа на компьютере приводит к снижению кровотока, что провоцирует слабость аккомодации и дистрофию в диске зрительного нерва.

В профилактических целях для приостановки прогрессирования миопии используют препараты для улучшения гемодинамики глаза и усиления обменных процессов в сетчатой оболочке. Одним из таких лекарственных средств и является витамин PP. А электрофорез с никотиновой кислотой для глаз признан эффективной и безболезненной процедурой. Противопоказания к проведению – это повреждение кожи век, слизисто-гнойные выделения, повышенное внутриглазное давление, различные новообразования и индивидуальная непереносимость.

Электрофорез при остеохондрозе шейного отдела позвоночника

Недостаток движения и сидячий образ жизни часто приводит к деформации шейных позвонков, а это вызывает возникновение остеохондроза. Развитию болезни способствует:

  • неправильная поза посадки за столом;
  • несимметричная работа мышц позвоночника;
  • ношение сумки на одном плече;
  • выполнение физических нагрузок без разминки;
  • использование мягких матрасов и подушек;
  • избыточный вес.

Остеохондроз является хроническим заболеванием, излечить недуг полностью невозможно. Однако снять боль в период обострения и облегчить состояние пациента вполне возможно. Для этого врачи часто назначают электрофорез с никотиновой кислотой. Витамин PP положительно влияет на:

  • метаболические процессы, стабилизируя их;
  • улучшение липидного и углеводного обмена;
  • расширяет кровеносные сосуды, в результате нормализуется кислородный обмен и питание тканей хряща.

Процедуры проводятся ежедневно, курс лечения – это десять манипуляций. Остеохондроз – тяжелое заболевание, причиняющие сильные боли. Иногда для облегчения состояния и усиления эффекта применяют электрофорез с эуфиллином и никотиновой кислотой. Такое лечение дает хороший результат, и больной быстро восстанавливается.

Электрофорез в гинекологии и при беременности

В гинекологии электрофорез широко используется для терапии воспалительных хронических процессов. Его используют для лечения эндометриоза и эрозии шейки матки. В этом случае используют метод тканевого электрофореза, когда лекарство проникает прямо в район повреждения. Без острой необходимости беременным женщинам витамин PP не выписывают, он может содержаться только в витаминных комплексах. Дополнительные дозировки препарата и электрофорез с никотиновой кислотой показан при:

  • патологии плаценты;
  • нарушении функционирования печени, спровоцированной беременностью;
  • зависимости беременной женщины от алкоголя и наркотиков;
  • склонности к тромбообразованию;
  • многоплодной беременности.

В результате у рожениц происходит улучшение оттока лимфы и снабжение кислородом плода. Процедура должна проходить строго под наблюдением врача. При грудном вскармливании электрофорез с никотиновой кислотой делать не желательно.

Побочные эффекты

Электрофорез – это одна из самых безопасных процедур, которая не вызывает тяжелых осложнений. Хотя у грудничков отмечают появление следующих побочных эффектов:

  • В месте наложения электродов происходит покраснение дермы.
  • Возможны раздражения кожных покровов.
  • Во время процедуры ребенок ощущает покалывание. Некоторые малыши начинают капризничать и срывать электроды.

У детей постарше и взрослых во время проведения электрофореза с никотиновой кислотой или через определенное время возможно:

  • появление красных пятен, шелушения кожи или волдырей;
  • учащенное сердцебиение;
  • затрудненное дыхание, одышка, кашель;
  • ухудшение общего состояния — появление вялости сонливости, отсутствие аппетита;
  • повышение температуры тела.

При обнаружении вышеописанных симптомов во время сеанса процедура прекращается. Возникновение признаков недомогания дома требует немедленного обращения в больницу, где врач даст соответствующие рекомендации по устранению возникшей ситуации.

Электрофорез с никотиновой кислотой, отзывы о котором в большей степени положительны, очень широко применяется в медицине и косметологии. Хотя есть пациенты, которым пришлось отказаться от процедур из-за аллергических реакций на препарат или электрический ток. Несмотря на это, электрофорез положительно воздействует на организм как грудничков, так и взрослых людей.

Электрофорез для грудничка: показания, плюсы, препараты

Предназначение электрофореза – неинвазивное введение лекарственных веществ с помощью электротока. Процедура часто применяется в лечении детей младшего возраста. Рассмотрим ее основные преимущества, а также выясним, какие фармакологические вещества обычно используются.

Преимущества электрофореза

Принцип действия электрофореза следующий. Лекарственное вещество наносится на кожу, прокладку или электрод. Электроток проходит через его частицы (ионы) и приводит их в движении. В результате они проникают через потовые и сальные железы в дерму либо слизистые оболочки. Затем средство равномерно распределяется в клетках, откуда попадает в крово- и лимфоток и доставляется к определенным органам и тканям.

Степень всасывания медикаментов зависит от многих факторов, среди которых их концентрация, параметры тока, продолжительность процедуры, свойства кожи пациента и так далее. Учитывая их, физиотерапевт может регулировать уровень воздействия лекарства (местный или системный). В любом случая процедура абсолютно безболезненна.

Основные преимущества введения лекарств с помощью тока:

  1. доставка действующих веществ в наиболее активном виде непосредственно в пораженные области
  2. низкое системное влияние синтетических соединений на организм, благодаря чему уменьшается риск побочных эффектов
  3. иммуностимулирующее и рефлекторное влияние тока

Показания и противопоказания

Грудничкам электрофорез назначают для лечения:

  • дисплазии тазобедренных суставов – врожденной патологии, для которой характерно неправильное развитие суставов
  • кривошеи – искривления шейного отдела в результате травм или врожденных аномалий
  • гипо- и гипертонуса мышц
  • родовых травм
  • болевого синдрома при различных нарушениях
  • гепатита
  • заболеваний ротовой полости – стоматита, гингивита
  • патологий сердечно-сосудистой системы
  • неврологических проблем и так далее

Очень часто при заболеваниях ЦНС и нарушениях в работе опорно-двигательного аппарата наряду с электрофорезом назначают лечебный массаж.

Воздействие электротоком противопоказано малышам при:

  • опухолях
  • сердечной недостаточности
  • острой фазе любого заболевания
  • гипертермии
  • астме
  • проблемах со свертываемостью крови
  • дерматите, экземе и любых повреждениях в обрабатываемой зоне
  • непереносимости тока

Кроме того, перед сеансом важно убедиться, что у ребенка нет аллергии на применяемый препарат.

Выбор лекарственного средства и методики проведения электрофореза осуществляется в зависимости от поставленного диагноза.

Процедура по Ратнеру

Данная техника была разработана ученым А.Ю. Ратнером. Она предполагает электрофорез с двумя препаратами –эуфиллином и папаверином.

Эуфиллин – средство, содержащее теофиллин и этилендиамин. Оно обладает такими свойствами, как:

  • расширение сосудов, расслабление гладкой мускулатуры и усиление кровообращения в месте воздействия
  • активизация работы сердца и дыхательного центра
  • разрушение тромбов
  • повышение диуреза

Папаверин – спазмолитик, эффективно устраняющий мышечные спазмы и связанную с ними боль.

Электрофорез с эуфиллином и папаверином назначают для лечения:

  • родовых травм
  • нарушения кровотока в шейном отделе позвоночника
  • ДЦП

Процедура по Ратнеру проводится так. Лекарственная прокладка с эуфиллином (5% раствором) накладывается на шею, а папаверином (1% раствором) – на правую часть грудины. Затем включается ток силой 1-2 мА. Длительность сеанса – 15 минут.

Электрофорез для грудничков с эуфиллином также практикуется при:

  • дисплазии тазобедренных суставов
  • повышенном внутричерепном давлении
  • нарушении кровотока в головном мозге
  • воспалительных очагах в хрящах и мягких тканях
  • повышенном или пониженном тонусе мышц

Воздействие током проводится в медицинском учреждении. Фармакологическое вещество наносится на специальную бумагу, она наматывается на электрод, сверху выстилается слой марли и вся эта конструкция прижимается к коже.

Зона наложения электрода с эуфиллином выбирается в зависимости от проблемы: при тонусе мышц и гипоксии обрабатывается шейный отдел, при нарушении строения тазобедренных суставов – ягодицы и так далее. Время сеанса, количество лекарства и силу тока определяет специалист. Обычно требуется около 10-15 процедур. Кроме того, малышу может быть показан массаж.

Другие препараты

Помимо процедур с эуфиллином, в педиатрии часто назначают электрофорез с магнезией, дибазолом, никотиновой кислотой и кальцием. Рассмотрим, для чего применяются эти препараты.

Магнезия – магниевая соль серной кислоты, обладающая спазмолитическим, расслабляющим, сосудорасширяющим, успокоительным, слабительным и другими действиями. Для проведения электрофореза детям используется 20% раствор магнезии. Процедура применяется для улучшения кровообращения, расслабления мышц и снятия нервного напряжения, а также для улучшения отхождения мокроты при бронхите.

Дибазол – лекарство, действующим веществом которого является бендазол. Оно способствует:

  • снятию спазмов
  • расслаблению гладкой мускулатуры
  • снижению давления
  • улучшению кровотока
  • активизации межнейронной передачи сигналов в спинном мозге
  • повышению иммунитета

Грудничкам процедуры с ним назначают для лечения родовых травм, неврологических нарушений и гипертонуса мышц.

Никотиновая кислота в ампулах – синтетический аналог витамина РР, основные свойства которого – улучшение углеводного обмена, ускорение регенерации тканей и расширение сосудов.

Электрофорез чаще всего проводится с двумя препаратами – эуфиллином и никотиновой кислотой. Он помогает при нарушении тонуса мышц, гидроцефалии и травмах, полученных во время родов.

Процедуры с кальцием в форме глюконата или хлорида показаны детям при дистрофии мышц, гингивите (в комплексе с никотиновой кислотой и витамином С), и костных ядрах в тазобедренных суставах.

Польза массажа

Массаж – универсальный физиотерапевтический метод, который можно применять для коррекции различных проблем со здоровьем у детей с первого месяца жизни. Основные показания к нему:

  1. Дисплазия тазобедренных суставов. С помощью различных движений (поглаживания, растирания, валяния) можно добиться полного восстановления нормальной структуры суставов
  2. Кривошея. Массаж шейного отдела позволяет устранить спазм дельтовидной мышцы и «вернуть на место» позвонки
  3. Гипотрофия и рахит. Благодаря воздействию мышцы укрепляются и активнее растут
  4. Пупочная грыжа. Массаж помогает укрепить абдоминальные мышцы, что способствует затягиванию грыжи. Наряду с этим устраняются спазмы кишечника.
  5. Респираторные заболевания. Специальные техники позволяют добиться облегчения отхождения мокроты при бронхите и пневмонии.
  6. Гипо- и гипертонус. При повышенном напряжении мышц проводится расслабляющий массаж, а при снижении тонуса – стимулирующий.

Кроме того, массаж показан любому ребенку в качестве общеукрепляющей процедуры.

Отзывы родителей показывают, что после профилактического курса их малыши становились более активными, быстрее, чем сверстники, осваивали навыки самостоятельного сидения, ползания и ходьбы.

Лечебный массаж назначается врачом, он же определяет продолжительность курса и технику манипуляций. Перед профилактическим курсом также желательно проконсультироваться с доктором, чтобы он установил, нет ли противопоказаний к нему.

Для проведения манипуляций лучше обратиться к специалисту. Не имея подготовки, не стоит массировать ребенка самостоятельно, особенно если у него есть проблемы со здоровьем.

Электрофорез для грудничков – безболезненная и безопасная процедура, назначаемая при различных патологиях опорно-двигательного аппарата, ЦНС, респираторной системы и так далее. Как правило, она практикуется не сама по себе, а в комплексе с другими методиками – массажем, приемом лекарств, гимнастикой. Очень важно, чтобы лечение контролировал опытный специалист.

Читайте также:

Электрофорез для грудничков с эуфиллином, магнезией: что это такое, отзывы

Процедура неинвазивного ввода необходимых препаратов называется электрофорез для грудничков. Она предполагает использование электрического тока. Для быстрой и эффективной подачи необходимых для скорейшего выздоровления веществ. Для грудничка данный вариант лечения считается оптимальным. Он обладает целым рядом преимуществ. Получить результат можно только в том случае, если правильно подобрать фармакологический препарат.

Достоинства процедуры

Электрофорез для грудничков обладает уникальными свойствами, поэтому широко используется в современной медицине. Посредством его использования действующий компонент наносится непосредственно на прокладку, к которой подводится активный электрод.

Процедура полезна для младенцев, ведь ионы заставляют активно двигаться частицы лекарства. В организм компоненты поступают через потовые или слизистые оболочки, поэтому эффект заметен уже через несколько дней активного использования. Средство равномерно распределяется по кровотоку и поступает к внутренним органам и тканях.

Младенцам электрофорез помогает увеличить степень всасывания медикаментов. Положительный эффект достигается посредством использования определенных параметров электрического тока. При этом немаловажное значение играют основные свойства человеческой кожи. Правильно назначить электрофорез детям до года может только физиотерапевт. Дополнительно он должен контролировать уровень воздействия препарата на организм крохи. На сегодняшний день не были выявлены негативные эффекты от регулярного использования электрофореза.

Грудному ребенку электрофорез дает возможность ощутить следующие преимущества:

  • Все необходимые для лечения или профилактики вещества поступают в пораженные участки быстро, поэтому лечение становится более эффективным.
  • Уменьшается вероятность влияния синтетических компонентов на внутренние органы крохи. За счет этого удалось заметно снизить вероятность развития побочных эффектов.
  • Воздействие на шейный отдел позвоночника стимулирует работу иммунитета посредством влияния электрического тока.

Показания

Проведение электрофореза новорожденным назначается в следующих случаях:

  • Наличие врожденных патологий в тазобедренной области. На фоне этого невозможно представить нормальное развитие суставов.
  • Электрофорез шейного отдела позволяет предотвратить искривление и избавиться от врожденного варианта патологий.
  • Неправильное развитие мышц малыша.
  • Во время родовой деятельности крохе была нанесена незначительная травма, которая при отсутствии необходимого лечения может существенно усугубиться.
  • Сильные боли, мешающие малышу.
  • Различные гепатиты.
  • Развитие стоматологических болезней.
  • Нарушения в работе сердца и сосудов.
  • Патологии в работе нервной системы.

Для того чтобы добиться максимального эффекта от электрофореза, целесообразно дополнительно производить лечебный массаж. Благодаря ему удается улучшить работу опорно-двигательной системы. Манипуляция может быть назначена также в профилактических целях.

Процедура проводится в специальном физиотерапевтическом кабинете

Детьми электрофорез не может использоваться в одном из следующих случаев:

  • У малыша ранее были диагностированы опухоли разной степени тяжести.
  • Неправильная работа сердца.
  • В данный период болезнь находится на стадии обострения.
  • Гипертермия.
  • Бронхиальная астма.
  • У грудничка были выявлены патологии со свёртываемостью крови.
  • Серьезные болезни кожного покрова, которые носят хронический характер.
  • Индивидуальная непереносимость электрического тока.

У грудничка противопоказания также могут быть к определенному препарату, который будет использоваться на процедуре. Выбор одного из них напрямую зависит от методики и диагноза, который был поставлен ранее.

Процедура по Ратнеру

Впервые электрофорез был предложен к использованию этим ученным. Проведение процедуры по Ратнеру предполагает свои особенности. В ее ходе принято пользоваться папаверином. В зависимости от формы и характера проявления болезни дополнительно может быть назначен эуфиллин. Родителя интересно, как делают процедуру и за счет чего достигается положительный эффект:

  • Расширение сосудов благотворно влияет на функционирование мышц сердца. Благодаря этому достигается повышение кровообращения на местном уровне.
  • Нормализуется работа сердца и сосудов. Положительный эффект наблюдается также в органах дыхания.
  • Снижение вероятности образования тромбов.
  • Повышение уровня диуреза.

Папаверин не вреден. Его назначают в качестве эффективного спазмолитика. Он помогает в течение короткого времени избавиться от болевых ощущений, которые проникают в грудную клетку.

Электрофорез с эуфиллином грудничку целесообразно использовать для устранения следующих патологий:

  • ребенок получил травму во время родов;
  • нарушение движения крови, которое наблюдается в районе шеи;
  • ДЦП.

Для проведения манипуляции необходимо взять эуфиллин в пятипроцентной концентрации. Одновременно назначается также папаверин. Электрофорез с эуфиллином на шейный отдел грудничку должен продолжаться не более 15 минут.

Курс лечения помогает избавиться от большого количества патологий. Его целесообразно использовать в следующих ситуациях:

  • Патологии в функционировании суставов в тазу или бедрах.
  • У малыша было обнаружено увеличение давления внутри черепа.
  • Неправильная циркуляция крови черепа.
  • Наблюдается наличие воспаления в отдельных тканях и хрящах.
  • В мышцах фиксируется снижение или повышение тонуса.

Электрофорез может производиться исключительно в медицинских учреждениях. Перед его началом препараты наносятся на специальную бумагу, к которой подводится электрод. Дополнительно целесообразно обернуть его в материю. Медицинский работник должен побеспокоиться о том, чтобы конструкция достаточно плотно прилегала к телу.

Выбор места воздействия напрямую зависит от жалоб пациента. Чаще всего электрофорез используется для лечения шейного отдела. Однако положительный эффект наблюдается также в случае наличия патологий в работе тазобедренных суставов или ягодиц. Интенсивность и длительность процедуры определяется специалистом в данной области. Положительный эффект достигается при воздействии на протяжении воздействием тока на протяжении не менее чем 10 минут. Для улучшения положительного эффекта производится также лечебный массаж.

Магнезия помогает быстро и эффективно избавиться от боли

Выбор препарата для электрофореза

Медикамент напрямую зависит, от чего назначают проведение данной процедуры. Только врач сможет правильно оценить ситуацию и правильно назначить курс лечения. Именно поэтому важно обратиться к специалисту в данной области.

Электрофорез с магнезией производится для устранения спазмов и расслабления мышц. Такая процедура также сужает сосуды и успокаивает кроху. Дополнительно родители отмечают очевидный послабляющий эффект. Для этого достаточно использовать вещество в двадцатипроцентной концентрации. После пройденного курса лечения отмечается снижение уровня нервного напряжения. Улучшается работа верхних дыхательных путей на фоне отхождения мокроты.

Электрофорез с дибазолом оказывает сразу несколько положительных воздействий на функционирование организма крохи:

  • устраняет полностью или уменьшает интенсивность спазмов;
  • гладкие мышцы расслабляются;
  • нормализуется давление;
  • циркуляция крови производится в нормальном режиме;
  • в спинном мозге активируется передача между нейронными клетками;
  • улучшается работа защитных функций организма.

Бендазол назначается в случае необходимости борьбы с родовыми травмами. Лечение тренталом целесообразно производить в случае выявления нарушений в функционировании нервов и мышц.

Улучшить эффект от воздействия током помогает массаж

Для проведения процедуры возможно также использовать синтетический аналог витамина РР. Это никотиновая кислота, которая выпускается в форме ампул. Она помогает улучшить обмен углеводов. Вещество способствует запуску естественной регенерации тканей. Также регулярные манипуляции расширяют сосуды.

Электрофорез с кальцием помогает малышам преодолеть дистрофию мышц. Его целесообразно производить в дополнении никотиновой кислотой и витамином С. Примочки прикладываются в район бедер и таза.

Массаж – это действенный метод терапии, который не может оказать негативное воздействие на организм младенца. Его допускается использовать с первого дня жизни. Массаж заметно увеличивает эффект от любых общеукрепляющих процедур.

Отзывы

Рита, 28 лет
Для лечения гипертонуса моему сыну был назначен электрофорез. После окончания курса лечения он стал намного активнее. Также Марк стал самостоятельно сидеть и ползать. Всего через месяц после электрофореза он стал активно ходить. Врачом также был назначен массаж. Я заметила только положительные моменты после лечения, поэтому настоятельно рекомендую его пройти даже в целях профилактики.

Марина, 23 года
Педиатр назначил нам электрофорез в возрасте 2 месяцев. Я была уверена в его компетентности, поэтому выполняла все рекомендации. Дочери понравился массаж. Надеемся, что пройденный курс послужит профилактикой развития серьезных болезней опорно-двигательной системы в будущем.
Электрофорез отличается высокой эффективностью и быстрым результатом. Именно поэтому его допускается использовать для лечения грудных детей. Процедура помогает справиться с нарушениями движения и работы нервной системы.

Электрофорез при кривошее на приборе Элфор — 3 ответов на Babyblog

Нам год и два. Установочная кривошея. Решила приобрести прибор Элфор и делать электрофорез дома сама. Дальше — все подробно. То, чего я не нашла в интернете, когда очень было нужно. Надеюсь, кому-то еще пригодится.

Год назад нам было два месяца, мы жили в мегаполисе и без проблем отходили на электрофорез и массаж. Сейчас мы живем в области, в селе, в частном доме. До местной амбулатории (районное подразделение поликлиники) очень сложно добираться своим ходом, на такси разоришься, и по межсезонью стоять с малышом на остановках по часу-два врагу не пожелаешь и цеплять лишний раз ОРВИ в амбулатории и автобусах не хочется. После долгих раздумий купила прибор для домашнего электрофореза Элфор. Цена смешная. Прибор пригодится всей семье. Его здесь описывать не буду, таких статей много. Напишу конкретно по нашему случаю, что и как мне объяснила медсестра физиотерапевтического кабинета из амбулатории.

Первое, в комплект к прибору не входят прокладки для процедуры. Пишут, что можно использовать марлю или бинт. Нет. Только фланель. Нужно самим изготовить две прокладки. Каждая состоит из пяти сшитых по периметру прямоугольных двойных тряпочек размером 5см на 8см. В верхней предусмотреть кармашек для резиновой штучки с электродом. По торцам эти пять тряпочек в середине перехватить стежком, скрепив таким образом. У вас получилась этакая вафелька из фланели с кармашком на одной стороне. Устанавливать электрод в кармашек нужно сверху, чтобы между кожей и электродом были все эти слои.

Далее берем чистую теплую воду, смачиваем прокладки и отжимаем. На одну из них капаем необходимое лекарство. У нас первый курс с эуфиллином. Я смогла найти в аптеке 2,4%. Невролог нам выписала 1,2%. Вообще его надо заказывать в рецептурном отделе, но здесь с этим проблема. Не страшно! Прокладка у нас уже мокрая, лекарства достаточно налить совсем немного, из ампулы буквально пятую часть. Для эуфиллина без разницы на какой электрод прикладывать лекарство (+ или -). В случае нашей кривошеи смоченную с лекарством прокладку, в которую вставлена резиновая пластина с электродом «+» прикладываем в основании шеи на спине. Вторую прокладку «-«, смоченную только в воде, прикладываем на середину поясницы. (важно — плюс всегда на шею, минус на поясницу) Как вариант можно на грудину, если например наблюдается слабость развития рук. Прокладки крепим эластичными (не резиновыми!) бинтами, ту, что на шее сзади по принципу «рюкзака» перехватывая спереди плечи.

Прибор сначала пробуем на себе, прикладывая прокладку с электродом на шее спереди или на внутреннем сгибе локтя, где наиболее нежные места. Включаем и колесиком определяем нужную силу тока, чтобы не сделать ребенку ожог. Идеально на минимуме, так как от силы тока эффективность не зависит. Когда определились, крепите на ребенка прокладки и включайте прибор. Сила тока минимальная (колесико на минимум), время процедуры 10 минут.

После процедуры прокладки необходимо в течение 1 часа промывать в холодной проточной воде (например, положив в ковшик и открыв кран). После кипятить в течение 30мин. И наконец повесить сушить. На следующий день использовать снова.

Процедуру электрофореза нужно делать через 40 минут после еды. Она оказывает возбуждающее действие, так что перед сном тоже не стоит. Если в этот день еще есть сеанс массажа, то между ними нужно выдержать 4 часа. Если у ребенка повысилась температура, или режутся зубки и он капризничает — процедуру не делать.

Второй курс у нас будет с сульфатом магния. Я купила ампулы 250мг/мл. Этот препарат всегда вводится с электрода «+».

Курсы по 10 сеансов либо делать ежедневно, не пропуская ни дня, один за другим. То есть 20 дней. Либо между курсом эуфиллина и курсом сульфата магния выдержать перерыв 1 месяц.

И в заключение, электрофорез, конечно, штука хорошая. Но в случае с кривошеей основной упор нужно делать на массажи. Они эффективнее.

Электрофорез для грудничков с эуфиллином, магнезией: что это такое, отзывы

Преимущества физиолечения

Электрофорез назначается не только взрослым, но и новорожденным для лечения многих патологических состояний. Его терапевтическое действие многогранно:

  • анальгезирующий эффект;
  • ингибирование воспалительного процесса;
  • уменьшение отечности;
  • нормализация кровообращения;
  • стабилизация нервной системы;
  • улучшение обменных процессов.

Введение лекарств в организм физиотерапевтическим способом обладает рядом преимуществ по сравнению с инъекциями или пероральным приемом. Плюсы физиопроцедуры:

Понятие аллергии на электрофорез неверно. Побочные эффекты в виде покраснения, зуда, сыпи являются следствием аллергической реакции на конкретный медикаментозный препарат. Снизить риск возникновения подобных осложнений можно, тщательно учитывая абсолютные и относительные противопоказания к конкретной процедуре. В противном случае симптомы могут усилиться, высыпания могут чесаться. Без адекватной терапии влияние электролечения будет отрицательным.

При электротерапии в месте соприкосновения прокладок с лекарством не должно быть ссадин, царапин, порезов, высыпаний, родинок и родимых пятен. При их наличии врач-физиотерапевт подберет методику таким образом, чтобы избежать воздействия на эти зоны.



Что же это за процедура

С помощью метода электрофореза в детский организм вводятся медицинские препараты в жидкой форме, при этом лекарства поступают непосредственно в больной орган. Для этого используют минимальный разряд тока, который не способен причинить боль или вред здоровью детки.

Вся суть процедуры заключается в том, что к определенному участку тела крепят металлические пластины, через которые подается электрический ток, который в свою очередь способствует проникновению лекарства в организм, непосредственно к нуждающемуся органу.

Правила проведения электролечения

Перед началом курса терапии нужно убедиться в отсутствии у пациента аллергии на лекарственный препарат. Кроме того, он должен хорошо переносить воздействие гальванического тока. Суть метода заключается в поступлении необходимых медикаментов через кожу, минуя желудочно-кишечный тракт. Перечень средств, разрешенных к применению во время электрофореза:

  • антибиотики пенициллинового ряда;
  • витамины;
  • лидокаин, новокаин;
  • химические вещества (калий, медь, йод, цинк).

В зависимости от очага поражения электрофорез накладывают на область поясницы, сустава (нога, рука), живот. Если после электрофореза болит низ живота, скорее всего, сеанс проводили при обострении заболевания. Красные пятна после электрофореза свидетельствуют об аллергической реакции на препарат.

Для эффективного действия достаточно минимальных концентраций лекарственных веществ. Растворы готовят непосредственно перед использованием. Допускается их хранение до 7 суток. Концентрации растворов:

  • йод, кальций, калий – 1-10%;
  • медь, цинк – 0,1%;
  • новокаин – 1г растворить в 100 мл 0,5% раствора соды.

При превышении допустимых значений может возникнуть ожог после электрофореза.

На чем основана процедура?

В процессе электрофореза лекарственные вещества переносятся с помощью минимального электрического поля к разным частям тела. Ток подается на железные пластины, укутанные слоем марли, пропитанной лечебным раствором. По электрическому полю лекарство достигает области воспаления. Например, электрофорез с магнезией на воротниковую зону назначают для лечения кривошеи у ребенка. В комплексе с массажем шейно-воротниковой зоны (швз) он обеспечивает равномерный приток и циркуляцию крови, оказывает анальгезирующее действие.

Сама процедура не причиняет детям болезненных ощущений. Если расчет величины тока точный, то она вызывает едва ощутимое покалывание. Ребенок может испытывать неудобство только от прохладной материи салфеток. Концентрация лекарственных веществ у новорожденных младенцев меньше, чем у взрослых людей, однако, на эффективности процедуры это не отражается. Физиотерапия часто используется в комплексе с основным лечением и массажем. Польза применения метода подтверждается его повсеместным использованием при заболеваниях различных органов и систем.

Особенность попадания жидкого лекарственного вещества в организм через кожу значительно снижает процент возникновения побочных реакций у ребенка. Кроме того, процедура не вызывает отрицательных эмоций у крохи, как в случае с инъекциями медицинских препаратов.

Показания к электрофорезу у новорожденных

Малышу физиопроцедура может быть назначена при костно-мышечных патологиях, расстройствах неврологического характера, болезнях пищеварительного тракта, стоматитах, родовых травмах, для ускорения реабилитации после оперативного вмешательства. Подобная методика более безопасна для здоровья ребенка, чем постановка инъекций препаратов. В зависимости от локализации патологического процесса и места прикрепления электрода сыпь после электрофореза у грудничка может появиться на шее, пояснице, груди, в области суставов.

Чтобы раздражение после электрофореза не возникало, необходимо учитывать противопоказания:

  • почечная или сердечная недостаточность;
  • нарушение свертываемости крови;
  • наличие в истории болезни аллергии любого характера;
  • высыпания на коже;
  • острый инфекционный процесс.

Красные пятна после электрофореза у грудничка являются реакцией кожных покровов. Если они появились через время после процедуры, необходима консультация врача. В таком случае метод введения лекарств нужно заменить на другой.

На выбор лекарственного средства влияет диагноз ребенка. Чаще всего врачи назначают:

  • эуфиллин при дисплазии суставов, мышечном гипертонусе;
  • кальций при переломах и частых кровотечениях, гингивитах;
  • магнезию для терапии патологий дыхательных путей, при болевом синдроме и желтухе;
  • папаверин, чтобы устранить спазмы различного характера;
  • дибазол при неврологических нарушениях;
  • лидазу в случае заболеваний органов зрения.

Стоит отметить, что препарат и его концентрацию определяет только врач.

Боли после электрофореза могут возникать при внутритканевом способе введения препарата из-за инъекций. Во время проведения процедуры и после нее нужно наблюдать за ребенком, чтобы не было нежелательных реакций: высыпаний и раздражений. Также может появиться одышка или приступ кашля. Такой побочный эффект, как красные пятна, иногда возникает из-за большой подвижности ребенка.

Аллергическая реакция на препараты может быть мгновенной или проявиться через время. Ее основными симптомами являются сыпь в виде пузырей по всему телу, крапивница, учащение сердцебиения. В таком случае лечение прекращают.

Электрофорез для грудничка на дому

Если при проведении процедуры родители боятся, что их малых подхватит инфекцию или это психологически его потревожит, то можно проводить электрофорез в домашних условиях. Для этого нужно приобрести аппарат, внимательно изучить инструкцию и технику безопасности. На первый раз пригласите медсестру. Она все наглядно покажет и расскажет. Получите у врача предписание о количестве процедур и название лекарственного препарата. Не проводите физиопроцедуру больше положенного времени. Для грудничков — это не больше восьми минут.

Во время процедуры лечебные вещества проникают к участку воспаления, воздействуя на него. При этом не происходит растворения лекарства в желудке. Не используются вспомогательные вещества, что значительно снижает нагрузку на почки, печень и селезенку.

Если после первых процедур малыш ведет себя беспокойно, то прекратите использование аппарата.

Виды лекарственной физиотерапии

Электрофорез с карипаином назначают для лечения грыжи межпозвонковых дисков и искривлений позвоночника. Эффект от процедуры обезболивающий и противоотечный. После прохождения курса физиолечения повышается прочность и упругость межпозвонкового диска. Физиопроцедура переносится хорошо, не вызывает нежелательных реакций.

Чтобы избежать отрицательных последствий, во время первого сеанса дозировка должна быть минимальной.

Противопоказания к проведению:

  • онкологические образования;
  • нарушение целостности кожи;
  • болезни сердца и почек.

Иногда в конце процедуры пациент может ощутить дискомфорт и боль, эти явления являются кратковременными, их лечить не нужно. С особой осторожностью следует проводить электрофорез дома. Длительные боли после электрофореза говорят о непереносимости препарата. Электролечение с димексидом показано при следующих заболеваниях:

Процедура используется при невозможности традиционного медикаментозного лечения из-за язвенной болезни желудка и 12-перстной кишки. Чтобы избежать появления раздражения после электрофореза и других побочных эффектов, его не проводят в ряде случаев:

  • при аллергии на димексид;
  • в третьем триместре беременности;
  • при соматических заболеваниях в стадии декомпенсации;
  • в пожилом возрасте;
  • при наличии ран на поверхности кожи.

Слабая концентрация вещества (5-10%) обеспечивает безопасность физиопроцедуры. По отзывам пациентов, она безболезненна и побочные эффекты появляются крайне редко.

Физиотерапевтическое лечение может использоваться в качестве основной и вспомогательной процедуры, в зависимости от показаний к применению. Если врач назначил курс электрофореза, не пропускайте сеансы и соблюдайте рекомендации для ускорения выздоровления.

Электрофорез ребенку назначается довольно часто для лечения некоторых патологий. С его помощью в организм малыша вводятся активные вещества, которые поступают непосредственно в пораженное место. Используют для этих целей минимальный разряд тока, чтобы не причинить вред здоровью маленького пациента. Продолжительность манипуляции зависит от возраста ребенка.

Сочетание прививок и электорофореза

Согласно международному календарю прививок ребенок должен получить вакцину в определенный день своей жизни, но при различных заболеваниях (в острой фазе или ремиссии) вакцинацию следует отложить, предварительно обсудив с детским врачом. Прививки обязательная процедура в детском возрасте, так как это гарантирует защиту ребенка от генерализованных заболеваний, результат которых может быть самым трагическим. На сегодняшний день уровень риска и степень пользы от прививок очень сложно оценить самостоятельно. Есть мотивированные мнения «ЗА» и «ПРОТИВ», решение о целесообразности прививок видимо ложится на плечи родителей. Электрофорез с различными лекарственными веществами назначается курсом для достижения эффективности лечения, а потому прививки могут совпасть по времени с проведением курса электрофореза. При беседе с детски врачом, каждая мама сможет уточнить, что никаких отрицательных последствий при совмещении курса физиотерапевтических процедур и прививки нет. Однако, в день проведения прививки, не стоит проводить электрофорез, или же можно отложить прививку после проведения курса процедур. Параллельное совмещение всех процедур и прививки могут отрицательно сказаться на здоровье ребенка, а потому врач – педиатр обычно советует провести прививку после окончания всех лечебных процедур.

Гулять после проведения электрофореза детям грудного возраста не рекомендуется. Электрофорез, как уже указывалось выше, абсолютно безопасный и безболезненный метод, но ослабленный и незащищенный организм грудного ребенка может быть подвержен различным агрессивным агентам, а потому длительные прогулки не рекомендуются. Не воспрещается гулять с ребенком спустя несколько часов после окончания процедуры. Кроме электрофореза детям грудного возраста и более старшего может быть назначен лечебный массаж, явное положительное влияние будет наблюдаться при дисплазии тазобедренного сустава и гипертонусе мышечной системы. После введения лекарственных веществ, расширяющих кровеносные сосуды, и улучшающие кровообращение, дополнительный сеанс массажа поможет расслабить мышечные волокна и улучшить обмен веществ в них. После совмещения электрофореза лекарственных веществ и массажа гипертонус мышечной системы снизиться, и ребенок сможет полноценно поворачивать голову, переворачиваться с животика на спинку, наступать полной стопой, без опасения развития патологических осложнений.

Принцип действия

Электрофорез представляет собой движение в электрическом поле заряженных ионов, способных переносить в жидкой или парообразной среде различные частицы. Принцип действия следующий. На дерму кладут прокладки электродов, обернутые тканью, пропитанной лекарственным средством. Благодаря воздействию тока растворы препаратов распадаются на ионы, образуя гидрофильные заряженные комплексы, которые проникая в биологические ткани оказывают лечебное действие. Большая их часть задерживаясь в коже, проявляет местный терапевтический эффект.

Оставшаяся часть вместе с током крови и лимфы разносится по всему организму. Положительно заряженные частицы оказывают обезболивающее, успокаивающее, антивоспалительное и обезвоживающее действие. Отрицательные нормализуют процессы обмена, расслабляют, расширяют сосуды. Кроме того, электрофорезу присущ незначительный согревающий эффект.

Показания и противопоказания

Для чего назначают электрофорез детям? Эта процедура отлично справляется с остаточными явлениями простуды и ее зачастую рекомендуют детские доктора в восстановительный период. А также его назначают для лечения следующих патологических состояний:

  • Родовые травмы.
  • Аномалии и врожденные пороки сердца.
  • Ожоги.
  • Костно-мышечные нарушения.
  • Гипер- или гипотонус мышц.
  • Для уменьшения болевых ощущений при различных недугах.
  • Лор-болезни.
  • Неврологические нарушения.
  • Диатез.
  • Болезни глаз.

Кроме того, его применяют, когда необходимо направить действие лекарства непосредственно в центр очага воспаления.

Как часто можно делать электрофорез ребенку? Любое физиотерапевтическое лечение назначается с частотой не более четырех раз в год. Интервал между курсами должен быть не менее трех месяцев.

Противопоказана эта процедура при наличии у детей:

  • повреждения кожи в месте наложения электродов;
  • гнойничков;
  • дерматита;
  • высокой температуре;
  • почечной и сердечной недостаточности;
  • опухоли;
  • бронхиальной астме в острой стадии;
  • острого воспалительного процесса;
  • нарушения свертываемости крови и риске кровотечения;
  • аллергических проявлений на медикаменты, рекомендуемые для проведения процедуры электрофореза.

Когда нужен электрофорез

Показания, когда назначается электрофорез для грудничков, довольно разнообразны. Данную процедуру могут приписать:

  1. Если у ребенка обнаружена дисплазия тазобедренных суставов.
  2. Имеются различные патологии или врожденные пороки сердца (применение кальция).
  3. Для лечения и профилактики родовых травм.
  4. Различные патологии опорно-двигательного аппарата.
  5. Имеются патологии органов дыхания (ЛОР, бронхиты и т. п.).
  6. Патологии зрения.
  7. Заболевания нервной системы.
  8. Детский церебральный паралич.
  9. Стоматиты.
  10. Болезни глаз.

Преимущества и недостатки

Довольно часто назначается лекарственный электрофорез детям. Что это такое? Это одновременное воздействие на организм электрического тока и препарата. Использование этого физиотерапевтического метода дает хороший эффект.

  • отсутствует ощущение дискомфорта;
  • нет риска развития аллергических или иных неблагоприятных реакций местного или общего характера;
  • длительность терапевтического эффекта от суток до двадцати;
  • имеется возможность введения медикамента непосредственно в пораженный участок, минуя сосудистую систему и ЖКТ;
  • малыши старше года обычно хорошо переносят эту процедуру.

Среди недостатков следует отметить:

  • наличие противопоказаний у конкретного индивида;
  • не все лекарства можно ввести данным методом.

Особенности действия электрического тока у маленьких пациентов

Что дает электрофорез детям? Лечение этой методикой позволяет частично отказаться от перорального или инъекционного приема медикаментов.

Рассмотрим некоторые особенности детского организма:

  1. Морфофункциональная незрелость дермы – тонкий наружный слой. В нем содержится малое количество клеточных слоев, которые рыхло связаны с тонким бесклеточным слоем, отделяющим соединительную ткань от эндотелия (базальной мембраны).
  2. У малышей младше четырех месяцев неразвиты потовые железы, а также внутрикожные сосуды склонны к расширению.
  3. Кожные покровы обладают высокой интенсивностью молекулярного взаимодействия с водой, т. е. они имеют низкое сопротивление к электрическому току и с большой скоростью впитывают вещества.
  4. Химическая и температурная регуляция недостаточно развита, поэтому процедуру электрофореза проводят осторожно.

В период манипуляции, длительность которой зависит от возраста, необходим контроль за состоянием ребенка со стороны и медиков, и родителей.

Под воздействием тока наблюдаются такие эффекты, как:

  • лимфодренажный;
  • гормонорегулирующий;
  • сосудорасширяющий;
  • лимфодренажный;
  • противовоспалительный;
  • миорелаксирующий;
  • иммуностимулирующий.

Можно ли проводить процедуру дома

По большому счету, электрофорез можно проводить и в домашних условиях. Однако есть одно большое НО: неправильное проведение процедуры, несоблюдение времени воздействия тока, нарушение дозировки вводимого лекарства могут привести к пагубным последствиям.

Следовательно, процедура электрофореза самостоятельно дома должна осуществляться обученным человеком, чтобы исключить возможные ошибки и сделать процедуру безопасной для ребенка. Особенно, когда речь идет о детях до года.

Недопустимо самостоятельное назначение этой физиопроцедуры. Для нее должны быть четкие показания, которые устанавливает лечащий доктор.

Лечение дисплазии тазобедренных суставов

При ДТБС у детей до года часто назначают в комплексной терапии электрофорез с парафином и кальцием, лечебный массаж и гимнастику. В некоторых случаях, если есть показания, назначают разводящие механизмы (стремена, подушка Фрейка, гипс в серьезных случаях и преимущественно деткам старше года).

Лекарственные средства, используемые для физиопроцедуры

Как уже упоминалось, довольно часто назначают электрофорез детям. Что это такое? Это один из безопасных и эффективных методов введения медикаментов при многих недугах. Он прост в исполнении, но требует понимания некоторых физических законов и фармакологического действия применяемых лекарств. Используя электрический ток вводят различные медикаменты, при этом системное воздействие на организм ребенка существенно снижается. В пораженном очаге создается максимальная концентрация активного вещества. Выбор препарата зависит от имеющихся болезней:

Специалист индивидуально подбирает необходимую концентрацию раствора, силу тока, а также длительность проведения манипуляции.

Помогает ли электрофорез детям? Ответ на этот вопрос положительный. Эта методика безопасна, позволяет создать в патологическом очаге высокую концентрацию активного вещества, дает быстрый и стойкий эффект. Кроме того, данная физиотерапевтическая процедура доступна практически во всех учреждениях здравоохранения на бесплатной основе.

Методы электрофореза

Соответствующие показания позволяют применять различные методики электрофореза.

  1. В современной медицинской практике широко применяют электрофорез с примочками магнезии. Показания: заболевания органов дыхания. При этом магнезия способствует улучшению кровообращения в поврежденных тканях, восстанавливает эмоциональное и психическое состояние малыша. К тому же магнезия обезболивает и снимает спазмы.
  2. Показания, при которых назначают электрофорез по Ратнеру, преимущественно следующие: нарушения нормального кровообращения в шейном отделе позвоночного столба и ДЦП.

Комплексное назначение папаверина и эуфиллина помогает улучшить кровообращение в шейном отделе.

Суть манипуляции по Ратнеру следующая: на ребра правой стороны грудной клетки прикрепляют электрод с папаверином (1%), на шею – эуфиллин (0,5%).

  • Глюконат кальция и хлористый кальций широко применяется вместе с витамином С. Показания: гингивит, паралич, мышечная дистрофия.

Противопоказания данных методов общие для проведения электрофореза детям.

Методики, используемые в детском возрасте

Перечисленные выше методики применяют и у детишек. Кроме того, существует несколько способов, которые преимущественного используют у маленьких пациентов:

Ток в ходе проведения электрофореза ребенку добавляется постепенно. При появлении покалывания его перестают подавать. Длительность манипуляции от десяти до пятнадцати минут. Делают ее через день или ежедневно. Курс лечения минимум десять и максимум двадцать процедур.

Какие бывают электроды

Существует большое разнообразие этих изделий:

  1. Самые распространенные – это бумажные одноразовые. Они снабжены гидрофильными прокладками, за счет которых активное действующее вещество медикамента сквозь них проникает в дерму. Такие медицинские изделия чаще всего состоят из двух пластин, но имеются и более сложные варианты. Непосредственно перед манипуляцией их обильно пропитывают физиологическим раствором, водой или лекарством. Преимущество одноразовых электродов – это возможность придать любую форму для удобства наложения на разные участки тела.
  2. Одноразовые полостные электроды для электрофореза предназначены для проведения процедуры внутри полостей. Они стерильны и не требуют никакой дополнительной обработки.
  3. Медицинские изделия многоразового использования — практичны, но требуют стерилизации. Они изготовлены из хлопчатобумажной ткани, обладающей хорошей электропроводностью и устойчивостью к действию агрессивных кислот и щелочей. Материю складывают в несколько слоев, между ними располагают углетканевые электроды, через которые подается ток.
  4. В резиновые пластины вшиваются специальные токопроводящие элементы, благодаря которым они становятся прочными и надежными. Ими комплектуют многие современные аппараты для физиотерапии.
  5. Металлические электроды используют в настоящее время довольно редко. Для их изготовления чаще всего используют медь или свинец.
  6. Можно и самостоятельно сделать гидрофильные прокладки. Для этого берут натуральную ткань, например, хлопок или фланель, складывают в несколько слоев, чтобы толщина была не более десяти миллиметров и смачивают солевым раствором или водой. Электрод размещают на прокладке.

К подбору этих изделий следует подходить ответственно и перед покупкой желательно проконсультироваться со специалистом.

Обзор моделей

Для проведения физиотерапевтического лечения дома надо приобрести устройство для электрофореза. Желательно уточнить у доктора, какого производителя лучше всего покупать аппарат. Первую процедуру выполняют в присутствии медсестры. Кроме того, надо научиться подбирать готовить растворы для проведения манипуляции. На рынке представлен большой выбор приборов для электрофореза. Рассмотрим некоторые из них:

Таким образом, выполняют физиолечение используя разные аппараты. Помните, что решение о необходимости проведения данной манипуляции принимает лечащий доктор вашего ребенка.

«Я не рекомендую «АльфаСтрахование»» — отзыв клиента о «АЛЬФАСТРАХОВАНИЕ» в проекте «Народный top. Рейтинг страховых компаний»

Оксана (гость)

Добрый день!

Поскольку полис добровольного медицинского страхования обеспечивает своему владельцу право пользоваться услугами медицинских учреждений, предусмотренных программой страхования в течение оговоренного срока, а отличительной чертой ДМС является поддержка застрахованного в процессе обслуживания, прошу Вашего разъяснения в связи со сложившейся ситуацией:

Моя дочь застрахована в «АльфаСтрахование», страховой полис 61291547.Страховая программа моей дочери включает амбулаторно-поликлиническое обслуживание, в том числе проведение лечебных манипуляций и процедур, в число которых входит физиотерапия, лечебный массаж, ЛФК.В настоящее время моя дочь проходит лечение под наблюдением врача невропатолога с DS: Нестабильность ШОП.Шейно-мышечный с-м.С-м вертебро-базиллярной недостаточности.Страховым случаем является острое заболевание, либо обострение хронического.Насколько я понимаю,DS моей дочери, очевидно, относится ко второму-обострение хронического заболевания, учитывая, что УЗИ шейных сосудов к тому же выявило, что правая позвоночная артерия в V3 сегменте образуют С-образную извитость с нарушением кровотока, а сосуды глазного дна имеют изменения.Кроме того, в настоящее время у ребёнка присутствует неврологическая симптоматика в виде 2-х стороннего экзофтальма, слабоположительного с-ма Кернига слева, головные боли, постоянные обильные носовые кровотечения, болезненность мышц шейного отдела.Врачом невропатологом, кроме лекарственной терапии по поводу данного заболевания, назначено ЛФК, массаж шейно-воротниковой зоны, электрофорез с эуфиллином на ШОП по Ратнеру.Осмотрена физиотерапевтом-назначено лечение.

В настоящее время застрахованному ребёнку страховая компания «АльфаСтрахование» отказывается обеспечить предоставление услуг в виде электрофореза и, насколько я понимаю, при обращении по поводу ЛФК и массажа, ребёнку также будет отказано.

Основанием для получения медицинской услуги являются медицинские показания и направление врача, которые имеются у нас на руках.На просьбу к региональному представителю «АльфаСтрахования» в г.Хабаровске получить обоснование в отказе также получен отрицательный ответ в крайне негативной форме-«Я не обязана его предоставлять, не положено и всё!»

При обращении на круглосуточный телефон компании никто не дал никакой информации, но посоветовали написать письмо на адрес pult [email protected]Письмо отправлено на указанный адрес, но ответа так и не получено.При обращении в службу контроля качества «АльфаСтрахования» также никто не отреагировал на мою просьбу, заявление, жалобу (выберете то, что больше по душе)

Создаётся впечатление, что и нет никакой компании «АльфаСтрахование»-в ответ на вопросы только хамство, либо полная тишина от людей на том конце провода, как и а письменные обращения на официальном сайте компании.

Качество обслуживания

Администратор:

Оценка не засчитана, т.к. компания дала обоснованный ответ на претензии автора отзыва.

Представитель СК

Уважаемая Оксана!

Все услуги по полису ДМС входящие в Программу ДМС предоставляются только при наступлении страхового случая, по Программе.

Страховым случаем является обращение Застрахованного в медицинское учреждение в связи с развитием в период действия договора страхования следующих состояний:

1. острого заболевания (включая травмы, ожоги, отморожения, отравления и другие состояния, возникшие в результате несчастного случая).

2. обострения хронического заболевания.

3. заболевания или состояния, возникшего как осложнение в результате медицинского вмешательства.

4. острого заболевания или обострения хронического заболевания из числа перечисленных в разделе «Исключения из программы добровольного медицинского страхования» до момента установления диагноза.

Всех представленные медицинские документы были внимательно рассмотрены и в результате страховое событие не выявлено. Соответственно Вам было отказано в соответствии с пунктом Б Программы ДМС.

А именно:

ОАО «АльфаСтрахование» не оплачивает следующие медицинские услуги и расходные материалы, если иное прямо не указано в разделе «Объем предоставляемой медицинской помощи»:

1. услуги, оказанные без медицинских показаний, без назначения врача, по желанию Застрахованного.

2. услуги, оказанные в профилактических, оздоровительных целях (в том числе в стоматологии).

Мы не имеем права публично излагать медицинские подробности, связанные с данной ситуацией, поэтому просим направить согласие на отправку Вам письма на адрес электронной почты [email protected] Для возможности идентификации Вашего обращения укажите, пожалуйста, в теме письма «Отзыв на ASN/ 22241».

Дополнительно заметим, что с данного адреса электронной почты письмо в Хабаровский филиал, а также в Службу контроля качества сервиса не поступало, поэтому ответ и не предоставлялся.

С уважением, Служба контроля качества сервиса ОАО «АльфаСтрахование».

Универсальный метод синтеза искусственных гелевых антител методом импринтинга в сочетании с уникальной техникой электрофореза для обнаружения мельчайших структурных различий белков, вирусов и клеток (бактерий). Ib. Гелевые антитела против белков (гемоглобины)

Related Concepts

Акриламид Rhinohide Liquid Acrylamide Акриловые смолыBos indicusЭлектрофорез GelEryhemZoophaginae

Trending Feeds

широко распространенных вирусов COVID-19 включает в себя более распространенные вирусы COVID-19 заболевания, такие как продолжающаяся вспышка коронавирусной болезни 2019 г. (COVID-19; официально известная как 2019-nCoV).Коронавирусы могут передаваться от животных человеку; симптомы включают жар, кашель, одышку и затрудненное дыхание; в более тяжелых случаях заражение может привести к летальному исходу. Этот канал охватывает недавние исследования COVID-19.

Бластомикоз

Бластомикоз Грибковые инфекции распространяются при вдыхании спор Blastomyces dermatitidis. Ознакомьтесь с последними исследованиями грибковых инфекций бластомикоза здесь.

Комплекс ядерных пор в ALS / FTD

Изменения в ядерно-цитоплазматическом транспорте, контролируемом комплексом ядерных пор, могут быть вовлечены в патомеханизм, лежащий в основе множественных нейродегенеративных заболеваний, включая боковой амиотрофический склероз и лобно-височную деменцию.Вот последние исследования комплекса ядерных пор при ALS и FTD.

Применение молекулярного штрих-кодирования

Концепция молекулярного штрих-кодирования заключается в том, что каждая исходная молекула ДНК или РНК прикрепляется к уникальному штрих-коду последовательности. Считывания последовательностей с разными штрих-кодами представляют разные исходные молекулы, в то время как считывания последовательностей с одинаковым штрих-кодом являются результатом дублирования ПЦР с одной исходной молекулы. Узнайте о последних исследованиях в области молекулярного штрих-кодирования здесь.

Синдром хронической усталости

Синдром хронической усталости — заболевание, характеризующееся необъяснимой инвалидизирующей утомляемостью; патология которого не до конца изучена.Узнайте о последних исследованиях синдрома хронической усталости здесь.

Эволюция плюрипотентности

Плюрипотентность означает способность клетки развиваться в три основных слоя зародышевых клеток эмбриона. Этот канал посвящен механизмам, лежащим в основе эволюции плюрипотентности. Вот последнее исследование.

Вариагация эффекта положения

Вариагация эффекта положения Возникает, когда ген инактивирован из-за его расположения вблизи гетерохроматических областей в хромосоме.Ознакомьтесь с последними исследованиями вариагации эффекта позиции здесь.

Агонисты рецепторов STING

Стимуляторы генов IFN (STING) представляют собой группу трансмембранных белков, которые участвуют в индукции интерферона I типа, важного для врожденного иммунного ответа. Стимуляция STING была активной областью исследований в лечении рака и инфекционных заболеваний. Вот последние исследования агонистов рецепторов STING.

Микробицид

Микробициды — это продукты, которые можно наносить на поверхности слизистой оболочки влагалища или прямой кишки с целью предотвращения или, по крайней мере, значительного снижения передачи инфекций, передаваемых половым путем.Вот последние исследования микробицидов.

Сопутствующие статьи

Биомакромолекулы

Дэниел М. Хокинс Subrayal M Reddy

Аналитик

Карин Зайдлер Франц Л. Дикерт

Биоматериалы

Аналитик

Аналитик

Аналитический журнал

Linden D BolisasPe Биоаналитическая химия

Кевин Флавин, Марина Ресмини

Произошла ошибка при настройке вашего пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г.,
    браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie
потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт
не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к
остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Agar — обзор | ScienceDirect Topics

2.2.6 Агаровые наноносители

Агар — это высушенный гидрофильный коллоидный полисахаридный комплекс, экстрагированный из агароцитов водорослей семейства Rhodophyceae .Агар представляет собой смесь двух компонентов: линейного полисахарида, известного как агароза, и гетерогенной смеси более мелких молекул, называемой агаропектином. Для агарозы можно выделить три структурных крайности: нейтральная агароза; пируватированная агароза с низким содержанием сульфатирования; и сульфатированный галактан (рис. 2.2). Агароза содержит 1,3-связанную d-галактозу и 1,4-связанную 3,6-ангидро-1-галактозу, при этом очень мало гидроксилов сульфатируется. Хотя агаропектин более сложен, чем агароза, он содержит, помимо звеньев d-галактозы и 3,6-ангидрогалактозы, d-глюконовую кислоту, пировиноградную кислоту и гораздо более высокую долю сложноэфирных групп сульфата (Lee et al., 2011).

Агар в качестве фармацевтического наполнителя использовался как эмульгирующий агент, загуститель, стабилизирующий агент; мукоадгезив, основа для неплавящихся нерасщепляющихся суппозиториев, суспендирующий агент, разрыхлитель таблеток, связующее, агент, повышающий вязкость, и способствующий эффекту замедленного высвобождения (Varshosaz et al., 2015).

Для получения НЧ на основе агара использовались различные методы, например: эмульгирование, гелеобразование распылением, мембранное эмульгирование и нанопреципитация (рис.2.3). Было продемонстрировано, что условия производства, например концентрация агара и скорость гомогенизатора, сильно влияют на характеристики агаровых НЧ (Lee et al., 2011).

Сообщений об использовании НЧ агара для доставки лекарств немного (таблица 2.3). Варшосаз и др. сообщили об успешной доставке в легкие бупропиона HCl, включенного в наносферы агара, с использованием хлорида кальция в качестве сшивающего агента в сочетании с агентом, повышающим проницаемость (HPβCD). При надлежащей оптимизации условий производства НЧ (скорость гомогенизации, процент агара и сшивающего агента) для этих НЧ были достигнуты оптимальное высвобождение (более 5 ч) и свойства мукоадгезии (Варшозаз и др., 2015).

Zaki et al. (2015) оценили использование генетического алгоритма, искусственной нейронной сети и методологии поверхности отклика для оптимизации производственного процесса наносфер агара.

Адсорбция белка — обзор

A Молекулярная адгезия

Адсорбция белка — очень важный аспект во многих биомедицинских и биотехнологических приложениях. Например, многие хроматографические разделения, такие как гидрофобная, вытесняющая и ионообменная хроматография, основаны на различиях в аффинности связывания белков с поверхностями.Кроме того, in vitro культурам клеток требуется адгезия на клеточной поверхности, которая опосредуется подслоем адсорбированных белков.

Адсорбция белка является чистым результатом различных сложных взаимодействий между всеми компонентами и внутри них, включая твердую поверхность, белок, растворитель и любые другие присутствующие растворенные вещества. Эти силы взаимодействия включают дипольные и индуцированные дипольные моменты, образование водородных связей и электростатические силы. Все эти межмолекулярные и внутримолекулярные силы способствуют снижению энергии Гиббса при адсорбции.

Важным вопросом, касающимся процесса адсорбции белка, является его обратимость. Один из подходов к этой проблеме — анализ динамики адсорбции. Поскольку адсорбция — это многоступенчатый процесс, возникает важный вопрос: на какой стадии процесс становится необратимым? Наиболее распространенный способ количественной оценки адсорбции — это изотерма адсорбции, где при постоянной температуре количество адсорбированных молекул наносится на график в зависимости от стационарной концентрации тех же молекул в объеме раствора.Изотермы адсорбции представляют собой удобный метод определения обратимости процесса адсорбции. Обратимость обычно наблюдается при адсорбции небольших молекул на твердых телах, но лишь изредка в случае более сложных полимеров с хаотической спиралью.

Белки — это полимеры: однако глобулярные белки не являются истинными случайными клубками. Нативное состояние этих белков в водном растворе строго упорядочено. Большинство полипептидных скелетов практически не имеют свободы вращения. Следовательно, для образования многочисленных контактов с любой поверхностью должны происходить значительные денатурирующие процессы.Структурные перестройки могут происходить таким образом, что внутренняя стабильность глобулярных белков не позволяет им полностью разворачиваться на поверхности в рыхлые структуры, подобные петле и хвосту. Таким образом, количество контактов белок-поверхность, образованных в установившемся состоянии, определяется тонким балансом между межмолекулярными и внутримолекулярными силами. Следовательно, термодинамическое описание процесса адсорбции белка в целом должно основываться на законах необратимой термодинамики (Norde, 1986; Haynes and Norde, 1994).Процесс сильно зависит от времени, и некоторые из вовлеченных стадий молекулярной перестройки являются чрезвычайно медленными и, вероятно, приводят к значительному связыванию белков только в масштабе времени в секунды (Hemerlé et al ., 1999). При различных временных масштабах для различных взаимодействий процесс адсорбции можно разделить на быстрые этапы, которые могут быть обратимыми, и медленные этапы, на которых могут происходить перестройки структуры белка, которые определяются окружающей средой на поверхности.Последние процессы во многих случаях могут стать необратимыми.

Силы адгезии, создаваемые отдельными белками, например, молекулами белка А и тубулина, в пределах времени контакта от миллисекунд до секунд, могут быть измерены с помощью ABM. Белок А и тубулин, оба глобулярные белки, можно рассматривать как примеры различных типов связывания с белками. Молекулы можно прикрепить к наконечнику кантилевера, а затем привести в контакт с различными поверхностями, которые также могут быть покрыты различными молекулярными структурами.Эти поверхности могут быть металлическими, например, из золота, титана и оксида индия (ITO). Такие исследования актуальны для многих биомедицинских приложений, таких как оптический прозрачный ITO, для разработки интерфейсов между биологическими молекулами и электрооптическими устройствами.

Приближаясь к поверхностям из золота, оксида индия и титана покрытыми протеином кончиками и затем втягиваясь, можно измерить силы адгезии между протеинами и этими металлическими поверхностями. В результате для первого контакта существует специфическое взаимодействие, характерное для разных молекул и металлов (Eckert et al ., 1998). Учитывая высокую воспроизводимость одного определенного значения силы адгезии для серии измерений, следует предположить, что в этих экспериментах определенный тип взаимодействия между определенной аминокислотной группой в белке и металлом определяет первый контакт. Точный характер измеренных сил адгезии еще предстоит определить. Тем не менее, можно продемонстрировать, что при адекватной подготовке такой метод можно использовать не только для измерения взаимодействий на уровне одной молекулы, но и для изучения зависимости этих взаимодействий в различных условиях окружающей среды.

Метод двумерного микроразделения белков и пептидов, сочетающий изоэлектрическую фокусировку и гель-градиентный электрофорез.

Journal of Chromatography, 132 (1977) 451-468

C Elsevier Scientific Publishing Company, Амстердам, напечатано в Нидерландах CHROM. 9628 МЕТОД ДВУМЕРНОГО МИКРОРАЗДЕЛЕНИЯ БЕЛКОВ И ПЕПТИДОВ, КОМБИНИРУЮЩИЙ ИЗОЭЛЕКТРИЧЕСКУЮ ФОКУСИРОВКУ И ГЕЛЕГРАДИЕНТНЫЙ ЭЛЕКТРОФОРЕЗ REINHARD ROCHEL Отдел клеточной патологии, Институт патологии A-med Forces, Вашингтон, округ Колумбия.C. 20306 (США)

(получено 11 августа 1976 г.)

РЕЗЮМЕ Двумерная комбинация электрофокусирования геля и электрофореза в градиенте геля дает отдельную информацию о различиях в чистом заряде и молекулярной массе макроионов. Описана микроверсия этой методики. Электрофокусирование первого измерения выполняется в цилиндрическом полиакриламидном геле с размером капилляров с использованием ксилолцианола FF в качестве надежного маркерного красителя для индикации конечной стадии разделения, когда белки достигают своей изоэлектрической точки.Во втором прогоне сфокусированные белки разделяются в непрерывном градиенте геля пластины размером менее штампа с общей концентрацией акриламида в диапазоне от прибл. От 1% до более 40%. Показано, что распространение пиков в градиентном пластинчатом геле связано с приближением белка к пределу пор в геле. Это распределение является полезным индикатором конечного положения белка в геле, если молекулярные массы оцениваются в соответствии с картиной разделения в градиентном геле. Описанный метод был разработан для разделения белков, экстрагированных из отдельных крупных клеток (т.е.е_, нейроны моллюска Aplysia californica).

ВВЕДЕНИЕ Методы двумерного картирования, в которых используются различные типы электрофореза в полиакриламидном геле, считаются наиболее мощными инструментами для разделения макроионов, то есть белков, пептидов и нуклеиновых кислот. Для первого измерения этого метода картирования был использован гель-электрофорез в цилиндрических гелях с постоянной и низкой концентрацией акриламида. Второй эксперимент был проведен на полиакриламидных плитах с постоянной, но более высокой концентрацией акриламида.Кроме того, в обоих измерениях использовались буферные системы с различным pH ». Для достижения разделения, зависящего исключительно от различных свойств заряда. взгляды Министерства армии или Министерства обороны.

452

р. RUCHEL

видов белков, электрофокусировка геля была принята для первого измерения 2.3. Для второго измерения рекомендуется добавление ионного детергента SDS для получения более надежной информации о молекулярных массах разделенных белков ». Изоэлектрическая фокусировка и гель-градиентный электрофорез, который разделяется в первую очередь по молекулярной массе, были впервые объединены в двумерном методе Кенриком и Марголисом. -ионы исследуются.Была сделана попытка уменьшить масштаб этого метода, чтобы белки, извлеченные из отдельных клеток, можно было проследить по их образцам оптической плотности. МАТЕРИАЛЫ Акриламид, N, N’-метилен-бисакриламид (бисакриламид) и N, N, N ‘, N’-тетраметилэтилендиамин (Tented) были получены от Eastman-Kodak (Рочестер, Нью-Йорк, США). ; Персульфат аммония (персульфат), трис (гидроксиметиламинометан) (Трис), бромфеноловый синий, метиловый зеленый и ксилолцианол FF были приобретены у Fisher Scientific (Fair Lawn, N.Y:, U_S .A.); были использованы амфолиты-носители с pH 3,5-10 от LKB (Bromma, Швеция) и амфолиты-носители с pH 2-11 от Serva (Heidelberg, G.F.R.); человеческий сывороточный альбумин был также получен от Serva; пепсин и бычий сывороточный альбумин были от Pentex (Канкаки, ​​Иллинойс, США); Кумасси бриллиантовый синий R, химотрипсиноген A, цитохром c, ферредоксин, ферритин, лактатдегидрогеназа из мышц кролика и из говяжьего сердца (EC 1,11 27), 13-лактоглобулин, гемоглобин, овальбумин, трансферрин, глицин, fl-никотинамид аденин динуклеотид, нитросиний тетразолий, феназинметосульфат и DL-молочная кислота (натриевая соль) были от Sigma (St.Луис, Миссури, США). Стеклянные капилляры (5 p1) — были приобретены у Brand (Wertheim, G.FR.) И Drummond (Broomall, PA, U.SA.) — Одноразовые пипетки для отбора проб (l0pl) (Corning, Corning, N .Y., USA). .) также использовались; их нужно разрезать на кусочки ок. Длиной 3 см, очистить ацетоном. Для денситометрии использовали двухлучевой микроденситометр (Joyce Loeb), Gatesheadon-Tyne, Великобритания). Aplysia californica была приобретена у Pacific Bio-Marine (Венеция, Калифорния, США).). МЕТОДЫ

Изоэлектрическое фокусирование Если не указано иное, полиакриламидные гели с Т 5% и С 5% * были меризованы поли-

в 5-, u] капиллярах. Гелевая смесь была приготовлена ​​из исходных растворов, которые хранились в холодильнике, следующим образом: 20 мкл исходного раствора акрилантид + бисакриламид (T 50%, C 5%), 5 мкл исходного раствора Temed (0,02 мл Temed made до 1 мл с водой), 20 мкл исходного раствора персульфата (2,5 мг / мл), 15 мкл амфолитов носителя 40% (до конечной концентрации в геле 3%) и 140 л воды.В качестве амфолитов-носителей используется либо Ampholine® pH 3,5-10 (LKB), либо Servalyt® T = концентрация сомономера (акриламида и бисакриламида) в% (wlv) C = процент T, который представляет собой бисакриламид.

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

453

pH 2-11 (Serva). Гелевый раствор должен полимеризоваться при комнатной температуре от 15 до 30 минут после смешивания. При необходимости следует внести коррективы, варьируя концентрацию персульфата. Капилляры были погружены в гелевую смесь и заполнены примерно до 50%.четыре пятых их длины за счет капиллярной силы. Для полимеризации геля заполненные капилляры хранят в вертикальном положении в сосуде, дно которого покрыто 60% раствором сахарозы. Во влажной камере гели можно хранить в холодильнике несколько дней. Старые гели демонстрируют значительную потерю амфолитов-носителей в удерживающем растворе. Гели использовали только после 12 часов хранения при комнатной температуре. Такое старение необходимо для уменьшения остатков кислородных радикалов после полимеризации.Образец смешивают с сахарозой или глицерином (до конечной концентрации 15%) и наносят непосредственно поверх геля, не удаляя жидкий супернатант, который остается после полимеризации геля. Супернатант содержит амфолиты-носители, которые смешиваются с образцом, обеспечивая тем самым некоторую буферную способность. Если применяются относительно большие объемы пробы (например, 2 ч. 1 и более), к пробе следует добавить некоторый дополнительный амфолит-носитель до конечной концентрации около 0,1%. Таким образом, уменьшается потеря белка в образце из-за загрязнения концевым электролитом.Маркер-краситель добавляется к образцу в соответствии с выбранной полярностью цикла. Если анод находится в верхнем положении, добавляется метиловый зеленый. Когда катод находится в верхнем положении, к пробе добавляют ксилолцианол или смесь бромфенолового синего и ксилолцианола. Метиловый зеленый цвет теряет свой цвет при приближении к изоэлектрической точке. Скорее, ксилолцианол можно вводить в нижний конец геля, если анод находится в верхнем положении. Встречная миграция обоих маркерных красителей будет происходить без заметного вмешательства между самими красителями или белками образца.Такое взаимодействие между кислотным красителем и основным белком наблюдалось, когда бромфеноловый синий мигрировал в противоположную сторону, что приводило к нестабильному пику преципитации в середине геля. Использование смеси бромфенолового синего и ксилолцианола в качестве анионных маркерных красителей дает дополнительное преимущество. Более быстро мигрирующий бромфеноловый синий меняет свой цвет на желто-коричневый и осаждается при изоэлектрической точке pH 3,2 (ссылка 6). На этом этапе цикла можно повысить напряжение для лучшего разделения пиков белка.Когда ксилоцианол достигает своей изоэлектрической точки в осадке бромфенолового синего, эксперимент может быть остановлен или продолжен в течение нескольких минут, если необходимо преодолеть просеивание больших белков. В качестве обрывающих электролитов использовали 0,5 н. NaOH на катоде и 0,5 эВ h3SO4 на аноде. Схема электрофокусировки показана на рис. 1. Электрофокусировка проводилась при 70 В / см. Когда применялись очень большие объемы образцов, напряженность электрического поля увеличивалась до 100 В / см.Циклы занимают около 20 минут, что достаточно для выполнения следующих этапов процедуры окрашивания. Гели выталкиваются из капилляров с помощью стальной проволоки или под давлением воды из шприца. Проволока разрушит сегмент геля, и поврежденный конец можно использовать для определения полярности. Выталкивание геля под давлением воды редко повреждает гель, если выполняется осторожно, но определение полярности в таких гелях может быть затруднено. После удаления из капилляра гель для электрофокусировки промывают в течение 15 мин при комнатной температуре в 10% трихлоруксусной кислоте (ТХК) (этанол до прим.33% может быть добавлено). Затем гель окрашивают кумасси синим R

454

R. ROCHEI

Рис.1. Снаряжение для микрокэлектрофокусировки. Стеклянный капилляр, содержащий гель (1), снабжен двумя частями гибкой трубки длиной около 8 мм (2) и прикреплен к опоре (3). Максимальный объем наносимой пробы определяется длиной указанного сегмента (4). Образец покрывают завершающим электролитом (5), а нижний конец геля погружают в завершающий электролит противоположного типа (6).Электроды из платиновой проволоки (7) вводятся таким образом, чтобы пузырьки газа, образующиеся при электролизе, не могли засорить систему (примерно 0,1% в 7% уксусной кислоте и 33% этаноле) в течение 5 минут при комнатной температуре. Для удаления 7% уксусной кислоты и прибл. Используется 20% этанол. Окрашенные гели хранятся в 7% уксусной кислоте, содержащей небольшое количество кумасси синего. Запись капиллярных гелей должна быть выполнена как можно скорее с помощью фотографии или денситометрии (например, с помощью микроденситометра Joyce Loebl).Гели с большими порами, которые используются для изоэлектрической фокусировки, имеют тенденцию очень быстро собирать частицы красителя и пыли, которые можно частично удалить, промывая гель в абсолютном метаноле в течение нескольких секунд. Электрофокусирующие гели, которые должны были быть перенесены на электрофорез во втором измерении, не промывают в ТХК и не окрашивают, а сразу же помещают поверх геля для пластин после кратковременного промывания водой. Гели градиента слябов с малым основанием. Гели с градиентом слябов отливают в камерах, состоящих из двух частей предметного стекла.В качестве разделителей используются двойные слои покровных стекол. Камера удерживается вместе за счет давления прищепки. Второе отверстие тканевого прядения используется для удержания смонтированной камеры на стойке (рис. 2). Перед использованием камеру промывают водой, метанолом и, наконец, ацетоном. Перед заполнением камеры 10 в нижний конец камеры можно налить х1 60% раствора сахарозы. Эта капля жидкости с высокой плотностью образует идеально горизонтальную кромку геля при наложении на нее раствора.Для смешивания градиента из четырех исходных растворов готовят два гелевых раствора, три из которых идентичны приведенным выше для электрофокусирующего геля. Смесь гелей для градиентных гелей для небольших пластин (Т макс. 40%, C 5%) выглядит следующим образом: Раствор 2 (сначала всасывается в пипетку): 100 мкл акриламида-17. Исходный раствор бисакриламида (T 50%, C 5%), 10 мкл Исходный раствор в тенте (0,02 мл Tmed, полученный

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

45 5

Рис.2. Малогабаритные градиентные гели отливают в камеру (1), состоящую из двух кусков предметного стекла, которые разделяются друг на друга с помощью прокладок (2). Двухслойные покровные стекла (например, толщина № 2, Fisher Scientific) могут использоваться в качестве разделителей, обеспечивая расстояние прибл. 0,5 мм, что достаточно для нанесения цилиндрического геля первого измерения поверх плиты. Гелевая камера удерживается вместе прищепкой со вторым отверстием (4), с помощью которого камера может быть установлена ​​на стойка (3).Перед заполнением камеры раствором геля в кончике пипетки (6) раствор сахарозы (10) d, 60%) помещается в камеру для герметизации ее нижнего конца (5).

(от

до 1 мл с водой), 10 мкл гелевого буфера (3,3 M Tris-S04, pH 8,4) и 5 ​​мкл раствора бромфенолового синего (0,2% в воде). Раствор I: 100 мкл исходного раствора персульфата Etl (2,5 мг / мл в воде), 100 мкл воды и 10 мкл раствора сахарозы (50% в воде) (можно добавить гелевый буфер). Исходные растворы акриламида, темеда и персульфата идентичны тем, которые указаны для эффективного фокусирования.Градиентные гели с более низкой максимальной концентрацией могут быть получены путем разбавления раствора акриламида. Любой тип буфера может заменить приведенный выше. Раствор акриламида можно отфильтровать перед использованием, чтобы обеспечить более чистый фон гелей для пластин небольшого размера. В прерывистой буферной системе с pH 8,4 в качестве рабочего буфера используется 50 мМ трис-глицина с pH 8,4. Раствор I содержит персульфат и немного сахарозы, а раствор 2 содержит акриламид, бисакриламид, темед, буфер, краситель-маркер и сахарозу.Градиент смешивается с помощью автоматической пипетки (например, Eppendorf). Для заполнения камеры описанных размеров подходит пипетка 100 Ед. Различные пипетки также подходят для заполнения камер других размеров и форм, например цилиндрических трубок. Сначала примерно половина объема пипетки заполняется раствором 2. Затем пипетка перемещается в раствор 1, где палец на верхней кнопке пипетки быстро отпускается. Таким образом, раствор 1 вынужден резко попасть в пипетку. Из-за меньшей плотности раствор I проходит через объем раствора 2 и оседает поверх раствора 2.Из-за скорости всасывания возникают турбулентности, смешивающие оба раствора до такой степени, которая создает градиент плотности, оседающий на наконечнике пипетки. Поэтому пипетку необходимо удерживать в вертикальном положении в течение примерно 10 секунд, пока на отверстии не начнет образовываться капля. Маркер-краситель в растворе 2 позволяет контролировать развитие градиента как в пипетке, так и в камере. Содержимое пипетки медленно выталкивается в верхнюю щель гелевой камеры, как показано на рис. 2. Только последние 5 мл остаются в пипетке, потому что они содержат раствор геля более высокой плотности, который поступает с внутренней поверхности наконечника пипетки.Эта остаточная капля смешивается с водой или раствором персульфата до 100 кл и используется для покрытия градиентного раствора в камере. Камера большего объема

R. RUCHEL

456

должна быть охлаждена перед заполнением, чтобы задержать полимеризацию геля. Заполненную камеру оставляют в горизонтальном положении на штативе при комнатной температуре на 15 мин до начала полимеризации. Это легко узнать по появлению дифрагирующей границы раздела около нижнего конца камеры.Наклон таких гелевых пластин был протестирован путем включения красителя в гелевый раствор 2 и с помощью денситометрии полимеризованного геля (фиг. 3a и b). (n)

(e) °°

1

4

Рис.3. (а) Кривые оптической плотности (0D) распределения бромфенолового синего в пределах длины (L) градиентного геля с пластинкой небольшого размера. Краситель был включен только в раствор акриламида, таким образом представляя градиент концентрации геля. Пластина была просканирована в гелевой камере, чтобы избежать потери красителя из-за диффузии.Параллельное сканирование выполняли в указанном (-) направлении на расстоянии 2 мм от ширины геля пластины, как показано сегментами сканирования с правой стороны. Нерегулярные выбросы, вызванные попаданием сканирующего луча в гелевую камеру, заменены пунктирными соединительными линиями. Ось максимальной концентрации геля наклонена, как показано пунктирной линией (M). (b) Кривые оптической плотности (OD) распределения бромфенолового синего в пределах ширины (W) небольшого слоя градиентного геля. Условия сканирования такие же, как в (a).Параллельные сканирования были выполнены на расстоянии 1 мм в геле, таким образом, увеличивающиеся расстояния сканирования выявляют экспоненциальный характер градиента. Для усиления полимеризации низкоконцентрированного раствора акриламида в верхней части градиента камеру теперь можно перенести примерно на 10 мин в печь с температурой 40 °. Гель можно хранить около двух дней, если его хранить в закрытом сосуде при температуре 4 °. Нижний конец гелевой камеры необходимо погрузить в гелевый буфер. В старых гелях между поверхностью стекла и гелем могут образовываться щели, которые вызывают обход тока.Перед нанесением геля первого измерения поверх геля для плиты гелевая камера должна быть полностью заполнена водным раствором сахарозы (примерно 50%) и небольшим количеством маркерного красителя. Надосадочную жидкость следует слегка перемешать, несколько раз перевернув гелевую камеру. Затем цилиндрический электрофокусирующий гель помещается на верхнюю щель гелевой камеры и проталкивается в камеру тонким инструментом (например, пинцетом, стальной проволокой). После погружения в супернатант гель можно полностью нанести на верхнюю часть гелевой пластины коротким краем фильтровальной бумаги, которая используется в качестве буферного мостика (рис.4). Имея некоторый опыт, перенос геля займет не более 20 секунд. Таким образом, можно избежать серьезных потерь из-за диффузии белка в супернатант. Область с высокой концентрацией сахарозы наверху гелевой пластины обеспечивает область пониженной проводимости, в которой элюирование белков из электрофокусирующего геля происходит очень быстро после приложения напряжения. При 100 В / см время работы во втором измерении составит около 30 мин. На этом этапе маркер бромфенолового синего покинул гель, в то время как цианол ксилола все еще виден в геле в виде острой линии.

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

457

Рис.4. Устройство для электрофореза во втором измерении в пластинчатом градиентном геле. Камера для геля (1) установлена ​​на стойке с помощью прищепки (2), как показано на рис. удерживается на месте крышкой (5) фильтровальной бумаги, которая используется в качестве буферного мостика (6). Электроды из платиновой проволоки (7) погружаются в рабочий буфер (8).Уровень рабочего буфера в стакане не должен превышать уровень верхнего края гелевой камеры. Нижний резервуар-резервуар изготавливается путем просверливания ряда соединенных отверстий в блоке из оргстекла. Инжир . 5. Экструзию очень крутых, цилиндрических градиентных гелей из капилляров можно надежно выполнить с помощью стальной проволоки, закрепленной в держателе (слева), и плоскогубцев, которые были оснащены соответствующими половинами латунной трубки с коническим просветом (в центре). Капилляр очень плотно удерживается плоскогубцами в прорези полуразъемной резиновой пробки (справа).Стопор входит в отверстие плоскогубцев. Поскольку может потребоваться высокое давление, сначала необходимо использовать проволоку длиной 1 см, а затем увеличивать ее длину в процессе.

Если исследуются малые пептиды, на этом этапе анализ можно остановить. Для приближения белков к пределу пор необходимо как минимум в два раза больше времени. Камеру с гелем осторожно разбирают, и гель окрашивают кумасси синим, как упоминалось выше. Гели с крутым цилиндрическим градиентом Вместо пластинчатых гелей в некоторых случаях для эксперимента во втором измерении использовались гели с очень крутым градиентом цилиндрической формы с размером капилляров.Они производятся капиллярной силой, как описано ранее ». Чтобы получить максимальное значение T 60%, необходимо внести некоторые изменения в общую процедуру: используется основной раствор, содержащий акриламид и бисакриламид (T 71%, C 4%) — Требуемое количество бисакриламида (3% масс. / v) не растворяется в воде отдельно, но легко растворяется в присутствии акриламида. Этот исходный раствор кристаллизуется при комнатной температуре, и его необходимо нагреть до более

458

R.ROCHEL

, чем за 40 минут до использования. Все остальные стандартные решения идентичны приведенным выше. Два гелевых раствора для градиентов с Т макс. 60% и C 4% составляют: раствор 1:30, маточный раствор персульфата u1, буфер 10 мкл и 60 мкл воды. Раствор 2: основной раствор акриламид-1-бисакриламида 85 Id, 10 мкл буфера и 5 мкл маточного раствора Темеда. Очищенные капилляры с прочными стеклянными стенками и неповрежденными концами сначала наполовину заполняются гелевым раствором I, а затем полностью заполняются гелевым раствором 2; таким образом создается градиент.После полимеризации геля заполненные капилляры необходимо хранить в течение нескольких дней, наполовину погруженные в гелевый буфер при 4 °. Только после такого старения гель можно без повреждений вытолкнуть из капилляра. Старые гели все еще очень плотно сидят в капиллярах. Следовательно, инструмент для удержания капилляра полезен и предотвращает несчастные случаи (рис. 5). Стальная проволока для выталкивания геля должна быть снабжена держателем и должна использоваться сначала на небольшой длине, чтобы избежать изгиба проволоки и, таким образом, разрушения капилляра и геля (рис.5). Окрашивание таких градиентных гелей занимает намного больше времени из-за ограниченной диффузии красителя в геле с небольшими порами. РЕЗУЛЬТАТЫ

Изоэлектрическая фокусировка Изоэлектрическая фокусировка стала широко используемым аналитическим и препаративным инструментом, и первоначальная методика получила значительное развитие 9. Изоэктрическая фокусировка как техника микрогеля была описана Квентином и Нойхоффом 10, Гейнером и Гроссбахом. Чтобы улучшить результаты, полученные с помощью их методов, были опробованы различные варианты, т.е.е. амфолиты-носители могут заменять Темед в качестве катализатора в гелевых смесях. Поскольку при отсутствии Темеда необходимо использовать значительно большее количество персульфата, увеличивается вероятность окисления белков пробы. По той же причине образцы белков не должны полимеризоваться в гель, который был рекомендован 12. Гели не покрывались водой или раствором амфолита до или после полимеризации, а также образец не покрывался раствором амфолита. Последний предотвращает загрязнение образца конечным электролитом, но также вызывает расширение градиента pH в верхний резервуар с электролитом.Это может объяснить проблемы с выбором полярности, о которых было сообщено «0,11». Предварительные электрофоретические прогоны, предназначенные для очистки гелей от ионных примесей, не улучшили разделение. Покрытие капилляров либо Column Coat (Dow Chem., Midland, Mich., U.S.A.), Либо метилцеллюлозой, как рекомендовано в другом месте »13, не улучшило результатов, указывая на то, что электроэндосмос не препятствовал разделению Было заявлено, что добавление сахарозы, глицерина или этиленгликоля к гелевой смеси улучшает разделение белков (особенно липопротеинов) при изоэлектрическом фокусировании 14-6.Включение 10% сахарозы, глицерина или этиленгликоля не улучшило разделение исследуемых белков. Как часто утверждается, следует избегать загрязнения образца концевым электролитом, так как такой контакт может изменить белки. Поскольку электрофокусировку на начальной стадии можно сравнить с электрофорезом, загрязнение образца ионами конечного электролита с высокой подвижностью повысит проводимость и, следовательно, помешает образованию определенной начальной зоны и приведет к потере белка.Когда нельзя было нанести большие объемы образца, я попытался удалить ограничивающий электролит на верхнем конце капилляра, погрузив электрод непосредственно в образец, который был изготовлен. до 0,2% с амфолитами. Это вызвало некоторый сдвиг градиента pH к верхнему электроду, но изменения картины разделения не наблюдалось, что согласуется с выводами других авторов ». .Таким образом, можно избежать проблемы загрязнения образца и связанной с ним потери белка. Ксилолцианол ранее использовался в электрофорезе с додецилсульфатом натрия (SDS) в качестве второго анионного маркерного красителя в дополнение к бромфеноловому синему »; он фокусируется почти в том же месте градиента pH, что и бромфеноловый синий. В то время как ксилолцианол мигрирует все больше. медленнее, чем бромфеноловый синий, фокусировка его пика гораздо лучше указывает на момент, когда невидимые белки фокусируются в геле.Даже с хромопротеинами, такими как цитохром с, ферритин или гемоглобин, необходимо подождать дополнительное время после фокусировки таких маркеров, прежде чем фокусировка всех белков будет завершена ». Это становится критически важным, если условия работы меняются чаще или если приложенное напряжение повышается в конце цикла, чтобы получить дополнительную резкость сфокусированных пиков. Ксилолцианол и белки всегда фокусировались одновременно, при условии, что не было значительного просеивания белка в геле.Молекулярное просеивание макроионов является особенностью поддерживающей матрицы полиакриламидного геля, которая может мешать изоэлектрической фокусировке, как утверждали различные авторы M, 9 Электрофокусирование конского ферритина и его димера в гелях T 5%, C 5% обеспечивает пример такой несовместимости, когда размер молекулы одного вида (димера) слишком велик для размера пор геля. В таких условиях следует наблюдать образование хвостов и осаждение белка в неправильных местах геля.Чтобы уменьшить просеивание, необходимо снизить концентрацию Т или С. Когда необходимо сфокусировать только пептиды, концентрацию геля можно повысить до Т 7% или более. При условии, что нет мешающего просеивания, такой гель с меньшим размером пор уменьшает диффузию и, таким образом, увеличивает разделяющую способность метода. С теоретической точки зрения полярность в системе электрофокусировки не должна влиять на разделение белков, но предпочтение той или иной позиции было выражено без дополнительных объяснений 1 ° «Выбор полярности должен рассматриваться в зависимости от заряда. свойства белков, которые должны быть разделены, поскольку имеет место более или менее выраженный сдвиг градиента pH в капилляре в ту или иную сторону, в зависимости от выбранной полярности.Размещение анода вверху улучшит развитие градиента pH на его основной стороне в нижнем конце геля и наоборот. Таким образом, фокусировка очень основных белков должна выполняться с анодом в верхнем положении, в то время как фокусировка очень кислых белков будет улучшена с катодом вверху (рис. 6). Зависимость фокусирующих свойств от полярности связана с тем фактом, что белки фокусируются лучше при нанесении на дальний конец геля, обеспечивая максимальную подвижность белка в начале цикла20.Сдвиг градиента pH может быть связан с соотношением объемов обоих завершающих электролитов, с потерей амфолитов в удерживающий раствор во время хранения геля, и это может быть связано с распространением градиента pH на сегмент образца в вверху, если используются большие объемы пробы. Зависимый от полярности сдвиг градиента pH, по-видимому, не идентичен «катодному сдвигу» или «явлению плато», которые были описаны различными авторами и которые происходили при продолжительном времени работы и при более низких концентрациях амфолита независимо от выбранного полярность, «.Основной проблемой изоэлектрического фокусирования является вмешательство литов-носителей ampho-

460

R .RUCHEL

в процедуру окрашивания белков. Удаление амфолитов перед окрашиванием проводится в присутствии TCA. Давно известно, что TCA может сделать некоторые белки растворимыми в спирте » — z. Это может быть причиной потери белка в процессе окрашивания, которую еще полностью не преодолели. Для небольшого геля с относительно большой поверхностью и, следовательно, хорошими диффузионными свойствами, обработка TCA не должна выполняться при повышенных температурах, что было рекомендованоa? а, поскольку время такого лечения имеет решающее значение для потери белка.TCA

Рис. 6. Изоэлектрическое фокусирование стандартных белков в геле с большими порами (T 5%, C 5%) с размером капилляров после окрашивания кумасси синим. Испытания проводили при 150 В в присутствии 3% амфолитов-носителей. (pH 2-I1). 1 = цитохром с; 2 = химотрипсиноген А; 3 = гемоглобин; 4 = трансферрин; 5 = (3-лактоглобулин; 6 = овальбумин; 7 = ферредоксин; 8 = пепсин. Градиент pH смещен в зависимости от полярности, что позволяет разделить основные белки, предпочтительно, когда образец нанесен на анод (слева), и разделение кислых белков, если образец был нанесен на катод (справа).Для сравнения, гели были отрегулированы по положению гемоглобина, что указывает на нейтральный диапазон градиента pH. Сдвиг градиента pH очевиден на ранних стадиях процесса электрофокусировки и усиливается, если применяются большие объемы образца, вызывая расширение и, таким образом, смещение градиента pH к максимуму. Рис. 7. (a) Двумерный электрофорез сывороточного альбумина человека (HSA) после окрашивания кумасси синим. После изоэлектрического фокусирования HSA элюировали в непрерывный градиентный гель пластинки (T макс.40%, C 5%) с помощью прерывистой буферной системы с pH 8 .4. Структура олигомеров HSA показывает вертикальную линию дисков, типичную для изомерных частиц размера, которые сфокусировались в одном и том же месте в первом измерении. (b) Двумерный электрофорез бычьего сывороточного альбумина (BSA) после окрашивания кумасси синим — после изоэлектрического фокусирования альбумин элюировали в непрерывный пластинчатый градиентный гель (T макс. 30%, C 5%) с помощью прерывистого буфера. система pH 8_4. На схеме показан не только вертикальный ряд олигомеров БСА, но также изомеры мономера и димера БСА.Разница в изоэлектрических точках составляет около 0,3 единицы pH. Очевидное растекание протеиновых дисков указывает на приближение к их пределу пор в геле.

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

461

Концентрация не должна превышать 10%, так как это сильно увеличивает потерю белка. Окрашивание и обесцвечивание также следует проводить при комнатной температуре, поскольку присутствующий спирт может солюбилизировать преобразованный белок. Удаление амфолитов-носителей перед испытанием во втором измерении было испытано с использованием 10% TCA при комнатной температуре с последующим удалением TCA диэтиловым эфиром «или ацетоном» «-«.Обработка этиловым спиртом TCA, как описано, но продолжительностью более 12 часов, сделала большую часть водорастворимого белка клетки (нейрон Aplysia californica R) нерастворимой в воде, что препятствовало второму измерению без использования детергента. Таким образом, количество амфолитов-носителей, содержащихся в электрофокусирующем геле, было учтено в градиентном электрофорезе во втором измерении, даже несмотря на то, что это вызвало некоторое влияние на окрашивание пластинчатого геля, как было показано в другом месте 25 —

Градиент пластины гели Гели с градиентным слоем небольшого размера могут быть получены при любом значении T максимум до примерно 40%.При более высоких концентрациях гелевая камера может лопнуть из-за набухания геля и, таким образом, втягивать пузырьки воздуха между стеклянной стенкой и гелем. Экспериментальные возможности, предлагаемые этими гелями, в основном такие же, как и описанные для цилиндрических градиентных гелей в капиллярах ‘- «,’. Если необходимо идентифицировать разделенные белки

Рис. 8. Сканирующее электронное микроскопическое изображение (СЭМ) площади поверхности непрерывного градиента слоя получают, который содержит α-макроглобулин овечьей сыворотки, после проведения электрофореза в прерывистой буферной системе с pH 8-4.Макроскопическое изображение очень резкого белкового диска, который приближается к пределу поры, подтверждается изображением, полученным с помощью SEM. СЭМ-изображение показывает определенный край между гелевой матрицей, которая полностью забита белком, и областью, которая показывает некоторое количество белка только на гелевых мембранах (->). Гель был приготовлен для SEM путем сублимационной сушки и ротационного покрытия, как описано ранее »_

OD

,

f

Рис. 9. (a) Сканирование оптической плотности (OD) электрофокусированной лактодегидрогеназы (LDH) из мышца кролика (Sigma Type 2 (2)] с субъединицами M a и из говяжьего сердца [Sigma Type 3 (3)) с образцами субъединиц H, (слева), H, M (в центре) и H 2 M 2 (справа) .Ферменты были обнаружены тетразолиевой системой (см., Например, ссылку 12). (b) Картина оптической плотности (OD) электрофокусированных молочнокислых дегидрогеназ (2,3) и белков-маркеров с известными изоэлектрическими точками: овальбумин (0), pl = 4,6; f1-лактоглобулин (L), pt = 5,2; трансфетрин (Т), pf = 5,8; гемоглобин (H), pf = 7,0; химотрипсиноген A (Ch), pI = 8,9; цитохром c (Cy), pl = 10,0. Ферменты были локализованы с помощью тетразолиевого эссе до окрашивания кумасси синим. (c) График изоэлектрических точек белков, разделенных, как показано на (b), в зависимости от расстояния их линейной миграции (M).Согласно повторным экспериментам, изоэлектрические точки LOH типа 2 были определены на уровне 8,1, в то время как разновидности LOH типа 3 имеют изоэлектрические точки 4,9, 5,5 и 5,8, соответственно. (d) Двумерный электрофорез «мертвого хода» ЛДГ типов 2 (слева) и 3 (справа). Ферменты были обнаружены в исследовании тетразолия. В первом измерении ферменты были разделены в соответствии с их зарядовыми свойствами, как показано на (а). Второе измерение было выполнено в геле с непрерывным градиентом (T макс.40%, С 5%). Во всей системе использовали трис-боратный буфер (pH 9_5). Буфер имел максимальную концентрацию 160 мМ Трис и был распределен в геле в непрерывном градиенте концентрации, а также в акриламиде. Градиент буфера обеспечивается удалением буфера из раствора персульфата (см. Методы). Этот буферный градиент обеспечивает низкую проводимость в верхней части геля и в супернатанте, что позволяет быстро вывести белок из геля первого измерения в гель-пластину.Показанная здесь конечная стадия электрофореза была достигнута только после 10-часового цикла при 100 В / см геля. На более ранних этапах цикла основной LOB типа 2 в виде размытого пятна следует за благоприятно мигрирующим кислым LOB-типом. 3. На конечной стадии все белки вплотную приблизились к пределу пор в геле и образуют в геле почти горизонтальную линию. Такое поведение миграции типично для зарядовых изомеров белков в геле с крутым градиентом. Поскольку разница между pf базового LDH Type 2.(8 .1) и pH разделения в градиенте геля (9,5) меньше, чем разница между pf разделенных частиц LOU, этот эксперимент показывает мощность электрофореза ограничения пор (мертвого пробега), который используется для определения заряда изомерные белки.

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

463

без окрашивания всего геля, пилотная полоска может быть вырезана с края пластины для окрашивания и, таким образом, локализации белков. Гели градиента плиты имеют тенденцию набухать в клиновидную форму при удалении из камеры 2 7.Таким образом, их нужно фотографировать под прикрытием предметного стекла. Неожиданная особенность, продемонстрированная на рис. 7 — сильное растекание белков по ширине t » гета, когда они прижимаются к пределу пор в геле с градиентом пластинки. Этот эффект, хотя и в меньшей степени, наблюдали Марголис и Ригли. Распространение идет в обе стороны; таким образом, это не может быть следствием задержки белка в процессе электрофокусировки и не может быть вызвано диффузией, параллельной направлению миграции.30 Артефактная потеря белка в супернатанте

(a)

(+) -F—

Рис. 10. (a) Двумерный электрофорез водорастворимых белков, окрашенных кумасси синим, которые были экстрагированы из Клетки мешка и оболочка мешка брюшного ганглия Aplvsia californica посредством прохождения этиленгликоля и осмотического шока «. После изоэлектрического фокусирования в указанном направлении белки элюировали в гель с непрерывным градиентом пластин (T макс. 30%, C 5%) с помощью прерывистой буферной системы с pH 8.4. Эксперимент останавливали, когда бромфеноловый синий достигал нижнего края геля. Показанная здесь область пластинчатого геля покрывает диапазон pH 4-5 и демонстрирует разнообразие белков с низкой молекулярной массой, которые содержатся в таких нейросекреторных клетках. Используя радиоактивно меченый белок и авторадиографию геля, чувствительность такого разделения может быть дополнительно увеличена. (b) Двумерный электрофорез водорастворимых белков, окрашенных кумасси синим, которые были экстрагированы из гигантского нейрона R2 брюшного ганглия Aplysia californica посредством пассажа этиленгликоля и осмотического шока.Эта обработка особенно активизирует более мелкие пептиды, в то время как большие белки остаются в клеточном каркасе ». Условия работы идентичны условиям (а). Область пластинчатого геля, показанная здесь, покрывает немного более щелочной диапазон pH, чем на рисунке (а). Различия в обоих образцах очевидны, если сопоставить пептидные диски в нижнем левом углу для сравнения. Оставшиеся амфолиты-носители окрашиваются в правом нижнем углу. Их можно удалить либо промыванием геля в TCA перед окрашиванием, либо увеличив время работы.Обе эти возможности подвергают опасности небольшие пептиды, которые могут либо проходить через гель, либо вымываться из геля перед окрашиванием. Остаточные амфолиты-носители также вызывают большинство мелких зернистых осадков красителя на поверхности геля.

464

R RUCHEL

во время переноса геля на верхнюю часть плиты может способствовать эффекту, но не является единственной причиной. Расплывание может происходить из-за увеличения сопротивления и уменьшения проводимости в областях геля, которые сильно загружены белком в очень ограниченных условиях миграции.Таким образом, распределение тока в поперечном сечении такого градиентного геля может показывать минимум в области высокой концентрации белка, а частицы, движущиеся на заднем конце пика, будут стремиться обойти препятствие с обеих сторон в соответствии с плотностью тока. . Эти частицы попадают в одну и ту же область сужающих пор и, таким образом, образуют такие широкие фронты, как те, что показаны на рис. 7. Концентрация белка на таком диске больше не имеет колоколообразной (гауссовой) кривой распределения, а резко возрастает в передней части диска (от почти нуля) до максимального значения, в то время как задний конец диска заканчивается в хвост .Такое распределение было продемонстрировано с помощью сканирующей электронной микроскопии (SEM) в градиентных гелях (рис. 8) 31. Распределение пиков белков в геле градиента пластинки можно сравнить с результатами двумерных иммуноэлектрофорезных прогонов, в которых замедление мигрирующих антигенных частиц вызвано не сужением пор, а иммобилизацией, вызванной реакцией с антителом (см. например, ссылка 32).

Двумерный электрофорез Существуют два эксперимента, которые определяют структуру, в которой результаты могут быть получены с помощью описанной двумерной техники: один включает разделение частиц, которые имеют одинаковый размер, но разные заряды, а другой — разделение частиц. разделение частиц, одинаковых по заряду, но разных по размеру.Макроионы разного размера, но с одинаковым суммарным зарядом представлены набором олигомеров одного и того же белка. При электрофокусировке в первом измерении они будут располагаться в одном пике, а во втором измерении в градиенте пластины они будут образовывать вертикальную линию пятен (рис. 7). Макроионы почти одинакового размера, но с разным зарядом обеспечиваются изоферментами лактатдегидрогеназы (рис. 9). Эти белки оседают в разных местах в ходе электрофокусировки в первом измерении и будут мигрировать почти горизонтально по мере приближения к пределу поры в градиентном геле второго измерения.Этот подход является асимптотической функцией времени 2e; таким образом, остаточное расстояние всегда будет оставаться при конечных временах электрофореза, при условии, что белки не осаждаются в очень ограниченных условиях миграции в узких порах геля. Такой результат не будет идеальным, но будет полезен для практических целей, если будут соблюдены некоторые меры предосторожности »25. Точечные рисунки типа« отпечатков пальцев »можно получить не с помощью описанной здесь техники, а с помощью дисковых рисунков белков, которые являются типичными для различных экстрактов, которые должны быть получены, например, из большого одиночного нейрона (рис.10) 25 или белков сыворотки крови (рис. 11). Для достижения более высокой чувствительности цилиндрический гель первого измерения можно разрезать, и белки из этих срезов можно элюировать индивидуально в цилиндрические градиенты геля (рис. 12). Чтобы облегчить определение местоположения основных пиков белка в электрофокусирующем геле, гель можно погрузить в 10% TCA, что сделает белки белыми. Перед циклом элюирования TCA можно вымыть из геля диэтиловым эфиром или ацетоном », ‘- Чтобы получить надежное разделение в зависимости от размера небольших пептидов, которые содержатся в схеме цикла электрофокусировки, градиенты цилиндрических пор с максимальной концентрацией T 60% были использованы во втором измерении.Производство и обращение с такими гелями с крутым градиентом было описано выше_

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

— ‘—

465

5 мм

Рис. 11. Двумерный электрофорез белков сыворотки крови крыс после окрашивания кумасси синим. В первом измерении электрофокусировка производилась в указанном направлении. Участок цилиндрического электрофокусирующего геля, покрывающий ок. pH 3-8, вырезали и наносили поверх геля с непрерывным градиентом (T макс.40%, C 5%). Прерывистую буферную систему с pH 8,4 использовали при 100 мкл / см геля в течение 30 мин (см. Методы). Испытание было остановлено, когда бромфеноловый синий только что прошел через гель, а цианол ксилола все еще не доходил до края геля примерно на одну пятую длины геля. На рисунке показаны два изомерных альбумина с зарядом, которые распространились по всей ширине геля. . Такое распространение частично происходит из-за вымывания белка в супернатант во время переноса цилиндрического геля поверх геля пластины.Распространение также указывает на приближение белка к пределу пор в градиентном геле. Можно увидеть указанную серию белковых пятен, которая простирается от кислотного диапазона до нейтрального диапазона и образует слегка изогнутую кривую. В зависимости от их кажущейся молекулярной массы (> 100000) и зарядовых свойств эти белки могут быть иммуноглобулинами типов A и G. При продолжительном времени работы эти белки образуют почти горизонтальную линию в геле, которая указывает их близкую молекулярную массу.Однако в таких условиях пептиды, такие как те, что перед альбумином (- *), проходят через гель. Для сравнения добавлено изображение геля в исходном размере.

a

O)

Рис. 12. Селективный двумерный электрофорез белков нейронов Ap / ysia californica после их окрашивания кумасси синим. Белки, экстрагированные из клеток мешка и оболочки брюшного ганглия (сравните фиг.10а), подвергали электрофокусированию, и пик, идентифицированный по его белому внешнему виду в 10% TCA, вырезали из области pH 5-5.Сегмент геля промывали в течение 2 минут водой перед элюированием белка в крутой цилиндрический градиент геля (T макс. 60%, C 4%). Использовалась прерывистая буферная система с pH 8,4. Эксперимент проводился при 120 В (см геля до тех пор, пока бромфеноловый синий не достигал нижней пятой части геля, а ксилолцианол мигрировал только на две трети длины геля. После окрашивания можно идентифицировать два пика (0), которые соответствуют Образец всех водорастворимых белков одного и того же образца запускается в сравнимых условиях (средний гель).Поскольку к гетерогенному образцу был добавлен димер инсулина, возможна оценка диапазона молекулярной массы. Положение только димера инсулина (t,) показано в правом геле. Такой селективный, двумерный метод, хотя и более сложный, также более чувствителен к слабым пикам белка, поскольку растекание пиков не нарушает рисунок, как в гелях пластин.

466

R RUCHEL

ОБСУЖДЕНИЕ Поведение белка в электрическом поле зависит от его электрофоретической подвижности ».Два основных параметра подвижности — заряд и размер частицы — можно исследовать отдельно с помощью методов двумерной электрофоретики. Следовательно, изоэлектрическая фокусировка как метод разделения, который строго зависит от заряда, в основном выполняется в первом измерении ‘•’ • 5 34- «. Другие электрофоретические вариации первого измерения включают катионный электрофорез в кислотных буферах4 • 4 ‘-2 и SDS-электрофорез 43 5. Во втором измерении часто используется электрофорез в просеивающем полиакриламидном геле с постоянным размером пор для достижения разделения из-за разницы в размерах 1-4,34,40,42,43.Без использования детергента целостность белка практически не нарушается, и различия в заряде по-прежнему вносят вклад в электрофоретическую подвижность мигрирующих белков. Когда основная масса белка элюируется из геля для изоэлектрической фокусировки, он всегда будет мигрировать диагональной решеткой в ​​пластинчатом геле с постоянным размером пор 3. Этот образец иллюстрирует постоянное влияние заряда на подвижность белка даже во втором измерении. Разделение белковых пятен внутри такого паттерна «млечный путь» происходит только из-за различий в размере и форме, если положения сравниваются на линиях, параллельных оси миграции.Диагональные картины также типичны для двумерных комбинаций электрофореза при кислом pH и в буферах, содержащих SDS4 .40 ‘», 44_. Это может быть связано с тем, что разделение при кислом текущем pH преимущественно зависит от молекулярной массы 47. Таким образом, комбинация электрофокусирования и электрофорез в кислотном буфере дал хорошее разделение ». Распознавая один и тот же параметр, SDS-электрофорез в обоих измерениях дает ярко выраженный диагональный узор S 43 и, таким образом, дает лишь ограниченную информацию.В присутствии SDS влияние заряда широко 4s, поэтому предполагается, что происходит миграция белков в соответствии с молекулярной массой. В сочетании с электрофокусированием метод SDS дает прекрасные результаты 3 ‘, 39; однако необходимо учитывать некоторые несоответствия метода SDS: аномальная миграция была зарегистрирована для гликопротеинов, а также для очень основных и очень кислых. Поскольку белки и для пептидов с молекулярной массой менее 15000 51,1z обработка SDS и дисульфидная обработка большинства белков или белковых субъединиц, присутствующих после восстановления, имеют промежуточный размер, были использованы плоские гели с постоянным размером пор и концентрацией акриламида 10-15. в прогоне второго измерения 35 • 37,39 _ Для улучшения разделительной способности прогона второго измерения использовались градиентные гели плиты даже в присутствии SDS 17.Использование таких гелей было введено в двумерный электрофорез Кенриком и Марголисом для получения разделения по размеру без присутствия детергентов. Комбинация электрофокусирования и градиентного гель-электрофореза в буферных системах без детергентов успешно использовалась для разделения иммуноглобулинов и других белков сыворотки 38 _. В градиентных гелях белки будут приближаться к своему пределу пор только в зависимости от асимптотической функции времени »-». При конечном времени работы можно получить разумные результаты, если градиентные гели достаточно крутые2.53. Разница между pH разделения и изоэлектрической точкой самого основного белка (в основных буферных системах) или самого кислого белка (в кислотных буферных системах) должна быть больше, чем разница pH изоэлектрических точек всех белков, участвующих в эксперименте. . В гелях с пластинчатым градиентом результаты затруднены из-за растекания пиков белка, когда они приближаются к пределу пор »(см. Фиг. 8-11). Когда оценки молекулярных масс должны быть получены из разделенных паттернов

ДВУМЕРНЫЙ МИКРОЭЛЕКТРОФОРЕЗ БЕЛКОВ

467

, растекание может служить для определения предела пор.Leabaek 47 сообщил об отсутствии разделения, которое зависит от молекулярной массы иммуноглобулинов в пластинчатых градиентных гелях при основном текущем pH. Такие белки кажутся размытыми и образуют диски только в кислой буферной системе, когда они достигают предела пор (см. Рис. 11). Микроверсия метода электрофокусирующего градиента геля, описанная здесь, была разработана для разделения пептидов и белков, которые были последовательно экстрагированы из крупных одиночных нейронов или кластеров клеток брюшного ганглия морского слизняка Aplysia californica.Следовательно, изоэлектрическая фокусировка в полиакриламидных капиллярах, как сообщают другие авторы 10-11, была улучшена. Анионный маркер-краситель ксилолцианол FF использовался вместо или в дополнение к бромфеноловому синему для определения конца цикла фокусировки. Ксилолцианол фокусируется в то же время, что и белки, при условии, что белки не просеиваются в геле. Таким образом, можно легко определить критически важное минимальное время фокусировки и избежать проблем (таких как явление плато )b 8.9 .21. Белковые экстракты идентифицированных нейронов обнаруживают специфические различия на пептидном уровне. Они также содержат большие белки с молекулярной массой до 10 с6. Использование геля с постоянным парным размером во втором измерении ограничило бы исследование довольно узким диапазоном молекулярных масс, так как слишком большие белки исключаются из исследования. гель и пептиды, которые слишком малы для просеивания, мигрируют без разделения с фронтом буфера в используемой прерывистой системе.Гели с крутым градиентом, напротив, позволяют разделять белковые смеси, охватывающие несколько порядков величины молекулярных масс за один цикл »26. Поскольку весь белок одного экстракта в большинстве исследованных нейронов должен быть израсходован за один цикл в двумерной системе, градиентный гель является предпочтительным носителем для второго измерения в буфере, не содержащем детергента.

БЛАГОДАРНОСТИ Я в долгу перед доктором. H. Гейнер, Бетезда, Мэриленд, США, США и У. Дамы и Дж.Биспинку, Геттинген, Г.Ф.Р., за полезные обсуждения; последний предоставил мне образец амфолитов Serva. Препарат нейронов Aplysia califorvlica был выполнен доктором. Y. П . Ло, Бетесда, Мэриленд, США. Помощь доктора Г. F. Бахр, Вашингтон, округ Колумбия, США, за редактирование рукописи выражает признательность. R .R. поддерживается товариществом Max-Planck Gesellschaft, G .F .R.

СПИСОК ЛИТЕРАТУРЫ E. Kaltschmidt и H.G. Виттманн, Anal. Биохимия, 36 (1970) 401.ГРАММ . Дейл и А.Л. ratner, Clin_ Chin: _ Acia. 24 (1969) 61. V. Macko и H. Stegemann, Z_ Physiol. Жев., 350 (1969) 917. Т. Халтин и А. Sj6gvist, Анал. Biochem_, 46 (1972) 342. К. ГРАММ . Кенрик и Дж. Марголис, Анал. Biochem., 33 (1970) 204. P.G. Ригетти и Дж. W. Драйсдейл, Энн. N.Y. Acad. Sci_, 209 (1973) 163. Р. Ручель, С. Мезеке, Д. 1_ Вольфрам и В. Neuhoff, Hoppe-Seder’s Z. Phvsial. Chem., 354 (1973) 1351. ТАК . Вестерберг, Sci. Инструменты, 20 (1973) 22. 9 п.ГРАММ . Ригетти и Дж. W. Драйсдейл, J. Chronzatogr., 98 (1974) 271. 10 C.D. Квентин и В. Нойхофф, Int. J. Neurosci_, 4 (1972) 17 1 2 3 4 5 6 7

468.

Р. РУЧЕЛ

11 Н. Gainer, Anal_ Biochem-, 51 (1973) 64612 U. Grossbach, Biochem. Биофиз. Res. Commun., 49 (1972) 667. 13 P. Lundahl, S.Hjerten, Ann. N.Y Acad. Sci., 209 (1973) 94. 14 G. Kostner, W. Albert and A. Holasek, Hoppe-Seylers Z. PhysioL Chem., 350 (1969) 1347. 15 P. Doerr, A. Chrambach, Anal.Биохимия, 42 (1971) 96. 16 гл. Риттнер и Б. Риттнер, З. Мин. Chem. Мин. Биохимия, 9 (1972) 503. 17 J.S. Фосетт, в H. Peeters (редактор), Protides of the Biological Fluids, Vol. 16, Пергамон, Нью-Йорк, 1969, стр. 409. 18 О. Вестерберг, в J. P. Arbuthnott and J. А. Били (редакторы), Isoeleciric Focusing, Butterworths, London, 1975, p. 78. 19 Т. Маниатис, А. Джеффри и Х. ван де Санде, Биохимия, 14 (1975) 3787. 20 D. Граэслин, А. Рмутвайн и Г. Беттендорф, J. Chroinatogr., 63 (1971) 475.21 Л. Э. М. Майлз, Дж. Э. Симмонс и А. Храмбах, Анал. Biochem., 49 (1972) 109. 22 S. E. Michael, Biochem. J., 82 (1962) 212. 23 Дж. Содерхольм. П. Аллестам и Т. Вадстром, FEBS Letters, 24 (1972) 89. 24 1 V. Maizel, in K. Мараморош и Х. Копровски (редакторы), Методы в вирусологии, т. 5, Academic Press, Нью-Йорк, 1971, стр. 179. 25 R. Rachel, J. Hisrochem. Cytochem., 24 (1976) 773. 26 Р: Рэйчел, С. Мезеке, Д. Л. Воффрум и В. Нойхоф Хоппе-Зейлер, Z PizysioL Chem., 355 (1974) 997.27 Х. Фуасси, J. Chrontatogr., 106 (1975) 51. 28 Дж. Марголис и К. В. Ригли, J. Chromatogr., 106 (1975) 204. 29 D. Родбард, Г. Кападиа, А. Храмбах, Anal. Биохимия, 40 (1971) 135. 30 Г. Х. Вайс и Д. Родбард, Сепар. Sct, 7 (1972) 217. 31 р. Рэйчел и М. D. Брагер, Анал. Bioc / rem., 68 (1975) 415. 32 C. A. Converse and D. С. Папермастер, Science, 189 (1975) 469. 33 Т. В. Ни, J. Chromarogr., 105 (1975) 251. 34 W. Domschke, W. Sayde и G. Ф. Домагк, З. К / ин. Chem. Ким. Biochem., 8 (1970) 319. 35 С. W. Wrigley и K. W. Shepherd, Ann. N.Y. Acad. Sci-, 209 (1973) 154. 36 A: Дж. Мак Гилливрей и Д. Риквуд, Ухо. J. Biochem., 41 (1974) 181. 37 П. Х. О’Фаррелл, J. Blot Chem., 250 (1975) 4007. 38 A. В. Эмес, А. Л. Лэзер и Дж. А. Мартина, с / в. Чим. Acta, 64 (1975) 69. 39 G. Ф. Эймс и К. Никайдо, Биохимия, 15 (1976) 616. 40 М. 0. Дж. Олсон, Э.Г. Эзраилсон, К. Гетцов и Х. Буш, J. MoL Biol., 97 (1975) 611. 41 К. В. Тейлор, Л. С. Йомен и Х. Буш, у Д.М. Прескотт (редактор), Методы клеточной биологии, Том 9, Academic Press, Нью-Йорк, 1975, стр. 349. 42 Р. А. Боссельман и М. С. Кауленас, Anal. Biochem., 70 (1976) 28143 K. Wang and F.M. Richards, J. BioL Chem., 249 (1974) 8005. 44 млн. J. Conrad и J. T. Penniston, J. Viol. Chem., 251 (1976) 253. 45 В. Ансейстеттер и Х. Дж. Хорстманн, Ear. J. Biochem., 56 (1975) 259. 46 Y. П. Ло и Х. Гейнер, Brain Res., 92 (1975) 181. 47 D. H. Leaback, в J. P. Arbuthnott and J. A. Били (редакторы), Изоэлектрическая фокусировка, Баттервортс, Лондон, 1975, стр.201 48 А. Л. Шапиро, Э. Винуэла и Дж. V. Кукуруза], Биохимия-Биофиз. Res. Commun., 28 (1967) 815. 49 К. Вебер и М. Осборн, J. Biol. Chem., 244 (1969) 440650 A.K. Dunker and R. Р . Rueckert, J. Biol. Chem., 244 (1969) 5074. 51 Дж. Дж. Уильямс и У. Б. Гратцер, J. Chromatogr., 57 (1971) 121. 52 К. Вебер и М. Осборн, у Х. Нейрата и Р. Л. Хилл (редакторы), Die Proteins, Vol. I, Academic Press, Нью-Йорк, 3-е изд., 1975, с. 179. 53 K. Feigenhauer, Hoppe-Seyler’s Z. Physiol. Chem., 355 (1974) 1281. 54 р. Рэйчел, Ю. П. Ло и Х. Gainer, готовится.

1. Введение — Сложность и проблемы, связанные с Гликомиксом

1. Введение — Сложность и проблемы, связанные с Гликомиксом

После успеха названия некоторых подразделений наук с суффиксом «омикс», термин «гликомика» был придуман для описывают всестороннее исследование гликома, при этом сам гликом характеризуется как полный набор структур гликана, выраженных в определенное время и пространственное положение в определенных клетках, тканях или организмах [1].В этом обзоре приводится краткое изложение методов, используемых для структурного анализа, биоинформатической интерпретации данных и методов, используемых для биоанализа HS и других гликанов GAG. Проект «Геном человека» пришел к выводу, что только 30 000–50 000 генов определяют сложность человека. Это подчеркивает исключительную сложность живых организмов и дает представление о важности процессинга белков и структурных модификаций, которые способны расширять функции белков [2]. Углеводные структуры — это посттрансляционные модификации белков, которые особенно важны для многоклеточных организмов благодаря их роли в структуре и регуляции.Структурная сложность гликома намного превосходит сложность генома, поскольку синтез углеводов не зависит от матрицы (рис. 1). Сложность анализа структуры и функции гликанов привела к тому, что область гликомики отстает от области генома и протеома.

Рисунок 1

Сложность гликома. Гликом определяется как полный набор структур гликанов, экспрессируемых в определенное время и в определенном пространственном положении в определенных клетках, тканях или организмах.Следовательно, сложность структур и потенциальная химическая информация гликома намного превышает таковую генома и протеома. Рисунок взят из [1].

1.1. Структурные характеристики протеогликанов

Протеогликаны широко распространены в тканях животных и синтезируются практически всеми типами клеток [3]. Гликозамингликаны (ГАГ), ранее известные как мукополисахариды, синтезируются путем ковалентного присоединения к коровым белкам с образованием протеогликанов. Исключением является гиалуроновая кислота (HA), которая образует нековалентно связанные комплексы с протеогликанами.Ковалентная связь между коровым белком и GAG включает специфическую тетрасахаридную связь, включающую остаток глюкуроновой кислоты, два остатка галактозы (Gal) и остаток ксилозы (Xyl). Эта структура соединяется с остатком серина (Ser) в структуре ядра белка через O-гликозидную связь. В случае кератансульфата (KS) некоторые формы также связаны через N-аспарагинильную связь. Таким образом, протеогликаны характеризуются огромным разнообразием структур ГАГ, которые их украшают. Члены семейства GAG представляют собой длинные неразветвленные молекулы, которые можно упростить до повторяющейся структуры дисахарида, где один сахар является уроновой кислотой, либо глюкуроновой кислотой (GlcA), либо идуроновой кислотой (IdoA), а другой — либо N-ацетилированной глюкозаминовой кислотой. (GlcNAc) или остаток N-ацетилированного галактозамина (GlcNAc).Эти остатки сахара могут быть сульфатированы в различных положениях в зависимости от типа GAG. В случае простейшего структурного члена семейства, гиалуроновой кислоты, существует повторяющаяся единица GlcA и GlcNAc без сульфатных групп, в отличие от хондроитинсульфата (D-глюкуронат и либо GalNAc-4, либо GalNAc-6 сульфат. ), кератансульфат (Gal и GalNAc-6-сульфат) и дерматансульфат (L-идуронат (который может быть сульфатирован) и GalNAc-4-сульфат). Гепарансульфат (HS) — это еще один тип ГАГ, который подробно описан в следующем абзаце.В общем, все ГАГ имеют высокий отрицательный заряд, что важно для их функций, которые варьируются от структурной поддержки в матриксе до смазывания суставов и регулирования биодоступности и активности белков.

1.2. Структура и биосинтез гепарансульфата

HS представляет собой повсеместно распространенную линейную молекулу полисахарида, принадлежащую к семейству макромолекул GAG. Было обнаружено, что цепи HS ковалентно присоединены к коровым белкам с образованием протеогликанов HS (HSPG). Присоединение HS к различным коровым белкам приводит к тому, что HS имеет способность изменять свое местоположение и топографию, поскольку основные белки, такие как синдеканы и глипиканы, нацелены на поверхность клетки, тогда как перлекан, агрин и коллаген XVIII обнаруживаются во внеклеточном матриксе [4].Кроме того, разнообразие HSPG обеспечивается множеством семейств генов ядерных белков, таких как четыре члена семейства синдеканов и шесть членов семейства глипиканов в клетках млекопитающих [5]. Кроме того, коровые белки протеогликана обладают пространственной и временной специфической экспрессией [6].

Экспрессия структуры HS зависит от высокоспецифичного и регулируемого многоступенчатого биосинтетического процесса, который приводит к огромному множеству возможных структур HS. Возможные модификации структур HS можно упростить, рассматривая полисахариды HS как повторяющуюся дисахаридную единицу, состоящую из глюкуроновой кислоты (GlcA) и остатка N-ацетилглюкозамина (GlcNAc).Глюкозамин может оставаться ацетилированным (GlcNAc) или быть сульфатированным (GlcNS) в аминоположении, а также может находиться в незамещенной форме (GlcNH 2 ) [7]. Остаток GlcA может подвергаться реакции эпимеризации во время биосинтеза, а также может существовать в виде L-идуроновой кислоты (IdoA). Уроновая кислота подвергается 2-O сульфатации, в основном на IdoA и редко на GlcA. Сахар глюкозамина может быть дополнительно O-сульфатирован в 6 или 3 положениях. Моносахаридные единицы этих структур изображены на рисунке 2 [8].

фигура 2

Индивидуальные моносахаридные единицы гепарансульфата. Повторяющаяся диссахаридная единица состоит из α-L-идуроновой кислоты (a) или глюкуроновой кислоты (GlcA) (b) и остатка N-ацетилглюкозамина (GlcNAc) (c). Различные биосинтетические модификации могут происходить в положениях R моносахаридных единиц, включая функциональные группы, H-гидроксил, COCh4-ацетильные группы и SO3-сульфатные группы. R1 = H или SO3-, R2 = h3COCh4 или SO3-, R3 = H или SO3-, R4 = H или SO3-.

1.3. Гетерогенность, обеспечиваемая доменной структурой полисахаридов HS

дисахаридных звеньев HS образуют структуры полисахаридов с длинной цепью. Есть по крайней мере 8 различных общих дисахаридных структур, которые составляют HS. Для более длинных олигосахаридов количество вариантных структур увеличивается экспоненциально. Например, в случае гексасахарида теоретически существует 512 (8 3 ) возможных структур, а в случае октасахаридов — 4096 (8 4 ) возможных структур [9].Однако ограничения процесса биосинтеза ограничивают количество возможных структурных вариаций.

Хотя существует огромное количество разнообразия в структурах HS, есть также доказательства регуляции в формировании и поддержании этих структур. Это очевидно из специфической структуры доменного типа, которая встречается в полноразмерных полисахаридных цепях HS, длина которых обычно составляет от 50 до 200 дисахаридных единиц (что эквивалентно размеру 25-100 кДа [8]. Это проявляется в виде областей высокая сульфатация, состоящая в основном из остатков IdoA, сульфатированных в положении 2 (IdoA-2-S), и N-сульфатированных остатков, которые известны как «S» или «NS» домены.

Эти домены разбросаны между немодифицированными доменами, называемыми «NA» доменами, которые состоят в основном из немодифицированных остатков GlcA и GlcNAc. Эти два домена разделены промежуточными доменами, которые имеют чередующееся расположение N-ацетилированных и N-сульфатированных дисахаридных единиц. Они также известны как «домены NA / NS» (рис. 3). Длина S-доменов обычно составляет 3-8 дисахаридных единиц, тогда как длины NA / NS-доменов более вариабельны [10].

1.4. Гибкость цепей HS

Гибкость HS регулируется двумя факторами. Один фактор — это конформация кольца, а другой фактор — изгиб гликозидной связи. Кольцевая структура пиранозы может иметь конформацию «стул» (C), скошенную форму (S) или также возможна конформация «твист-лодочка» (T). Остатки, такие как GlcN и GlcA, являются жесткими и кольцами sTable 4C 1 . Но остатки IdoA находятся в равновесии между конформацией 1 C 4 и конформацией 2 S 0 , которые являются равноэнергетическими.Это равновесие очень быстрое (10 6 секунд) в физиологических условиях, что указывает на низкий энергетический барьер между двумя формами. Модификации, такие как сульфатирование, влияют на соседние остатки и могут влиять на конформационное равновесие [12]. Второй фактор, влияющий на гибкость HS, — это вращение вокруг гликозидных связей. Это главное соображение для трехмерных структур, которые зависят от связей, которые образуют гликозидную связь связей C1-O и O-C4.Повороты представлены двугранными углами Ψ и Φ, и вращение этих связей приводит к тому, что эти части полимера становятся гибкими [12].

Рисунок 3

Диаграмма, представляющая различные домены, присутствующие в цепочках HS. Сульфатированные домены (S-домены) содержат N-сульфатированные дисахариды с IdoA-2-O-сульфатом в качестве основного компонента уроната. N-ацетилированные (NA) домены не сульфатированы и имеют ацетилированные области. Напротив, N-ацетилированные и N-сульфатированные (NA / NS) домены содержат чередующиеся N-ацетилированные и N-сульфатированные звенья.Показаны сайты расщепления для обычно используемых ферментов переваривания гепаритиназы [11].

1.5. Разнообразные функции HS

HS взаимодействует со многими молекулами, особенно с белками, и выполняет разнообразные функции. Длина цепей HS позволяет им охватывать цели, которые могут быть расположены на расстоянии нескольких сотен нанометров друг от друга, такие как базальная мембрана или соседняя клетка. HS выполняет множество функций в физиологии клетки, которые можно в широком смысле разделить на различные категории, такие как функции корецепторов с различными факторами роста (члены факторов роста FGF и передача сигналов Wnt), участие в клеточной адгезии, прикреплении бактерий и вирусов, органогенез, эмбриогенез. и нейронная связь [13,14,15,16].Кроме того, было показано, что определенные структуры HS отвечают за определенные функции. Было показано, что специфические последовательности в структурах HS ответственны за специфические взаимодействия с белками [1]. Это было впервые показано на примере пентасахаридной последовательности в связывании гепарина с антитромбином и повышении его активности [17].

1.6. Вариации HS структур эндогенных тканей

Вариации HS могут быть проанализированы путем экстракции и очистки HS из тканей с последующим структурным исследованием.Эти исследования показывают, что изменение структур HS происходит регулируемым образом. Анализ состава ГВ препаратов ГВ из разных тканей крупного рогатого скота [18] показывает четкие различия в структурном составе ГВ. Состав N-сульфатированных областей в человеческих органах показывает различия в встречаемости доменов. Например, соотношение IdoA-aManR (6-OSO3) / GlcA-aManR (6-OSO 3 ) снижается с 3,2 до 1,0 от здоровой селезенки человека к больной селезенке [19]. Существуют различия в соотношении О-сульфатных дисахаридов, GIcA-aManR (6-OSO 3 ), ldoA (2-OS0 3 ) — aManR (6-OS0 3 ) и ldoA — aManR ( 6-OS0 3 ) из головного мозга человека по сравнению с другими органами, такими как печень, аорта и почки; Было отмечено, что 2-O-сульфатные единицы GlcA более многочисленны в головном мозге взрослых, но отсутствуют в коре головного мозга новорожденных [20].Другие ткани млекопитающих также показали тканеспецифические структурные композиции с использованием анализа состава дисахаридов и картирования олигосахаридов, где легкое содержало высокие общие уровни 2-O-сульфатирования, а HS из селезенки, почек и легких содержало высокие уровни 6-O-сульфатирования [21]. . Это указывает на строгую регуляцию биосинтетической модификации полимеров [13,22]. Дальнейшие доказательства регуляции структур HS обнаруживаются с помощью иммуногистохимического анализа. Антитела с разной аффинностью и специфичностью к эпитопам HS показывают, что структура и распределение HS варьируют в тканях [23,24].Кроме того, разные паттерны окрашивания демонстрируют, что разные клеточные компартменты в тканях обладают разными структурами HS [25,26]. Различия в структурном составе HS также существуют в тканях разного возраста, где повышенные уровни структуры трисульфатированного дисахарида обнаруживаются у пожилых людей [27].

3. Современные методы анализа больших наборов данных, полученных из структурных исследований

Спектроскопический анализ данных дает спектр пиков, который является результатом дифференциального разделения структур.Пики имеют определенное время удерживания, высоту и площадь в зависимости от образца и метода разделения. Площадь пика измеряется путем электронного интегрирования резонансных сигналов в спектр [97]. Однако многие трудности возникают при использовании сильной анионообменной хроматографии для структурного анализа олигосахаридов множества наборов данных. Это трудности с нанесением разных спектров на одной диаграмме без перекрытия графиков в разных точках (что позволяет избежать «шума» и затемнения областей спектра), трудности с получением количественных наблюдений и выводом из наборов данных

Большинство инструментов теперь компьютеризированы и автоматизированы.Это облегчает сбор больших объемов данных и помогает одновременный мониторинг различных экспериментальных параметров. Однако по-прежнему существуют проблемы со сравнением данных и выводами. Следовательно, для решения этих проблем с помощью сравнительного анализа данных необходим хемометрический анализ данных, который может использоваться для извлечения информации из различных наборов данных.

3.1. Необходимость в хемометрических методах для структурного анализа HS

Сложную структуру полисахаридов HS можно упростить до повторяющейся дисахаридной единицы, которая превращается в 8 часто встречающихся дисахаридов.Однако изучение структуры олигосахаридов HS является более сложным. Это связано с тем, что более длинные цепи HS имеют экспоненциально большее количество теоретических структур. Декасахаридная структура может иметь 32 768 (8 5 ) теоретических структур [98]. Экспериментально обнаруживается гораздо меньше структур [99]. Методы, используемые при изучении структур олигосахаридов HS, часто представляют собой спектроскопические методы, такие как ЯМР или аналитическая хроматография, которые разделяют по размеру с использованием гель-фильтрации или заряда с использованием сильной анионообменной хроматографии.Обычными методами, используемыми для определения последовательности HS, являются методы масс-спектрометрии, такие как MALDI-TOF или ESI-MS / MS. Все эти методы имеют следующие характеристики, которые очень затрудняют сравнительный анализ:

(1). Чувствительность методов означает, что они хороши при анализе проб, особенно при сравнении со стандартами (если возможно). Но, когда стандарты недоступны (что является обычным явлением в анализе олигосахаридов HS), большие различия в спектральных результатах вызваны небольшими изменениями в обработке образцов и обращении с ними.Это очень затрудняет сравнение результатов.

(2). Высокая размерность данных экспериментальных методов приводит к появлению «зашумленных» спектров (белого шума), которые могут потребовать предварительной обработки. Это сложная задача, так как нужно быть осторожным, чтобы не удалить важные компоненты.

(3). Одна из наиболее распространенных проблем для всех методов исследования олигосахаридов HS заключается в том, что одновременный и рутинный анализ предоставляет огромное количество данных.

3.2. Существующие хемометрические методы

В других областях биологических исследований наблюдалась рутинная обработка больших объемов данных, и для решения этой проблемы были разработаны стандартные пакеты программного обеспечения, такие как микроматричный анализ. При этом используется комбинация хемометрического или статистического анализа для работы с наборами данных. Область гликомики несколько отстала в этой области и только в последние годы начала использовать хемометрические методы. Многомерные хемометрические методы используют математику для вычисления матричной алгебры и векторов и могут быть разделены на два важных приложения [97].Другой пример распознавания образов — кластерный анализ. Кластерный анализ уже использовался для упрощения взаимосвязей, относящихся к структурному и функциональному анализу HS. Кластерный анализ распределяет объекты по группам (называемым кластерами) и разделяет объекты в один и тот же кластер, если данные рассматриваются как «похожие». Если данные считаются разными, то данные группируются в отдельные группы. Сходство определяется типом измерения расстояния, которое обычно измеряется статистическим анализом данных.Кластерный анализ успешно применялся для сравнения сходств в спектрах кругового дихроизма синхротронного излучения (SRCD) [100]. Существуют различные типы методов кластеризации, такие как иерархическая кластеризация, K-кластеризация и самоорганизующиеся карты. Одним из способов представления результатов кластерного анализа является создание тепловой карты кластера, которая представляет собой цветной график с высоким разрешением, который использует цветовое представление для изображения другого измерения данных. Тепловые карты обычно используются в методах молекулярной биологии, таких как микрочипы ДНК, которые представляют уровни экспрессии многих генов в ряде сопоставимых образцов.Также были разработаны новые инструменты для помощи в анализе данных, полученных с помощью MALDI и ESI-MS [101]. Кроме того, было создано программное обеспечение для профилирования гликанов, присутствующих в образцах, разделенных и проанализированных с использованием жидкостной хроматографии / масс-спектрометрии (ЖХ / МС). Примером может служить программный пакет GlycReSoft, созданный для автоматического распознавания гликанов по данным ЖХ / МС [102].

3.3. Базы данных, важные для интеркаляции данных

Также доступно множество интернет-инструментов, которые обеспечивают доступ к программному обеспечению, которое извлекает информацию из экспериментальных исследований [103].В Европе основным веб-сайтом, на котором собрана вся эта информация, является EuroCarb-DB. Доступное программное обеспечение имеет различные функции, такие как прогнозирование потенциальных сайтов гликозилирования на белках, прогнозирование трехмерных структур углеводов, а также профилирование различных структур HS [103,104,105]. Также были разработаны новые инструменты для определения воспроизводимости образцов за счет использования принципов теории хаоса [106].

4. Функциональный анализ структур HS

Есть много способов изучить биологическую функцию структур HS, чтобы понять взаимосвязь структура-активность (SAR).В общем, источники построек из:

— Прямая экстракция и очистка популяций HS из тканей или культуральных клеток, происходящих из различных органов.

— Частичные химические и ферментативные модификации гепарина для получения олигосахаридов контролируемых модификаций и размеров [98]. Структура этих фрагментов может быть подтверждена с помощью анализа состава дисахаридов, а также методов секвенирования (раздел 2).

-Химически синтезированные олигосахариды HS [107].Синтез структур HS — длительный и специализированный процесс. Твердофазный синтез и комбинаторная химия значительно продвинули эту область [108,109,110]

4.1. Методы изучения структурных аспектов взаимодействий HS и белков

Кристаллографические исследования были очень важны для понимания взаимодействия HS / белков, как это было ранее замечено с FGF-2. Методы иммобилизации HSPG на поверхности очень важны для понимания кинетики связывания и сродства HS с различными партнерами связывания.Биосенсоры использовались для изучения многих взаимодействий HSPG. Совсем недавно были описаны оптические и акустические методы, такие как двойная поляризационная интерферометрия (DPI) [111], микровесы на кристаллах кварца [112], круговой дихроизм синхротронного излучения (SRCD) [113] и инфракрасная спектроскопия с преобразованием Фурье (FTIR), которые позволяют дальнейшее понимание и количественная оценка молекулярной динамики взаимодействий HS [111]. Иммобилизация недериватизированных олигосахаридов на поверхности микрочипов также позволила качественный и количественный анализ взаимодействий связывания белков с помощью флуоресцентного детектирования и позволяет одновременно анализировать большое количество образцов [114,115,116].

4.2. Изучение эффектов на передачу сигналов в клетках

Важность HS как кофактора в передаче сигналов FGF была впервые показана на клетках, которые лишены HS в природе или где сульфатирование цепей HS блокируется с помощью обработки хлоратом натрия [117,118,119]. Дальнейшее изучение взаимосвязи между структурой и функцией HS было проведено путем скрининга определенных по размеру или химически десульфатированных сахаридов гепарина на их способность активировать передачу сигналов FGF. Было обнаружено, что сахаридные структуры обладают специфической активностью, поскольку сульфатирование определенных остатков (таких как 6-O-сульфатирование глюкозамина) является важным для передачи сигналов FGF-2 с использованием FGFR-1 [120,121].Регуляторная роль HS также была подчеркнута в экспериментальной работе, которая показывает, что выбранные структуры способны активировать и ингибировать определенные комбинации изоформ FGF / FGFR [32,99].

4.3. Анализ клеточной сигнализации

Исследование HS в конечном итоге направлено на выяснение структур, ответственных за различные функциональные результаты. Поэтому информация из биофизических анализов и данных кристаллографии сочетается с информацией из клеточных анализов. Для определения эффекта конкретных олигосахаридных структур используются различные типы клеточных анализов, и выбор зависит от типа клеток, чувствительности анализа, необходимого материала, доступного оборудования для обнаружения и типа задействованных методов.Существует четыре основных типа клеточных анализов, включая: пролиферацию клеток / синтез ДНК; анализы клеточной адгезии, агрегации и инвазии; анализ ангиогенеза; сотовая сигнализация.

4.3.1. Клеточная пролиферация

Способность HSPGs связываться с различными факторами роста FGF и рецепторами факторов роста, чтобы индуцировать синтез ДНК или пролиферацию клеток, широко изучалась [122, 123]. Клетки с естественным дефицитом HS, такие как клетки BAF, предоставляют важный инструмент для изучения функциональных эффектов различных структур HS, различных FGF и различных FGFR [124].Клетки также можно обрабатывать для удаления сульфатации HS. Это достигается добавлением конкурентного ингибитора, такого как хлорат натрия, который ингибирует процесс сульфатирования [117]. В нормальных условиях сульфат включается в HS с использованием донора сульфата аденозин-3′-фосфат-5′-фосфосульфата (PAP), который затем транспортируется в аппарат Гольджи, где сульфатные группы затем переносятся с PAP на зрелые цепи GAG. Хотя PAP являются облигатным источником сульфатов для цитозольных и мембраносвязанных сульфотрансфераз, 70% потребления PAPS происходит за счет биосинтеза GAG [125].Эффективным методом удаления сульфатации и обеспечения отмены передачи сигналов, индуцированной фактором роста FGF, а также различных комбинаций факторов роста и рецепторов FGF является ингибирование хлората натрия. Радиоактивность можно использовать для измерения синтеза ДНК путем измерения включения метил- [3H] тимидина. Количество клеток может быть определено количественно с использованием колориметрических продуктов, таких как 3- (4,5-диметилтиазол-2-ил) -2,5-дифенилтетразолий бромид, тетразол (МТТ), который восстанавливается митохрондриями живых клеток [9].

4.3.2. Анализы клеточной адгезии и инвазии

Анализы клеточной адгезии были важны для оценки способности клеток прилипать к поверхности. Клетки можно подвесить в буфере и позволить им взаимодействовать под действием силы тяжести. Количество прикрепившихся клеток можно определить с помощью гемоцитометра или счетчика Коултера для подсчета количества клеток. Анализы клеточной инвазии также были полезны для оценки способности клеток не только прикрепляться, но и проникать в клетки, такие как клетки миеломы. Гидратированный гель коллагена I типа можно использовать для оценки расстояния и глубины клеточной инвазии.Обнаружение с помощью фазовой микроскопии было полезно для измерения глубины клеточной инвазии. Неспецифические взаимодействия также можно устранить путем протеазного переваривания неинвазивных клеток. Эти анализы могут предоставить информацию о ряде факторов, поскольку ими легко манипулировать с помощью промоторов или ингибиторов [126].

4.3.3. Анализы ангиогенеза

HSPG участвуют в прорастании новых кровеносных сосудов из существующей микрососудистой системы (ангиогенез), поскольку они связывают многие ингибиторы этого процесса [127].Анализы ангиогенеза можно использовать для оценки участия многих различных белков. Многие наборы для ангиогенеза сейчас коммерчески доступны, но первоначальный анализ был описан более 50 лет назад с использованием хориоаллантоисной мембраны (САМ). Можно использовать удобренные куриные яйца с небольшим окном в скорлупе, открывающим доступ САМ, и можно добавить фильтрующие диски, предварительно пропитанные фактором роста и HSPG. Окно закрывают и инкубируют, а трансплантаты оценивают на рост и васкуляризацию [128]. Анализы с культивированными эндотелиальными клетками также можно использовать для изучения образования сосудов [129].

4.3.4. Анализ клеточной передачи сигналов

Распространенным методом изучения последующих эффектов различных структур HSPG является обнаружение различных белков и фосфорилирования белков, участвующих в различных клеточных сигнальных путях [130]. Обычно это выполняется с помощью вестерн-блоттинга, но в последнее время использовались методы иммуноокрашивания. Проблема с упомянутыми анализами заключается в их ограниченном количестве образцов, которые могут быть проанализированы. В анализах обычно используются планшеты для микротитрования в 96-луночном, реже — в 384-луночном формате.Однако ручная подготовка должна рассматриваться как человеческая ошибка, связанная с пробоподготовкой, которая может быть сложной и требовать много времени.

4.4. Потребность в биологических анализах с более высокой пропускной способностью для исследования HS

Анализы с более высокой пропускной способностью в настоящее время предпочтительны для изучения многих молекул. Использование анализов с более высокой пропускной способностью (HTP) при изучении HS улучшило бы изучение HS, поскольку трудности с очисткой HS означают, что доступны лишь небольшие количества определенных структур.Использование анализа HTP означает: сокращение времени для экспериментов; устранение радиоактивных отходов и сокращение химических отходов; сокращение количества сахаридов HS и необходимых расходных материалов.

4.5. Использование методов скрининга на основе клеток

Традиционные методы скрининга на основе клеток с использованием микротитровальных планшетов страдают небольшим количеством образцов, которые можно исследовать одновременно. Секвенирование геномов резко изменило акцент и направление исследований. В эту постгеномную эру упор был сделан на валидацию конкретных генных мишеней с определенными функциями и болезненными состояниями, что привело к тому, что биофармацевтические компании увеличили свою деятельность по скринингу на основе клеток с 30% до 50% [131].Использование микроматриц вместо других анализов оказалось успешным в изучении экспрессии генов и взаимодействий с белками. Автоматизация и высокая производительность микрочипов позволили быстро продвинуться в функциональном понимании генов и белков.

4.6. Платформы микрочипов ДНК Glycoarrays-Carbohydrate

были впервые описаны и запатентованы в 1998 году для анализа экспрессии различных генов и количественного определения взаимодействий нуклеиновых кислот и белков [132].Платформы микрочипов в настоящее время модифицированы для разработки новых платформ, таких как массивы белков, которые изучают молекулярные взаимодействия белков. Были описаны более современные платформы, такие как массивы клеток или массивы обратной трансфекции [133]. Массивы клеток состоят из плазмид или РНК, нанесенных на предметные стекла микрочипов и культивированных совместно с наложенными клетками для трансфекции. Успешная трансфекция определяется по увеличению флуоресценции, соответствующей используемой конструкции и локализации на слайде. Эти методы позволяют проводить высокопроизводительный параллельный скрининг и отстаиваются в качестве стратегии для крупномасштабных экспериментов, таких как полногеномный скрининг РНКи [134] и скрининг новых генов или лекарств [135, 136].Клеточные массивы также использовались для скрининга эффекта сверхэкспрессии генов человека на апоптоз клеток [137].

На сегодняшний день появилось много различных типов платформ массива ячеек. Тканевые массивы содержат массивы цилиндрических биоптатов ткани из блоков опухоли, залитых парафином отдельных доноров, которые помещаются в определенном положении на парафиновый блок «реципиента» с использованием специального оборудования. Тканевые массивы позволяют параллельное обнаружение ДНК с использованием флуоресцентной гибридизации in situ (FISH), РНК с использованием гибридизации мРНК in situ и белков с использованием иммуногистохимии.Тканевые массивы позволяют одновременно анализировать 1000 биопсий тканей [138] и имеют важное клиническое применение при раке, поскольку они потенциально могут анализировать большое количество опухолевых тканей и могут использоваться для изучения больных и здоровых тканей у людей, а также трансгенных тканей у мышей. [138].

Использование микроматриц для изучения взаимодействия углеводов (также известных как гликаноиды или гликановые массивы) отстает от других биологических молекул, и научная литература появилась только в 2003 году [2].Функциональное исследование гетерогенных структур HS всегда оказывалось проблематичным из-за ограничений относительно небольшого количества образцов, которые могут быть одновременно проанализированы в микротитровальных планшетах. Гликановые микрочипы предлагают возможность высокопроизводительного анализа углеводных структур.

4.7. Изготовление углеводных микрочипов

Конструирование углеводных микрочипов требует большего количества технических соображений, чем другие биологические молекулы. Одним из ключевых компонентов массива гликанов является поверхность.Типичными поверхностями являются микротитровальные планшеты, функциональные предметные стекла, предметные стекла, покрытые нитроцеллюлозой, и золотые предметные стекла [139]. Выбор поверхности важен, поскольку он определяет тип обнаружения, который можно использовать, поскольку метод обнаружения зависит от основных свойств поверхности.

Иммобилизация гликановых структур на поверхности — второе соображение. Существует четыре основных химического состава для прикрепления углеводов к поверхностям, которые перечислены ниже:

— Альдегид с восстанавливающимся концом, связанный с амино- и гидразидными поверхностными группами на поверхности.

-Иммобилизация с использованием реакции Дильса-Альдера.

-SH- / малемид.

— Специфическая для участка и нековалентная иммобилизация.

Используя метод альдегида с восстанавливающим концом, связанный с поверхностями, полученными из амино или гидразида, можно связать все углеводные структуры, содержащие свободные альдегидные группы на восстанавливающем конце сахаров. Ферментативно переваренные олигосахариды и дисахариды HS, CS, DS и KS могут быть иммобилизованы [140, 141].Недостатки использования поверхностей золота, дериватизированных гидразидом, состоят в том, что между поверхностью и гликаном необходим спейсер для увеличения доступности гликановой цепи в растворе, такой как самоорганизующийся монослой ω-тиолированной алкильной цепи (C16) [115]. Преимущества золота заключаются в том, что можно использовать различные методы обнаружения, такие как матричная лазерная десорбция / ионизация по времени пролета (MALDI-MS), биосенсоры поверхностного плазмонного резонанса (SRP) и микровесы на кристаллах кварца [115]. Иммобилизация с использованием реакции Дильса-Альдера была показана для иммобилизации циклопентадиен-циклопентадиен-содержащих углеводов на покрытой бензохиноном золотой поверхности и охарактеризована Mrksich и Houseman [142].Преимущество этого метода в том, что реакция проходит эффективно. Были описаны сахара, связанные с малемидом, присоединенные к тиоэфирным связям на предметных стеклах, покрытых тиоловыми группами [143]. Недостатком этого метода является то, что необходимо учитывать стерические препятствия связывания белков с углеводами. Таким образом, между малеимидными группами и углеводными фрагментами должны быть вставлены тросы надлежащей длины. Использование сайт-специфических и нековалентно конъюгированных углеводов на немодифицированных поверхностях было описано для неогликолипидов (NGL) с использованием нитроцеллюлозы [144,145]. Преимущества в том, что не требуется предварительных модификаций поверхности, что сокращает время эксперимента.

Еще один метод прикрепления углеводов включает пассивную адсорбцию структур на поверхности. Для этой поверхности используются черные полистирольные слайды и физическая модификация поверхности MaxiSorb ™. Связывание углеводов с поверхностью включает связывание водорода, ионное связывание (с участием полярных частей молекул) и гидрофобные взаимодействия Ван-де-Ваальса. Иммобилизация усиливается за счет удаления воды между иммобилизованным углеводом и гидрофобной поверхностью [146].

4.8. Glycobioarrays

Современные функциональные анализы in vitro с использованием подходов клеточной биологии часто требуют большого количества клеток или большего количества реагентов, которые не всегда доступны, особенно в случае сахаридов. Следовательно, разработка функциональных скрининговых анализов на слайдах может позволить проводить скрининг и дифференциацию различных и более крупных популяций сахаридных структур. Хотя были описаны методы массивов с использованием живых клеток для трансфекции РНКи и низкомолекулярных ответов [135, 136, 147, 148], было проведено несколько исследований, которые измеряли связывание бактерий, вирусов и клеток млекопитающих с иммобилизованными гликанами [149, 150, 151, 152, 153].Пример гликанового массива, используемого для количественной оценки клеточной адгезии, был показан с использованием гликановых массивов с лектиновыми структурами на гепатоцитах [152]. Это было показано с использованием предметных стекол с ковалентно присоединенными моносахаридами и олигосахаридами невосстанавливающих концевых остатков N-ацетилгалактозамина (GlcNAc), галактозы (Gal) и остатков N-ацетилгалактозамина. Первичные куриные гепатоциты экспрессируют четко выраженный лектин С-типа, который связывается с невосстанавливающими концевыми остатками N-ацетилглюкозамина, и был помечен флуоресцентным красителем.Для удаления неприлипающих клеток использовалась специальная камера (камера для центрифугирования GlycoChip®), а прилипшие клетки измерялись с помощью детектирования флуоресценции. Куриные гепатоциты избирательно связываются с лектином, дериватизированным структурами GlcNAc, а не с пятнами лектина с Gal или без модификаций [152].

Однако более недавнее исследование показывает, что технология на основе слайдов использует иммобилизацию сахаридов на аминосилановых поверхностях посредством связи основания Шиффа с восстанавливающими концами, чтобы оценить реакцию клеток на гликаны [154].Этот инструмент демонстрирует значительный потенциал для дальнейшего развития в качестве универсального инструмента для функционального скрининга широкого спектра гликанов [154]. Методология легко применима к стандартной лабораторной обстановке, потому что изображения получают с использованием только сканера микрочипов ДНК. Он имеет ряд преимуществ, включая скорость, возможность миниатюризации (и, следовательно, низкое использование реагентов), а также значительный потенциал для развития в качестве высокопроизводительного инструмента.

5. Заключительные замечания.

Гликомические методы для крупномасштабного структурного и функционального анализа гликанов HS теперь имеют реальный потенциал для изучения природных библиотек сахаридов HS, получение которых было недавно описано [155], а также сахаридов HS, продуцируемых с помощью синтетическая химия [156,157,158].Кроме того, такие сахариды могут быть автоматически выделены в форматы массивов [116, 156, 157, 159, 160], что позволит проводить крупномасштабный одновременный анализ различных структур. Разработка технологий анализа на основе массивов — очень необходимый шаг вперед для оценки функции гликанов, особенно в случае семейства протеогликанов HS. Такие исследования могут впоследствии изучить взаимосвязь структура-функция сахаридов HS на функциональном уровне и могут быть в дальнейшем использованы как общий инструмент для анализа гликанов.В конечном итоге можно легко предвидеть, что гликомические исследования HS дадут новые идеи, которые лежат в основе возможностей для биомедицинского использования [161], таких как новые методы лечения болезни Альцгеймера [162] или подходы для улучшения восстановления нервов [163].

Сравнение с гель-электрофорезом в импульсном поле и спа-типированием

Аннотация

Фон

Молекулярное типирование метициллин-устойчивого Staphylococcus aureus (MRSA) необходимо для изучения путей и скорости передачи этого патогена.Доступные в настоящее время методы набора текста либо ресурсоемки, либо имеют ограниченную дискриминационную способность. Анализ тандемных повторов (MLVA) с несколькими локусами может предоставить альтернативный высокопроизводительный инструмент молекулярного типирования с высоким эпидемиологическим разрешением.

Методология / основные выводы

Новая схема MLVA для S. aureus была утверждена с использованием 1681 изолятов S. aureus , собранных от голландских пациентов, и 100 изолятов от свиней. MLVA с использованием 8 локусов тандемных повторов выполняли в 2 мультиплексных ПЦР, и флуоресцентно меченые продукты ПЦР точно определяли размер на автоматическом секвенаторе ДНК.Оцененное количество повторов было использовано для создания профилей MLVA, состоящих из строк из 8 целых чисел, которые использовались для категориальной кластеризации. MLVA дало 511 типов, которые сгруппировались в 11 различных комплексов MLVA, которые, по-видимому, совпадали с клональными комплексами MLST. MLVA была по крайней мере такой же дискриминационной, как PFGE, и вдвое более дискриминационной, чем spa -последовательное типирование. Наблюдалось значительное совпадение между MLVA, типированием последовательности spa и PFGE на уровне комплекса MLVA со значениями разделения групп 95.1% и 89,2%. MLVA не смог провести различие между связанными со свиньями штаммами MRSA, выделенными от людей и свиней, что подтверждает высокую степень родства. MLVA также превосходил группу изолятов MRSA, ранее отнесенных к пространственно-временным кластерам с неотличимыми SpaTypes, демонстрируя его повышенную эпидемиологическую полезность.

Выводы

MLVA, описанный в этом исследовании, представляет собой высокопроизводительный и относительно недорогой метод генотипирования для S. aureus , который дает дискретные и однозначные данные, которые могут использоваться для определения биологических значимых генотипов и комплексов и могут использоваться для межлабораторных сравнений в доступной сети. базы данных.Результаты показывают, что MLVA компенсирует недостатки других подходов к высокодискриминационной типизации и представляет собой многообещающий инструмент для больничной, национальной и международной молекулярной эпидемиологии.

Образец цитирования: Schouls LM, Spalburg EC, van Luit M, Huijsdens XW, Pluister GN, van Santen-Verheuvel MG, et al. (2009) Тандемный повторный анализ числа переменных с несколькими локусами для Staphylococcus Aureus : сравнение с гель-электрофорезом в импульсном поле и типом spa -Typing.PLoS ONE 4 (4):
e5082.

https://doi.org/10.1371/journal.pone.0005082

Редактор: Адам Дж. Ратнер, Колумбийский университет, Соединенные Штаты Америки

Поступила: 7 января 2009 г .; Одобрена: 3 марта 2009 г .; Опубликовано: 3 апреля 2009 г.

Авторские права: © 2009 Schouls et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Финансирование этого исследования было предоставлено правительством Нидерландов (Министерством здравоохранения, социального обеспечения и спорта). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Staphylococcus aureus — важный бактериальный патоген, связанный с серьезными внебольничными и внутрибольничными заболеваниями [1], [2].Хотя он может вызывать различные клинические синдромы, такие как бактериемия, пневмония, эндокардит и образование глубоких абсцессов, S. aureus , по-видимому, присутствует повсеместно и чаще всего переносится без каких-либо клинических симптомов. Носители могут распространять патоген, заражая людей, у которых может развиться болезнь. Внедрение метициллина привело к быстрому появлению устойчивых к метициллину S. aureus (MRSA) и представляет собой серьезную клиническую проблему в больницах по всему миру [3] — [5].В Нидерландах заболеваемость инфекциями MRSA все еще довольно низка, вероятно, в результате «политики поиска и уничтожения» и ограниченного использования антибиотиков [6], [7]. В последнее время количество инфекций MRSA в Нидерландах постепенно увеличивается, что является серьезной причиной для беспокойства [8], [9].

Для понимания популяционной биологии S. aureus и изучения воздействия мер по борьбе с инфекциями MRSA однозначная характеристика S.aureus . Для анализа S. aureus использовались многие методы типирования. В течение многих лет использовалось фаговое типирование [10], но с появлением молекулярного типирования фаговое типирование было заменено более новыми методами. Было использовано множество методов, таких как риботипирование [11], [12], анализ случайной амплификации полиморфной ДНК [12], [13], анализ последовательности 16S – 23S рДНК spa cer областей [14], [15] , полиморфизм длины амплифицированного фрагмента [16], [17] и типирование SSC mec [18], [19].Однако наиболее широко используемыми методами молекулярного типирования для S. aureus являются PFGE [20], [21], MLST [21], [22] и spa -последовательное типирование [23], [24]. В PFGE фрагменты, полученные после макрорестрикции Sma I, разделяют на специальном агарозном геле. Это было чрезвычайно полезно для выяснения популяционных структур и идентификации вспышек S. aureus . MLST, основанный на анализе последовательности ДНК 7 генов домашнего хозяйства, дает однозначные результаты типирования, которые подходят для межлабораторных сравнений.В результате появилась база данных, доступная в Интернете, которая используется во всем мире (http://saureus.mlst.net/). Spa -последовательное типирование стало широко распространенной техникой типирования для S. aureus за очень короткое время. В spa — последовательность, типизирующая вариацию в области тандемного повтора белка А, кодирующего spa, ген используется для выполнения генотипирования S. aureus . Повторы в гене spa различаются как по количеству, так и по последовательности.Путем определения последовательности повторов создается профиль, который можно использовать для кластеризации. Это привело к быстрорастущей базе данных, доступной в Интернете, по которой можно делать запросы (http://www.spaserver.ridom.de/).

Как и большинство других методов генотипирования на основе полос, PFGE постепенно становится устаревшим методом. Этот метод не является портативным, размеры полос неточны, что приводит к неоднозначным результатам, а создание профилей является трудоемким и сложным в исполнении. MLST очень дорогой, трудоемкий и поэтому недоступен для большинства лабораторий. Spa -последовательная типизация — это портативный метод, который относительно легко выполнять. Однако он основан только на одном локусе в геноме, и кластеризация изолятов S. aureus на основе данных spa является сложной. По этим причинам мы разработали и проверили метод типирования, основанный на составе геномных локусов, содержащих тандемные повторы. Этот метод, называемый анализом тандемных повторов с переменным числом множественных локусов (MLVA), был введен в качестве метода типирования для большого числа бактериальных патогенов [25] — [37].В MLVA вариабельность количества коротких последовательностей тандемных повторов используется для создания профилей ДНК для эпидемиологических исследований. Было разработано несколько схем MLVA для S. aureus , которые используются для определения типа этого патогена. Однако эти схемы MLVA основаны на анализе в агарозных гелях, что делает их неточными и непереносимыми. В этом отчете мы описываем разработку надежного и портативного MLVA и демонстрируем полезность этого метода, идентифицируя типы и комплексы в большой коллекции метициллин-резистентных и метициллин-чувствительных S.aureus .

Материалы и методы

Штаммы бактерий

В это исследование мы включили коллекцию из 2525 штаммов, состоящую из i) тестового набора из 86 изолятов S. aureus + 10 S. epidermidis , ii) набора из 1681 человека и 100 свиней S. aureus. изолятов, используемых для обширной проверки; iii) 658 изолятов S. aureus , используемых для оценки потенциала MLVA для выявления вспышек. Набор для испытаний включал эталонные штаммы и использовался для первоначальной настройки MLVA.Изоляты, использованные для обширной валидации, были собраны для национального надзора за S. aureus отделом бактериального типирования Лаборатории инфекционных заболеваний и перинатального скрининга Национального института общественного здравоохранения и окружающей среды. Из этого набора штаммов с 2005 по 2007 год было собрано 1781 штамм, из которых 1681 штамм был выделен от людей и 100 — от свиней. Для этого исследования мы использовали 393 изолята, собранные в 2005 г., 617 — в 2006 г. и 671 изолят — в 2007 г.Изоляты собирали в течение первых 3 месяцев каждого из 3 лет и составляли примерно 20% от общего числа изолятов, собранных для национального надзора за этот период времени. Из 1681 штамма от людей 135 были выделены из крови, 831 — из мазков из носа, горла или промежности, а оставшаяся часть была выделена преимущественно из раневых инфекций. Приблизительно 87% штаммов, выделенных от человека, и все штаммы, выделенные от свиней, были устойчивыми к метициллину S.aureus (MRSA). Коллекция из 1681 штамма, выделенного от человека, также включала 163 штамма, которые были частью голландских штаммов, собранных для проекта EARSS (http://www.rivm.nl/earss/), 156 из которых были чувствительными к метициллину S. aureus ( MSSA). Все 100 штаммов MRSA, выделенных от свиней, были собраны в 2007 году. Кроме того, набор из 658 изолятов MRSA, собранных для национального надзора за S. aureus в 2008 году, был использован для предварительной оценки эпидемиологического потенциала MLVA.

Рост бактерий и подготовка лизатов

Культуры, хранящиеся при -80 ° C, наносили штрихами на чашки с колумбийским агаром с 5% овечьей кровью, культивировали в течение ночи при 37 ° C и визуально проверяли на чистоту. Две колонии суспендировали в 50 мкл смеси для лизиса в ТЕ (10 мМ Трис. HCl, 1 мМ ЭДТА, pH 8,0) с добавлением 100 мкг / мл лизостафина, инкубировали в течение 35 минут при 37 ° C и нагревали в течение 10 минут при 95 ° C. . После стадии инактивации добавляли 450 мкл ТЕ и лизат использовали либо непосредственно, либо хранили при -20 ° C до использования в ПЦР.

Гель-электрофорез в импульсном поле и

Spa -последовательное типирование

Гель-электрофорез в импульсном поле (PFGE) выполняли, как описано ранее [38]. Spa Типирование -последовательности в основном выполнялось в соответствии с протоколом RIDOM [24], (http://www.ridom.de) с небольшими изменениями. Первой модификацией было использование нового прямого праймера (TAAAGACGATCCTTCAGTGAGC) для замены праймера spa -1113f, используемого для ПЦР spa , и секвенирования, которое имеет несоответствие последовательности в положении 16 -го со всеми известными spa генные последовательности.Используемый обратный праймер был spa, -1514r, как описано в протоколе RIDOM. Кроме того, мы уменьшили количество праймера, используемого в spa -PCR, чтобы минимизировать количество неиспользованного праймера после ПЦР. В результате не требовалось очистки продукта ПЦР для анализа последовательности. Вкратце, 1 мкл стафилококкового лизата использовали в 25 мкл ПЦР с использованием мастер-микса HotStar (Qiagen, Hilden, Германия) и 2,5 пмоль праймеров. Ген spa амплифицировали с использованием следующей программы: 15 мин при 95 ° C, 30 циклов амплификации, состоящих из 45 секунд при 95 ° C, 45 секунд при 60 ° C и 1.5 мин при 72 ° C и последний этап 7 мин при 72 ° C. Два мкл неочищенного продукта ПЦР использовали для секвенирования обеих цепей продукта.

Идентификация и выбор локусов VNTR в

S. aureus

В начале этого исследования последовательности генома 9 различных штаммов S. aureus были доступны в открытом доступе. Эти геномные последовательности были проверены на наличие последовательностей тандемных повторов с использованием программы Tandem Repeats Finder, версия 4.00 [39] и самодельный сценарий для программного обеспечения Kodon 3.5 (Applied Maths, Синт-Мартенс-Латем, Бельгия). Анализ in silico доступных геномов S. aureus выявил наличие локусов с вариабельной количество тандемных повторяющихся последовательностей в этих секвенированных геномах. Примечательно, что большинство идентифицированных локусов VNTR несут несовершенные тандемные повторы. Праймеры, фланкирующие области VNTR, были разработаны и использованы в случайно выбранной генетически разнообразной тестовой панели штаммов, которые ранее были проанализированы PFGE в нашей лаборатории.Локусы VNTR считались подходящими, если они давали продукты ПЦР со всеми штаммами в тестовой панели и в тестовой выборке было не менее 3, но не более 10 различных аллелей. Повторяющиеся локусы, не дающие ни одного продукта ПЦР, считались неподходящими. Кроме того, предпочтительны локусы VNTR, расположенные в некодирующих областях генома, но это не является критерием исключения. Из более чем 20 локусов VNTR, которые первоначально были идентифицированы с помощью анализа in silico , 10 были отобраны на основе их характеристик (размер повтора, количество повторов, уникальный локус).Из этих 10 мы выбрали 8 локусов VNTR, которые соответствовали указанным выше критериям. Только 3 из 8 локусов располагались в кодирующих областях в геноме S. aureus (Таблица 1 и Рис. 1). Обоснование выбора 8 локусов VNTR было прагматичным. Во-первых, необходимо включить достаточное количество локусов, чтобы получить достаточную дискриминационную силу. Во-вторых, автоматический секвенатор ДНК, используемый для MLVA, может различать 5 различных флуоресцентных меток в одном канале. Это означает, что мультиплексная ПЦР с 4 разными мишенями с использованием разных флуоресцентных меток для каждой ПЦР может быть проанализирована вместе с внутренним маркером с пятой флуоресцентной меткой для получения точного определения размеров.Таким образом, 2 мультиплексных ПЦР позволили провести одновременный анализ 8 различных локусов VNTR S. aureus .

Анализ тандемных повторов числа переменных с множественными локусами

ПЦР VNTR проводили в объемах 25 мкл на машинах для ПЦР Applied Biosystems 9700 (Applied Biosystems, Фостер-Сити, США). Восемь локусов VNTR были амплифицированы в 2 мультиплексных ПЦР. Для каждой мультиплексной ПЦР 2 мкл 1-10 разведенного лизата S. aureus добавляли к смеси, содержащей 10 пмоль каждого из 4 различных 5′-флуоресцентно меченных прямых праймеров, 10 пмоль каждого из 4 немеченых обратных праймеров и 12 пмоль каждого.5 мкл мультиплексной мастермикса HotStarTaq (Qiagen, Hilden, Германия). Исключение составляла вторая мультиплексная ПЦР, в которой 5 пмоль меченого праймера VNTR61_02FV, а также 5 пмоль немеченого праймера VNTR61_02F использовали для уменьшения сигнала для этого VNTR в мультиплексной ПЦР. Все последовательности праймеров показаны в таблице 2. Локусы VNTR амплифицировали с использованием следующей программы ПЦР: 15 мин при 95 ° C, затем 20 циклов амплификации, которые включали 45 секунд при 95 ° C, 45 секунд при 54 ° C и 90 секунд при 72 ° C и заключительный этап 30 минут при 68 ° C, чтобы гарантировать полную активность терминальной трансферазы ДНК-полимеразы Taq.После ПЦР образцы разбавляли 1 × 100 в воде и 1 мкл разбавленных образцов смешивали с 10 мкл 1 × 100 в воде, разбавленной флуоресцентно меченным маркером GeneScan 1200 LIZ (Applied Biosystems). После тепловой денатурации в течение 5 мин при 95 ° C фрагменты разделяли на секвенаторе ДНК ABI 3730 с использованием стандартного модуля анализа фрагментов. Полученные файлы .fsa были импортированы и проанализированы в программе GeneMarker (Softgenetics, State College, США) для расчета количества повторов каждого локуса VNTR.Локусам VNTR, которые не дали продукта ПЦР после повторного анализа, был присвоен номер 99. Однако все 1681 изолят проверочного набора дали продукт ПЦР для всех локусов VNTR. Оцененные количества повторов 8 локусов VNTR были объединены в строку, состоящую из 8 целых чисел, например. 14-0-2-4-1-7-1-6. Эта строка, называемая профилем MLVA, использовалась для кластеризации.

Расчет количества повторов в каждом из локусов VNTR был простым. Размер продукта ПЦР минус размер фланкирующих областей давал повторяющуюся область.Разделив размер этой области на размер повторяющейся единицы, мы получили количество повторов в каждом локусе. Это было верно для всех локусов VNTR, за исключением VNTR61_01. Вышестоящая фланкирующая область этого локуса оказалась неоднородной по составу, в результате чего фрагменты были немного больше или меньше. Некоторые размеры бинов, используемых в программном обеспечении GeneMarker, были сдвинуты, чтобы соответствовать действительным размерам различных аллелей, что обеспечило точный расчет количества повторов в локусе VNTR61_01.Представители всех аллельных вариантов были секвенированы, чтобы гарантировать правильность определения количества повторов.

Анализ данных

Все данные набора были импортированы в программное обеспечение Bionumerics (прикладная математика), сгруппированы с использованием соответствующих настроек и взаимосвязей, отображаемых с использованием метода построения графиков, называемого минимальным остовным деревом, как описано ранее [34]. В минимальном связующем дереве было выбрано правило приоритета для первых типов ссылок, которые имеют наибольшее количество вариантов одного локуса.В дереве типы представлены кружками. В наших предпочтительных настройках размер круга указывает количество штаммов этого конкретного типа. Жирные короткие линии, соединяющие два типа, обозначают типы, отличающиеся одним локусом, тонкие более длинные линии соединяют варианты с двойным локусом. Комплексы MLVA создавались, если расстояние между соседними типами не превышало 1 и по крайней мере 5 типов удовлетворяли этому критерию. Для расчета генетического разнообразия и дискриминирующей способности типирования использовался индекс разнообразия Симпсона, где n i — количество штаммов, принадлежащих к типу i th , а N — общее количество штаммов в выборочной популяции [34 ], [40].

Статистический анализ проводился либо в Bionumerics, либо в StatsDirect v2.6.6 (StatsDirect Ltd., Чешир, Великобритания). В Bionumerics стабильность определенных групп рассчитывается с использованием статистического метода, называемого разделением групп. В этом методе используется метод складного ножа, при котором каждая запись берется из списка и идентифицируется по каждой группе. В этом исследовании это было сделано с использованием для идентификации среднего сходства каждой группы.

Секвенирование ДНК

Для реакций секвенирования ДНК использовали технологии BigDye Terminator и BigDye XTerminator (Applied Biosystems).Последовательности реакционных смесей анализировали на автоматическом секвенаторе ДНК ABI 3730.

Результаты

Проектирование и разработка MLVA для

S. aureus

На основе имеющихся последовательностей генома S. aureus были отобраны локусы VNTR и оценены для использования в MLVA. Были отобраны восемь локусов VNTR и проанализированы в 2 мультиплексных ПЦР. Пригодность была проверена с использованием набора из 96 штаммов, который включал 4 изолятов S. aureus , для которых был секвенирован геном (MW2, COL, N315, NCTC8325), 10 штаммов MRSA (5 пар), рассматриваемых как изоляты вспышек на основании их идентичных Профили PFGE, дата выделения и тот факт, что они были получены из одной и той же больницы, 72 случайно выбранных изолята MRSA, 5 изолятов MSSA и 5 метициллин-резистентных изолятов Staphylococcus epidermidis (MRSE) и 5 ​​метициллин-чувствительных S.epidermidis (MSSE). Все изоляты S. aureus дали продукты ПЦР, которые различались по размеру. Штаммы, из которых был секвенирован геном, дали ожидаемое количество повторов в различных локусах VNTR. Штаммы, принадлежащие к одной и той же вспышке, имели идентичные профили MLVA. Ни один из изолятов S. epidermidis не дал продуктов ПЦР с какой-либо из ПЦР VNTR.

Для определения стабильности локусов VNTR 5 изолятов S. aureus субкультивировали в течение 20 дней подряд, высевая одну колонию из каждого штамма на чашки с агаром.Из каждой субкультуры готовили суспензии и подвергали MLVA. Ни один из 8 локусов VNTR не был изменен во время серийного пассажа, что показывает, что по крайней мере в лабораторных условиях локусы VNTR были стабильными.

MLVA

изолятов S. aureus

MLVA была проведена на 1681 изолятах S. aureus , полученных от пациентов-людей. Все изоляты этого набора для проверки дали продукт ПЦР для всех локусов VNTR. Анализ состава 8 локусов VNTR S.Коллекция штаммов aureus показала, что разнообразие в количестве повторов варьировало среди различных локусов VNTR. Некоторые локусы несут большое количество повторов, например до 25 повторов в локусе VNTR09_01, в то время как другие локусы несут только ограниченное количество повторов, например VNTR61_02 с максимум 5 повторами (Таблица 1). Индексы разнообразия (DI) 8 различных локусов VNTR также значительно различались. Самый низкий DI (34,2%) был обнаружен для VNTR21_01, а самый высокий — для VNTR24_01 (83%), который представляет собой ген spa (Таблица 1).Всего среди 1681 изолятов S. aureus было обнаружено 511 различных типов MLVA. Профили MLVA были сгруппированы с использованием категориального коэффициента кластеризации, и было построено минимальное остовное дерево для отображения взаимосвязей между различными типами MLVA (рис. 2). Это выявило присутствие 11 различных комплексов MLVA, которым были присвоены сложные названия, например MC8 представляет собой комплекс MLVA 8. Из 1681 изолятов, использованных для исследования, 1473 (87,6%) входили в состав комплекса MLVA. Остальные 208 изолятов (12.4%) не были частью этих комплексов и им был присвоен код ближайшего комплекса MLVA (NMC), например NMC8 или 8, что указывает на наиболее близкий комплекс MLVA.

Рисунок 2. Минимальное остовное дерево изолятов 1681 S. aureus , типизированных методом MLVA.

Кластеризация профилей MLVA производилась с использованием категориального коэффициента. В минимальном остовном дереве типы MLVA отображаются кружками. Размер каждого кружка указывает количество изолятов этого конкретного типа. Толстые сплошные линии соединяют типы, которые различаются одним локусом VNTR, а тонкая сплошная линия соединяет типы, которые различаются 2 локусами VNTR.Цвет ореола, окружающий типы MLVA, обозначает типы, принадлежащие к одному и тому же комплексу. Комплексы MLVA назначались, если 2 соседних типа не различались более чем в 1 локусе VNTR и если этому критерию удовлетворяли не менее 5 типов. Комплексы MLVA также обозначаются буквами, например, MC8 обозначает комплекс MLVA 8.

https://doi.org/10.1371/journal.pone.0005082.g002

Большинство изолятов, включенных в это исследование, были MRSA (78,1%). Изоляты MSSA были обнаружены практически во всех комплексах MLVA.Однако комплексы MC100, MC15 и все 19 изолятов, которые были тесно связаны с MC15 (NMC15), полностью состояли из чувствительного к метициллину S. aureus . Кроме того, только 7,7% изолятов в комплексе MC7 MLVA были MRSA. Напротив, только 2 изолята (0,9%) в комплексе MC398 были MSSA (таблица 3). Для 1185 изолятов также было определено присутствие генов лейкоцидина Пантон-Валентайн (PVL) [41], и это показало, что 94,2% изолятов в MC80 были PVL-положительными (таблица 3). Два других комплекса MLVA, которые содержали значительное количество PVL-положительных изолятов, были MC30 (34.4%) и MC8 (17,8%).

Сравнение MLVA с

spa -последовательностью типирования и PFGE

Большое количество изолятов, ранее охарактеризованных с использованием типирования последовательности spa и / или PFGE, было использовано для оценки значения MLVA в качестве метода типирования для S. aureus . Spa — типирование последовательности было выполнено для 882 из 1681 изолята. Типы SpaTypes были сгруппированы с использованием подключаемого модуля spa в программном обеспечении Bionumerics, и результаты отображались в виде минимального связующего дерева.Минимальное остовное дерево (рис. 3) показало, что группировка по типу последовательности spa аналогична группировке, найденной с помощью MLVA. Одним из наиболее примечательных результатов было то, что изоляты, принадлежащие к MC7 и MC15, находились в одном кластере spa . Анализ PFGE был проведен на 1304 из 1681 изолята. Снова кластеризация на основе PFGE дала группировку, аналогичную группировке MLVA (рис. 4). Однако из-за небольших неточностей, присущих экспериментальным вариациям PFGE, группировка была не такой четкой, как при MLVA или spa -последовательности типирования.

Рисунок 3. Минимальное остовное дерево 882 изолятов S. aureus , типизированных с помощью spa -последовательного типирования.

SpaTypes отображаются в виде кружков. Описание символов, линий и т. Д. См. В легенде на рисунке 2. Кластеризация была выполнена с использованием спа-плагина Bionumerics с консервативной настройкой выравнивания 100% и максимальной длиной дублирования 0%. Ореолы, окружающие SpaTypes, указывают на связанные SpaTypes.

https://doi.org/10.1371/journal.pone.0005082.g003

Рис. 4. Минимальное остовное дерево 1304 изолятов S. aureus , типизированных с помощью PFGE.

Типы PFGE отображаются в виде кружков. Кластеризация проводилась с использованием коэффициента корреляции Пирсона и параметра оптимизации 2%. Полученная в результате матрица подобия использовалась для построения минимального остовного дерева с размером ячейки подобия 10%. Связанные ПФГЭ сгруппированы, и это обозначено двойным кружком (уплотненные комплексы). Комплекс MLVA обозначается цветом кружков (см. Рисунок 2), а также обозначается буквами.

https://doi.org/10.1371/journal.pone.0005082.g004

Для количественной оценки степени сходства в группировке, полученной с помощью трех методов, с помощью программного обеспечения Bionumerics определяли как соответствие между методами типизации, так и разделение групп. Соответствие методов типизации выводится из матриц сходства, которые создаются при анализе методов. Анализ с использованием коэффициента корреляции Пирсона показал, что соответствие между типированием последовательности spa и MLVA составило 62.7% для набора из 882 изолятов, типизированных обоими методами. Соответствие между PFGE и MLVA, выполненным на 1304 изолятах, было значительно ниже и составило 48,0%. Разделение групп рассчитывали по алгоритму Jackknife. В данном случае группы представлены 11 комплексами MLVA. Анализ показал, что 95,1% изолятов принадлежали к этим 11 группам, если для идентификации использовалось типирование последовательности spa . Разделение групп составляло 89,2%, если для характеристики изолятов использовался PFGE.Это указывает на то, что существует значительная степень сходства в группировке с использованием трех методов набора текста.

Индексы разнообразия MLVA, PFGE и

spa — типирование последовательности

Индексы разнообразия могут использоваться для оценки разнообразия бактериальной популяции. Однако индекс разнообразия также часто используется для обозначения дискриминирующей способности методов набора текста. Индекс разнообразия Симпсона был определен для всех изолятов, типизированных любым из 3 методов, и для 529 изолятов, для которых были выполнены все 3 метода типирования (таблица 4).Это показало, что MLVA и PFGE дали одинаковые DI 98,5% и 97,7% соответственно. DI типирования последовательности spa составлял 96,2% и, таким образом, несколько ниже, чем у MLVA и PFGE. Это предполагает относительно небольшую разницу между тремя методами набора текста. Однако, если число типов наносить на график в зависимости от кумулятивной доли изолятов в отобранной популяции, выявляется более выраженная разница между типами последовательностей MLVA, PFGE и spa (рис. 5). График выявил значительную разницу в дискриминирующей способности MLVA и PFGE по сравнению с типированием последовательности spa .В коллекции, отсортированной по частоте типов, 70% всех изолятов представляют 44 типа MLVA и 44 типа PFGE. Напротив, 70% всех изолятов представляют только 19 SpaTypes, что составляет менее половины от числа типов, полученных с помощью MLVA и PFGE. Более высокая дискриминационная сила MLVA также очевидна из того факта, что для типирования spa -sequence существует значительно больше изолятов одного типа, чем для MLVA (таблица 4).

Рисунок 5. Дискриминационная сила MLVA, spa -последовательности типирования и PFGE для S.aureus.

Разнообразие отображается как количество типов в зависимости от процента изолятов. Для получения графика список результатов типирования сначала был отсортирован по частоте, и было определено процентное соотношение изолятов по отношению к количеству типов. На графике показаны результаты только для 529 изолятов S. aureus , которые были проанализированы всеми тремя методами.

https://doi.org/10.1371/journal.pone.0005082.g005

Связь между MLVA и MLST

Четыре линии наблюдений подтверждают идею сильного согласия между группировками, созданными MLST и MLVA.(1) Прямое сравнение между MLST и MLVA на основе 40 изолятов, (2) косвенное сравнение MLVA с MLST на основе данных, полученных из базы данных Ridom, (3) косвенное доказательство того, что гены pvl присутствовали только в MC8, MC30 и MC80, (4) in silico анализ конгруэнтности с использованием 14 полностью секвенированных геномов.

Согласие между MLVA и MLST стало очевидным из сравнения результатов MLVA с результатами MLST, полученными для небольшого набора из 40 изолятов, для которых у нас также были доступны данные MLST, которые были ранее получены в нашем отделе.Это показало, что MLVA был более разборчивым, чем MLST, но, что более важно, только ST, принадлежащие к одному и тому же клональному комплексу MLST, были сгруппированы по MLVA (рис. 6)

Рисунок 6. Соответствие группировки, полученной MLVA и MLST.

Минимальное остовное дерево было построено на основе данных MLVA для 40 изолятов, для которых MLST уже был выполнен. Кружки представляют типы MLVA, а числа в кружках представляют ЗБ. Числа, отображаемые между типами, обозначают количество локусов VNTR, которые различаются между этими типами.Цвета представляют клональные комплексы MLST. Белые кружки — это ST, которые не были отнесены к конкретному клональному комплексу. Только варианты MLVA с одним или двумя локусами соединены линиями. Размер каждого кружка указывает количество изолятов с этим конкретным типом MLVA.

https://doi.org/10.1371/journal.pone.0005082.g006

Дополнительные доказательства соглашения между MLVA и MLST были получены косвенным образом. Была проведена инвентаризация моделей spa , которые присутствовали в различных комплексах MLVA.После этого был опрошен сервер Ridom Spa (http://spaserver2.ridom.de/mlst.shtml), чтобы выявить взаимосвязь между типом spa и типом последовательности (ST). Это выявило замечательное согласие между комплексами MLVA и клональными комплексами MLST. За исключением одного, каждый комплекс MLVA соответствовал определенному клональному комплексу MLST. По этой причине комплексы MLVA были названы по аналогии с клональными комплексами MLST, например. Комплекс MLVA MC8 состоит из изолятов, которые имеют spa -типы, принадлежащие к клональному комплексу CC8 MLST.Был большой комплекс MLVA, MC398, который не мог быть идентифицирован как соответствующий известному клональному комплексу MLST. Этот комплекс MLVA содержал все изоляты MRSA свиньи и поэтому был назван в честь доминантного типа последовательности MRSA свиньи ST398.

Строгое согласие между MLVA и MLST было дополнительно подтверждено наблюдением, что практически все PVL-положительные изоляты были обнаружены в MC80, MC30 и MC8. Это согласуется с выводом о том, что большинство PVL-положительных изолятов S. aureus принадлежат к клональным комплексам MLST CC80, CC30 и CC8 [42].

В качестве дополнительной попытки подтвердить возможную тесную взаимосвязь между MLVA и MLST был проведен анализ in silico 14 секвенированных геномов S. aureus . Типы последовательностей, профили MLVA и spa -типы были получены из последовательностей геномов, сгруппированы, а затем рассчитана конгруэнтность (фиг. 7). Это показало, что совпадение между MLST и MLVA составляет 86,5%. Соответствие 66,7% между типированием последовательности MLST и spa было значительно ниже, чем между MLST и MLVA.Для этого набора данных соответствие между MLVA и spa -последовательностью типирования составило 71,9%. Набор данных, полученных от этих 14 изолятов, слишком мал, чтобы делать однозначные выводы. Однако высокая степень соответствия между MLST и MLVA этого набора данных in silico предполагает высокую степень сходства между кластеризацией на основе MLST и MLVA.

Рис. 7. Анализ In silico 14 штаммов S. aureus , для которых была определена последовательность генома.

Штаммы

были сгруппированы на основе их полногеномной последовательности, профиля MLST, профиля MLVA и типа последовательности spa соответственно.

https://doi.org/10.1371/journal.pone.0005082.g007

MLVA изолятов MRSA свиньи

Приблизительно 12% штаммов, выделенных от людей, которые использовались для этого исследования, были скрининговыми культурами местного происхождения, то есть без госпитализации ни за границей, ни в Нидерландах, которые были взяты из-за контакта со свиньями. Эти так называемые свиньи MRSA принадлежали к одному комплексу MLVA, MC398. Вариабельность внутри этого комплекса очень низкая, индекс разнообразия составляет всего 72.1%. Используя MLVA, этот набор из 195 изолятов сравнивали с набором из 100 свиней MRSA, выделенных от свиней (фиг. 8). Как и ожидалось, MLVA не может отличить штаммы, выделенные от людей, от штаммов, выделенных от свиней. Было 2 доминирующих типа MLVA, которые представляли 2 доминирующих spa -типа t011 и t108. Изоляты с SpaType t1254 были того же типа MLVA, что и изоляты с SpaType t011. Учитывая, что между t011 и t1254 существует только одна разница в паре оснований, такое сходство неудивительно.Разница между доминирующими типами MLVA, представляющими изоляты с SpaTypes t011 и t108, вызвана исключительно наличием дополнительного spa repeat (r34) в t011. Этот дополнительный повтор приводит к единственному различию локусов между двумя основными типами MLVA.

Рис. 8. Минимальное остовное дерево из 295 изолятов MRSA свиней, типизированных с помощью MLVA.

Каждый кружок представляет тип MLVA. Оранжевые кружки или секторы кружков обозначают типы, полученные из 195 штаммов MRSA свиней, выделенных от человека.Профили MLVA 100 штаммов MRSA свиней, выделенных от свиней, показаны голубым цветом. Цифры в кружках обозначают типы SpaTypes и их частоту в пределах двух доминирующих типов MLVA.

https://doi.org/10.1371/journal.pone.0005082.g008

Потенциал MLVA для выявления вспышек

После проверки технических характеристик MLVA в нашей лаборатории, все изоляты, представленные в рамках национального надзора за MRSA в 2008 г., были охарактеризованы с помощью spa -последовательного типирования и MLVA.Это позволило нам сделать предварительную оценку эпидемиологического соответствия MLVA среди изолятов от пациентов с проксимальными временными и пространственными отношениями. Была включена выборка из 658 изолятов из больничных лабораторий, которые представили 30 или более изолятов в период с января по октябрь. Пространственно-временные кластеры были определены как изоляция 3 или более первичных изолятов от отдельных пациентов, пролеченных в одной больнице, в течение двухмесячного окна, отображающего один и тот же SpaType. Это выявило появление 38 пространственно-временных кластеров SpaType в 15 больничных лабораториях (Таблица 5).В 29 из 38 кластеров (76%) только один тип MLVA был обнаружен внутри кластера. Однако в 9 из 38 кластеров (24%) каждый кластер содержал 2 или 3 типа MLVA. В некоторых кластерах отклоняющийся тип MLVA представлял собой вариант MLVA с одним локусом (например, кластер 1 st в мае-июне, больница B). Это может означать изменение профиля MLVA в пределах одного и того же штамма. Однако в нескольких других Spa-кластерах были получены изоляты с профилями MLVA, которые различались по 3 локусам (например, 2 кластера st в мае-июне, больница B).Представляется весьма маловероятным, что изоляты, которые не соответствуют трем несвязанным генетическим локусам, могут считаться эпидемиологически связанными. Гораздо более вероятно, что типирование последовательности spa не позволило дифференцировать эти изоляты и, таким образом, неверно предположить эпидемиологическое родство. Это предварительное исследование показывает, что MLVA может быть более надежным средством выявления кластеров эпидемиологически связанных изолятов, которые могут представлять собой вспышку MRSA. Однако для оценки окончательной валидности MLVA как молекулярного эпидемиологического инструмента требуется тщательно спланированное исследование с подробными данными о перемещениях пациентов.

Обсуждение

В этом исследовании мы проверили недавно разработанный MLVA, используя коллекцию из 1681 штаммов S. aureus , выделенных от голландских пациентов. MLVA сравнивали с ранее полученными данными типирования последовательностей PFGE и spa , и это показало, что MLVA была, по крайней мере, столь же дискриминационной, как PFGE, давая 511 различных типов MLVA, что в два раза больше типов, чем типирование spa -sequence. MLVA дала однозначные числовые профили, представляющие количество повторов, присутствующих в 8 различных локусах VNTR в S.aureus геном. Профили MLVA, строки из 8 целых чисел, использовались для категориальной кластеризации изолятов, проанализированных в этом исследовании. Кластеризация дала 11 различных групп, которые мы обозначили как комплексы MLVA. Некоторые из этих комплексов состояли преимущественно только из MSSA, тогда как другие группы почти полностью состояли из MRSA. На уровне типирования наблюдалось умеренное соответствие типов между MLVA, spa, -последовательным типированием и PFGE. Совпадение между этими методами было намного выше на уровне групп со значениями разделения групп 95% для взаимосвязи между MLVA и spa -группировка по типу последовательности и 89% для MLVA и PFGE.Анализ набора из 40 изолятов, которые ранее были типизированы с помощью MLST, подтверждает высокую степень соответствия между MLVA и MLST. Кроме того, используя доступные данные о типировании последовательности spa , мы смогли показать, что было высокое согласие комплексов MLVA с клональными комплексами MLST. Однако необходимо будет проводить систематическое сравнение между MLVA и MLST, чтобы подтвердить установленную высокую степень согласия. Подготовка к такому сравнению в настоящее время продолжается.

В последние годы в Нидерландах появился возможный новый резервуар для MRSA.Имеются сообщения о том, что носительство MRSA через нос увеличилось у свиноводов, и что эти линии S. aureus являются общими для фермеров и их животных [43] — [45]. Этот родственный свинье MRSA, по-видимому, является клональным и идентифицирован MLST как последовательность типа 398 [8], [46]. MLVA этих штаммов ST-398, выделенных от людей и свиней, использовали для оценки возможных различий между изолятами человека и животных. Однако такие различия не были обнаружены, и MLVA выявила ту же степень дифференциации, что и типирование последовательности spa .Было 2 основных типа MLVA, которые представляли 2 доминирующих spa -типа t011 и t108, которые отличаются одним повтором.

Чтобы оценить потенциал MLVA как молекулярного эпидемиологического инструмента, MRSA, представленные в рамках национальной стратегии эпиднадзора в 2008 г., были просканированы на предмет пространственно-временных кластеров с неразличимыми SpaTypes. В этом наборе из 658 изолятов было идентифицировано тридцать восемь изолятов, 76% из которых были подтверждены идентичными кластерами MLVA-профилей. Более того, в 24% кластеров MLVA улучшило разрешение и еще больше различает SpaTypes.Это может быть связано с микроэволюцией локусов VNTR, но в случаях, когда 2 или 3 локуса VNTR различаются, более вероятно, что spa -последовательность, типизирующая неправильно сгруппированные штаммы, которые были различны в разных хромосомных положениях. Эти данные свидетельствуют о том, что MLVA может повысить микроэпидемиологическую точность, имеющую решающее значение для понимания распространения MRSA в определенных условиях больницы. Однако необходимы дополнительные исследования, подкрепленные подробными исследованиями контактов с пациентами, чтобы оценить весь потенциал этого метода как инструмента микроэпидемиологического типирования.

Для изучения эпидемиологии S. aureus использовалось множество различных методов генотипирования, и в течение многих лет PFGE был методом выбора из-за его дискриминирующей способности и относительно простого оборудования, необходимого для создания профилей PFGE [20], [21] ]. Однако основным недостатком PFGE является его низкая портативность, что делает его непригодным для межлабораторных сравнений. Разработка схемы MLST для S. aureus оказалась значительным улучшением [22].Его портативность и однозначность результатов, вероятно, делают MLST лучшим выбором для популяционного анализа эпидемиологических исследований. Однако высокие затраты, связанные с секвенированием 7 генов домашнего хозяйства для MLST, ограничивают его использование. Внедрение типирования последовательности spa оказалось весьма успешным [24]. При типировании последовательности spa требуется секвенирование только части одного гена. Это делает его портативным методом с однозначными результатами, который является гораздо более экономичным методом, чем MLST.Основным недостатком типирования последовательности spa является то, что изучается только один локус в геноме, и небольшое изменение, даже одна мутация, уже дает другой тип. Трудно интерпретировать значение такого изменения в его эволюционном контексте и в отсутствие более глобального взгляда на остальную часть генома. Изоляты S. aureus , которые различаются по одному или нескольким основаниям в локусе spa или даже по количеству повторяющихся единиц spa , могут представлять собой близкородственные штаммы или очень далекие.Использование нескольких геномных локусов, таких как MLST, обеспечивает более надежный подход. Гораздо более очевидна взаимосвязь между двумя изолятами, которые различаются только по одному из семи локусов. В то же время увеличение количества локусов также улучшает дискриминационную способность любой системы типирования. Как и MLST, MLVA использует несколько геномных локусов для генотипирования.

Представленная здесь схема MLVA — не первая зарегистрированная MLVA для S. aureus . Sabat et al. были первыми, кто описал MLVA на основе 5 различных локусов VNTR [47].Они проанализировали 34 изолята и обнаружили 26 различных типов и пришли к выводу, что их MLVA был таким же различающим и воспроизводимым, как PFGE. Однако их MLVA содержали VNTR с размером повтора всего 9 п.н., что делает невозможным точное определение размера полос на агарозных гелях. Кроме того, ПЦР на некоторых локусах, включенных в их MLVA, например, локус sdr дал множественные анонимные продукты ПЦР, из которых следует, что продукты ПЦР не могут быть отнесены к отдельным локусам VNTR.Таким образом, эта схема MLVA не могла решить генетические отношения. Результаты набора на основе анонимного рисунка полос, разрешенного в гелях агрозы, — как и PFGE — непереносимы и не дают однозначных результатов. Другие группы использовали схему типирования Sabat et al. или немного измененная схема [48] — [52]. Харди и др. [53], [54] описали использование VNTR, которые они, по не совсем понятным причинам, назвали стафилококковыми вкрапленными повторяющимися единицами (SIRU). Опять же размеры продуктов ПЦР были измерены на агарозном геле для расчета количества повторов на локус и в первом исследовании анализа 16 S.Изоляты aureus дали 11 различных типов. Во втором исследовании 116 изолятов дали 18 различных профилей SIRU. Недавно Ikawaty et al. [55] сообщили о применении слегка адаптированной версии MLVA Харди. Исследовали полиморфизм в 5 локусах VNTR с использованием коллекции из 150 изолятов и обнаружили 76 различных МТ. Часть их исследования была проведена с использованием изолятов от 6 вспышек. Однако эти вспышки были просто идентифицированы на основе идентичного фаготипирования и профилей PFGE, но не имели какого-либо эпидемиологического подтверждения.Примечательно, что профили MLVA показали неоднородность в 4 из 6 зарегистрированных вспышек.

Используя 2 мультиплексных ПЦР, MLVA 96 изолятов можно легко провести в течение одного дня при условии доступности оборудования для секвенирования. В нашей лаборатории стоимость расходных материалов для MLST-анализа одного штамма составляет примерно 70 евро. Стоимость последовательного типирования spa намного ниже — 9 евро за изолят, а затраты на MLVA еще ниже и составляют евро. 8. Это делает MLVA почти в 9 раз дешевле, чем MLST.Основным преимуществом MLVA перед типированием последовательности spa является простая кластеризация профилей MLVA по сравнению с SpaTypes. В кластеризации MLVA, которую мы использовали в этом исследовании, расстояние между типами выражается как количество различающихся локусов, а разница в количестве повторов не принимается во внимание. Сложный алгоритм, используемый для кластеризации SpaTypes, называется «основанный на повторяющемся шаблоне» (BURP) [56], [57]. Он использует множество различных параметров, таких как повтор-дупликация, повтор-вырезание и повтор-замена, но также были использованы события базовой вставки и удаления основания для расчета родства различных SpaTypes.Кроме того, он исключает SpaTypes, длина которых меньше 5 повторов. Достоверность использования этих параметров сомнительна, поскольку неизвестен механизм, управляющий изменением этого локуса, и часы эволюции. Кластеризация MLVA намного проще и похожа на метод, используемый для кластеризации профилей MLST. В MLVA локусы либо идентичны, либо разные, и не учитывается количество потерянных или полученных повторов.

Представленное здесь исследование было выполнено для проверки MLVA как нового метода типизации для S.aureus и, в частности, MRSA. Ван Белкум и др. [58] недавно опубликовали обзор, в котором они предоставили критерии для валидации метода типизации. В нашем исследовании мы продемонстрировали, что MLVA соответствует всем критериям эффективности, описанным в публикации Ван Белкума. Стабильность маркера в лабораторных условиях; среди 2515 S. aureus , включенных в исследование, не было нетипируемых изолятов. Тестовая популяция, выбранная для этого исследования, четко определена и, вероятно, составляет самую большую коллекцию, когда-либо использовавшуюся для такого анализа.Кроме того, было показано, что MLVA обладает высокой дискриминацией, а типирование — воспроизводимым и точным, что было подтверждено анализом последовательности всех аллельных вариантов. Эпидемиологическая достоверность была рассмотрена в предварительной оценке путем анализа изолятов с четкими пространственно-временными отношениями. MLVA оказался очень согласованным и может даже превзойти spa -последовательное типирование, хотя для подтверждения этого вывода потребуется более подробное исследование. Помимо критериев эффективности, MLVA, описанный в этом исследовании, также соответствует практически всем критериям удобства.Хотя праймеры для этого MLVA разработаны для использования только с S. aureus и не могут использоваться для других видов, сам метод является гибким и может использоваться для любых видов бактерий, несущих локусы VNTR. MLVA быстр, прост в использовании и отлично подходит для высокопроизводительного набора текста при относительно низких затратах. Он не требует экзотических реагентов или оборудования и поэтому доступен для любой лаборатории, оснащенной ПЦР-машинами и автоматическим секвенатором ДНК. Благодаря прямому компьютеризированному анализу, который приводит к однозначным числовым профилям, данные очень подходят для использования в электронных базах данных.

В заключение, MLVA, описанный в этом исследовании, представляет собой высокопроизводительный и относительно недорогой метод генотипирования, который дает однозначные данные, которые можно использовать для межлабораторных сравнений и для баз данных, доступных в Интернете. В настоящее время мы разрабатываем веб-платформу, на которой можно будет запрашивать базу данных со всеми известными профилями MLVA, обеспечивая единую номенклатуру для пользователей метода. Этот веб-сайт будет иметь функциональные возможности, аналогичные функциям веб-сайта MLST (www.mlst.net). Высокая пропускная способность и наблюдаемое сходство с группировкой MLST делают MLVA ценным методом типирования, который может позволить изучить эпидемиологию S. aureus на различных географических уровнях, и мы уверены, что его истинная ценность станет очевидной в подробных эпидемиологических исследованиях.

Благодарности

Мы благодарим голландские лаборатории медицинской микробиологии и больницы за отправку изолятов S. aureus для молекулярного типирования.Без их вклада это исследование было бы невозможно.

Вклад авторов

Задумал и спроектировал эксперименты: LMS. Проведены эксперименты: ЭКС МВЛ, ВНП МГВСВ. Проанализированы данные: LMS HG AJDN. Предоставленные реагенты / материалы / инструменты для анализа: XWH HGJVdH MEOCH. Написал статью: LMS.

Ссылки

  1. 1.
    Эмори Т.Г., Гейнес Р.П. (1993) Обзор внутрибольничных инфекций, включая роль микробиологической лаборатории.Clin Microbiol Rev 6: 428–442.
  2. 2.
    Steinberg JP, Clark CC, Hackman BO (1996) Нозокомиальные и внебольничные бактериемии Staphylococcus aureus с 1980 по 1993 год: влияние внутрисосудистых устройств и резистентность к метициллину. Clin Infect Dis 23: 255–259.
  3. 3.
    Tiemersma EW, Bronzwaer SL, Lyytikainen O, Degener JE, Schrijnemakers P, et al. (2004) Метициллин-устойчивый Staphylococcus aureus в Европе, 1999–2002 гг. Emerg Infect Dis 10: 1627–1634.
  4. 4.
    Панлилио А.Л., Калвер Д.Х., Гейнес Р.П., Банерджи С., Хендерсон Т.С. и др. (1992) Метициллин-устойчивый Staphylococcus aureus в больницах США, 1975–1991. Инфекционный контроль Hosp Epidemiol 13: 582–586.
  5. 5.
    Спеллер Д.К., Джонсон А.П., Джеймс Д., Марплс Р.Р., Чарлетт А. и др. (1997) Устойчивость к метициллину и другим антибиотикам в изолятах Staphylococcus aureus из крови и спинномозговой жидкости, Англия и Уэльс, 1989–95.Ланцет 350: 323–325.
  6. 6.
    Wertheim HF, Vos MC, Boelens HA, Voss A, Vandenbroucke-Grauls CM и др. (2004) Низкая распространенность метициллин-устойчивого Staphylococcus aureus (MRSA) при госпитализации в Нидерландах: значение поиска и уничтожения и ограничительного использования антибиотиков. J Hosp Infect 56: 321–325.
  7. 7.
    ван Трайп М.Дж., Меллес Д.К., Хендрикс В.Д., Парлевлит Г.А., Гомманс М. и др. (2007) Успешный контроль широко распространенной колонизации и инфекции метициллин-устойчивого Staphylococcus aureus в большой клинической больнице в Нидерландах.Инфекционный контроль Hosp Epidemiol 28: 970–975.
  8. 8.
    де Нилинг AJ, ван ден Брук MJ, Spalburg EC, van Santen-Verheuvel MG, Dam-Deisz WD, et al. (2007) Высокая распространенность метициллин-устойчивого Staphylococcus aureus у свиней. Vet Microbiol 122: 366–372.
  9. 9.
    де Нилинг AJ, ван Лиувен WJ, Schouls LM, Schot CS, van Veen-Rutgers A, et al. (1998) Устойчивость стафилококков в Нидерландах: наблюдение с помощью электронной сети в 1989–1995 гг.J Antimicrob Chemother 41: 93–101.
  10. 10.
    Williams RERJ, Dowsett LM (1953) Бактериофаговое типирование штаммов Staphylococcus aureus из различных источников. Ланцет 14: 510–514.
  11. 11.
    Hadorn K, Lenz W, Kayser FH, Shalit I., Krasemann C (1990) Использование зонда гена рибосомной РНК для эпидемиологического исследования устойчивости к метициллину и ципрофлоксацину Staphylococcus aureus . Eur J Clin Microbiol Infect Dis 9: 649–653.
  12. 12.van Belkum A, Bax R, Prevost G (1994) Сравнение четырех анализов генотипирования для эпидемиологического исследования метициллин-устойчивого Staphylococcus aureus . Eur J Clin Microbiol Infect Dis 13: 420–424.
  13. 13.
    Дамиани Г., Телекко С., Коминчини С., Сирони М., Карретто Е. и др. (1996) Сравнение улучшенного снятия отпечатков пальцев RAPD с различными методами типирования для различения клинических изолятов Staphylococcus spp. Eur J Epidemiol 12: 163–169.
  14. 14.
    Gurtler V, Barrie HD (1995) Типирование штаммов Staphylococcus aureus с помощью ПЦР-амплификации спейсерных областей 16S-23S рДНК переменной длины: характеристика спейсерных последовательностей. Microbiology 141 (Pt 5): 1255–1265.
  15. 15.
    Deplano A, Vaneechoutte M, Verschraegen G, Struelens MJ (1997) Типирование штаммов Staphylococcus aureus и Staphylococcus epidermidis с помощью ПЦР-анализа полиморфизмов длины спейсера между IS256.J Clin Microbiol 35: 2580–2587.
  16. 16.
    Grady R, Desai M, O’Neill G, Cookson B, Stanley J (1999) Генотипирование эпидемических метициллин-устойчивых изолятов Staphylococcus aureus фага типа 15 с помощью флуоресцентного анализа полиморфизма длины амплифицированных фрагментов. J Clin Microbiol 37: 3198–3203.
  17. 17.
    Меллес Д.К., ван Леувен В.Б., Снайдерс С.В., Хорст-Крефт Д., Петерс Дж.К. и др. (2007) Сравнение мультилокусного типирования последовательностей (MLST), гель-электрофореза в импульсном поле (PFGE) и полиморфизма длины амплифицированных фрагментов (AFLP) для генетического типирования Staphylococcus aureus .J Microbiol Methods 69: 371–375.
  18. 18.
    Катаяма Й., Ито Т., Хирамацу К. (2000) Новый класс генетического элемента, кассетная хромосома стафилококка mec, кодирует устойчивость к метициллину у Staphylococcus aureus . Антимикробные агенты Chemother 44: 1549–1555.
  19. 19.
    Стивенс AJ, Huygens F, Giffard PM (2007) Систематическое получение наборов маркеров для механического типирования хромосом стафилококковой кассеты. Антимикробные агенты Chemother 51: 2954–2964.
  20. 20.Ichiyama S, Ohta M, Shimokata K, Kato N, Takeuchi J (1991) Фингерпринт геномной ДНК с помощью гель-электрофореза в импульсном поле в качестве эпидемиологического маркера для изучения внутрибольничных инфекций, вызванных метициллин-резистентным стафилококком Staphylococcus aureus . J Clin Microbiol 29: 2690–2695.
  21. 21.
    Куксон Б.Д., Робинсон Д.А., Монк А.Б., Мурчан С., Деплано А. и др. (2007) Оценка методов молекулярного типирования для характеристики европейской коллекции эпидемических метициллин-устойчивых штаммов Staphylococcus aureus : коллекция HARMONY.J Clin Microbiol 45: 1830–1837.
  22. 22.
    Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG (2000) Мультилокусное типирование последовательностей для характеристики метициллин-устойчивых и метициллин-чувствительных клонов Staphylococcus aureus . J Clin Microbiol 38: 1008–1015.
  23. 23.
    Frenay HM, Theelen JP, Schouls LM, Vandenbroucke-Grauls CM, Verhoef J, et al. (1994) Различение эпидемических и неэпидемических метициллин-устойчивых штаммов Staphylococcus aureus на основе полиморфизма гена протеина А.J Clin Microbiol 32: 846–847.
  24. 24.
    Хармсен Д., Клаус Н., Витте В., Ротгангер Дж., Тернвальд Д. и др. (2003) Типирование метициллин-устойчивого Staphylococcus aureus в условиях университетской больницы с использованием нового программного обеспечения для определения повторения спа-процедур и управления базами данных. J Clin Microbiol 41: 5442–5448.
  25. 25.
    Coletta-Filho HD, Takita MA, de Souza AA, Aguilar-Vildoso CI, Machado MA (2001) Дифференциация штаммов Xylella fastidiosa с помощью анализа переменного количества тандемных повторов.Appl Environ Microbiol 67: 4091–4095.
  26. 26.
    Фарлоу Дж., Постик Д., Смит К.Л., Джей З., Барантон Дж. И др. (2002) Типирование штаммов Borrelia burgdorferi , Borrelia afzelii и Borrelia garinii с использованием анализа тандемных повторов с несколькими локусами с переменным числом переменных. J Clin Microbiol 40: 4612–4618.
  27. 27.
    Фарлоу Дж., Смит К.Л., Вонг Дж., Абрамс М., Литл М. и др. (2001) Francisella tularensis типирование штамма с использованием тандемного анализа множественных локусов и переменных чисел.J Clin Microbiol 39: 3186–3192.
  28. 28.
    Frothingham R, Meeker-O’Connell WA (1998) Генетическое разнообразие в комплексе Mycobacterium tuberculosis на основе переменного количества тандемных повторов ДНК. Microbiology 144 (Pt 5): 1189–1196.
  29. 29.
    Кейм П., Клевицкая А.М., Прайс Л. Б., Шупп Дж. М., Зинзер Г. и др. (1999) Молекулярное разнообразие Bacillus anthracis . J Appl Microbiol 87: 215–217.
  30. 30.
    Клевицкая А.М., Прайс Л.Б., Шупп Дж.М., Уоршам П.Л., Вонг Дж. И др.(2001) Идентификация и характеристика тандемных повторов с переменным числом в геноме Yersinia pestis . J Clin Microbiol 39: 3179–3185.
  31. 31.
    Лю Й., Ли М.А., Оои Е.Е., Мавис Й., Тан А.Л. и др. (2003) Молекулярное типирование изолятов серовара typhi Salmonella enterica из разных стран Азии с помощью мультиплексной ПЦР на тандемных повторах с переменным числом. J Clin Microbiol 41: 4388–4394.
  32. 32.
    Pourcel C, Vidgop Y, Ramisse F, Vergnaud G, Tram C (2003) Характеристика полиморфизма тандемных повторов в Legionella pneumophila и его использование для генотипирования.J Clin Microbiol 41: 1819–1826.
  33. 33.
    Schouls LM, van der Ende A, Damen M, van de Pol I (2006) Анализ тандемных повторов с переменным числом множественных локусов у Neisseria meningitidis
    дает группировки, аналогичные группировкам, полученным с помощью мультилокусного типирования последовательностей. J Clin Microbiol 44: 1509–1518.
  34. 34.
    Schouls LM, van der Ende A, van de Pol I, Schot C, Spanjaard L, et al. (2005) Увеличение генетического разнообразия штаммов Haemophilus influenzae серотипа b (Hib) после внедрения вакцинации против Hib в Нидерландах.J Clin Microbiol 43: 2741–2749.
  35. 35.
    Schouls LM, van der Heide HG, Vauterin L, Vauterin P, Mooi FR (2004) Анализ тандемных повторов с несколькими локусами с переменным числом голландских штаммов Bordetella pertussis показывает быстрые генетические изменения с клональной экспансией в конце 1990-х годов. J Bacteriol 186: 5496–5505.
  36. 36.
    Top J, Schouls LM, Bonten MJ, Willems RJ (2004) Анализ тандемных повторов с переменным числом множественных локусов, новая схема типирования для изучения генетического родства и эпидемиологии изолятов Enterococcus faecium .J Clin Microbiol 42: 4503–4511.
  37. 37.
    ван Белкум А., Шерер С., ван Леувен В., Виллемсе Д., ван Альфен Л. и др. (1997) Переменное количество тандемных повторов в клинических штаммах Haemophilus influenzae . Инфекция иммунной 65: 5017–5027.
  38. 38.
    Малви М.Р., Чуй Л., Исмаил Дж., Луи Л., Мерфи С. и др. (2001) Разработка канадского стандартизированного протокола для определения подтипов метициллин-устойчивого Staphylococcus aureus с использованием гель-электрофореза в импульсном поле.J Clin Microbiol 39: 3481–3485.
  39. 39.
    Benson G (1999) Поиск тандемных повторов: программа для анализа последовательностей ДНК. Nucleic Acids Res 27: 573–580.
  40. 40.
    Симпсон Э. (1949) Измерение разнообразия. Природа 163: 688.
  41. 41.
    Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, et al. (1999) Вовлечение лейкоцидин-продуцента Panton-Valentine Staphylococcus aureus в первичные кожные инфекции и пневмонию. Clin Infect Dis 29: 1128–1132.
  42. 42.
    Ванденеш Ф., Наими Т., Энрайт М.С., Лина Дж., Ниммо Г.Р. и др. (2003) Внебольничный устойчивый к метициллину Staphylococcus aureus , несущий гены лейкоцидинов Пантона-Валентайна: появление во всем мире. Emerg Infect Dis 9: 978–984.
  43. 43.
    Armand-Lefevre L, Ruimy R, Andremont A (2005) Клональное сравнение изолятов Staphylococcus aureus от здоровых свиноводов, контрольных людей и свиней. Emerg Infect Dis 11: 711–714.
  44. 44.Витте В., Стромменгер Б., Станек С., Куни С. (2007) Метициллин-устойчивый Staphylococcus aureus ST398 у людей и животных, Центральная Европа. Emerg Infect Dis 13: 255–258.
  45. 45.
    Huijsdens XW, van Dijke BJ, Spalburg E, van Santen-Verheuvel MG, Heck ME и др. (2006) Приобретенный сообществом MRSA и свиноводство. Энн Клин Микробиол Антимикроб 5: 26
  46. 46.
    ван Белкум А., Меллес Д.К., Петерс Дж.К., ван Леувен В.Б., ван Дуйкерен Э. и др.(2008) Устойчивый к метициллину и чувствительный к метициллину Staphylococcus aureus Тип последовательности 398 у свиней и людей. Emerg Infect Dis 14: 479–483.
  47. 47.
    Сабат А., Кшиштон-Руссьян Дж., Стшалка В., Филипек Р., Косовска К. и др. (2003) Новый метод типирования штаммов Staphylococcus aureus : тандемный анализ полиморфизма и генетических взаимоотношений клинических изолятов по множеству локусов с переменным числом тандемных повторов. J Clin Microbiol 41: 1801–1804.
  48. 48.
    Gilbert FB, Fromageau A, Gelineau L, Poutrel B (2006) Дифференциация изолятов крупного рогатого скота Staphylococcus aureus с использованием полиморфного тандемного повторного типирования.Vet Microbiol 117: 297–303.
  49. 49.
    Francois P, Huyghe A, Charbonnier Y, Bento M, Herzig S, et al. (2005) Использование автоматизированного метода множественных локусов с переменным числом тандемных повторов для быстрого и высокопроизводительного генотипирования изолятов Staphylococcus aureus . J Clin Microbiol 43: 3346–3355.
  50. 50.
    Tenover FC, Vaughn RR, McDougal LK, Fosheim GE, McGowan JE Jr (2007) Анализ тандемных повторов с множественными локусами и переменным числом метициллин-устойчивых штаммов Staphylococcus aureus .J Clin Microbiol 45: 2215–2219.
  51. 51.
    Collery MM, Smyth DS, Twohig JM, Shore AC, Coleman DC и др. (2008) Молекулярное типирование изолятов носительства из носа Staphylococcus aureus из популяции студентов ирландского университета на основе ПЦР токсинового гена, типов локусов agr и множественного локуса, анализа тандемных повторов с переменным числом тандемных повторов. J Med Microbiol 57: 348–358.
  52. 52.
    Малахова Н., Сабат А., Гнядковски М., Кшиштон-Руссьян Дж., Эмпель Дж. И др. (2005) Сравнение анализа тандемных повторов с переменным числом множественных локусов с гель-электрофорезом в импульсном поле, спа-типированием и мультилокусным типированием последовательностей для клональной характеристики изолятов Staphylococcus aureus .J Clin Microbiol 43: 3095–3100.
  53. 53.
    Hardy KJ, Ussery DW, Oppenheim BA, Hawkey PM (2004) Распределение и характеристика стафилококковых вкрапленных повторяющихся единиц (SIRU) и потенциальное использование для дифференциации штаммов. Микробиология 150: 4045–4052.
  54. 54.
    Hardy KJ, Oppenheim BA, Gossain S, Gao F, Hawkey PM (2006) Использование вариаций в стафилококковых вкрапленных повторяющихся единицах для молекулярного типирования метициллин-устойчивых штаммов Staphylococcus aureus.J Clin Microbiol 44: 271–273.
  55. 55.
    Ikawaty R, Willems RJ, Box AT, Verhoef J, Fluit AC (2008) Новый метод тандемно-повторяющегося анализа множественных локусов с переменным числом переменных для быстрого молекулярного типирования золотистого стафилококка человека. J Clin Microbiol 46: 3147–3151.
  56. 56.
    Меллманн А., Венигер Т., Берсенбрюгге С., Ротгангер Дж., Саммет М. и др. (2007) На основе повторяющегося паттерна (BURP): алгоритм для характеристики долгосрочной эволюции популяций Staphylococcus aureus на основе спа-полиморфизма.BMC Microbiol 7: 98
  57. 57.
    Стромменгер Б., Кеттлитц С., Венигер Т., Хармсен Д., Фридрих А.В. и др. (2006) Отнесение изолятов Staphylococcus к группам с помощью спа-типирования, макрорестрикционного анализа SmaI и мультилокусного типирования последовательностей. J Clin Microbiol 44: 2533–2540.
  58. 58.
    ван Белкум А., Тассиос П.Т., Дейксхорн Л., Хэггман С., Куксон Б. и др. (2007) Руководство по валидации и применению методов типирования для использования в бактериальной эпидемиологии.Clin Microbiol Infect 13: Suppl 31–46.

.

Добавить комментарий

Ваш адрес email не будет опубликован.