Электрофорез с дексаметазоном: Роль электрофореза противовоспалительных средств в лечении увеитов

Содержание

Роль электрофореза противовоспалительных средств в лечении увеитов

Введение

Увеиты являются актуальной проблемой практической офтальмологии в связи с их широкой распространенностью, хроническим рецидивирующим течением, развитием многочисленных осложнений [1, 4, 7]. При переохлаждении, нарушениях обмена веществ, иммунитета и аутоиммунных процессах сосудистая оболочка глаза часто вовлекается в воспалительный процесс. Преимущественно возникает поражение лиц молодого, трудоспособного возраста. Инвалидизация и временная нетрудоспособность при длительном течении и рецидивах заболевания определяют высокую социальную значимость проблемы [1, 5]. В общей структуре заболеваний глаз увеиты составляют 7–30 % и в 5–18 % случаев являются причиной слепоты [4]. Одним из наиболее распространенных осложнений увеитов является макулярный отек, который становится частой причиной как обратимого, так и стойкого снижения остроты зрения. Разрушение цитокинами гематоретинального барьера ведет к просачиванию жидкости в межклеточное пространство, где она накапливается в наружном плексиформном и внутреннем ядерном слоях вокруг фовеа. Это заметно на снимках оптической когерентной томографии (ОКТ) в виде увеличения толщины сетчатки как проявления воспалительного процесса. Так как толщина сетчатки в большей степени коррелирует с остротой зрения, для оценки объективной динамики течения заболевания используются снимки ОКТ [3, 6–8]. Персистирующий макулярный отек может приводить к необратимому разрушению связей между нейронами сетчатки, развитию глиоза или атрофии, что заканчивается стойкой потерей зрения. В то же время транзиторный отек макулы часто разрешается благоприятно, а острота зрения восстанавливается [9, 10]. Обычно для лечения увеита назначают местные инъекции стероидов (периокулярные или интравитреальные). Однако некоторым пациентам, страдающим увеитом или панувеитом, может потребоваться длительная иммуносупрессивная и противовоспалительная терапия в виде системного применения кортикостероидов [9, 10]. Альтернативой этой терапии может служить введение методом электрофореза Дексаметазона ВФЗ и Ципронекса®. Дексаметазон оказывает противовоспалительное, антиаллергическое и иммуносупрессивное действие, влияет на все фазы воспалительного процесса, уменьшает проницаемость сосудов, угнетает миграцию лейкоцитов, фагоцитоз, высвобождает кинины и способствует образованию антител [10]. Ципронекс®, антибиотик класса фторхинолонов, обладает бактерицидным действием, влияет на синтез ДНК бактерий, что реализуется благодаря угнетению ДНК-гиразы, демонстрирует высокую эффективность по отношению к основным возбудителям бактериальных инфекций. Препарат обладает высокой антибактериальной активностью, низкой частотой резистентности основных возбудителей увеитов. 

Цель: изучить терапевтическую эффективность электрофореза Ципронекса® и Дексаметазона ВФЗ в комплексной терапии больных увеитами (передними и задними). 

Материал и методы

Под наблюдением в отделении воспалительной патологии глаз ГУ «Институт глазных болезней и тканевой терапии им. В.П. Филатова НАМН Украины» находились 67 пациентов от 18 до 62 лет с диагнозом «увеит (передний и задний) различной этио–логии», средний возраст которых составил 31,2 ± 15,7 года; женщин среди них было 25 (37,3 %), мужчин — 42 (62,6 %). Исследовались острота зрения, поля зрения, внутриглазное давление, проводились ОКТ, биомикроскопия, офтальмоскопия. О наличии макулярного отека можно было говорить в случае увеличения толщины сетчатки в фовеа более 230 μm. Пациенты были рандомизированы на две группы: одна группа больных (30 человек) получала системную противовоспалительную, иммуносупрессивную терапию, а пациентам второй группы (37 человек) был применен электрофорез Ципронекса® и Дексаметазона ВФЗ. Трансорбитальный электрофорез: активный электрод — в виде ванночки, добавляли 2–3 мл 2% раствора хлористого кальция, 1,0 мл Ципронекса®, 1,0 мл Дексаметазона ВФЗ. Анод позитивный. Сила тока постепенно возрастала с 0,3–0,5–0,8 mА до 1 mА; 3 мин — 5 мин — 8–10 мин. Индифферентный электрод с гидрофильной прокладкой находился в воротниковой зоне. Эндоназальный электрофорез: активный электрод в виде носовой турунды (1,0 мл Ципронекса®, 1,0 мл Дексаметазона ВФЗ). Анод позитивный. Сила тока возрастала с 0,3–0,5–0,8 до 1 mА; 3 мин — 5 мин — 10 мин. Срок наблюдения составил 3 месяца.

Статистическую обработку полученных данных проводили с помощью программы Statistica 7.0, используя параметрический критерий Стьюдента для попарного сравнения двух групп и предварительной оценки нормальности распределения, критерия Крускалла — Уоллиса в случае одномоментного сравнения более чем двух групп, а также критерия ранговой корреляции Спирмена [2].

Результаты и их обсуждение

Под воздействием проведенного лечения стихание признаков воспаления наблюдалось к 4–5-м суткам от начала лечения. Так как сроки наблюдения за пациентами составили 3 месяца, нами представлены результаты, полученные по истечении этого срока, в сравнении с исходными. Данные динамики остроты зрения и полей зрения, полученные в результате наблюдения, представлены в табл. 1.

В результате проведенного лечения наблюдалась не только стабилизация зрительных функций, но и их повышение в обеих группах. Острота зрения достоверно повысилась в 3,5 раза в группе с использованием электрофореза Дексаметазона ВФЗ и Ципронекса® в результате резорбции макулярного отека. 

У большинства пациентов с передними и задними увеитами были диагностированы изменения показателей толщины сенсорной части сетчатки. При изучении морфометрических показателей по данным ОКТ в различных зонах глазного дна в группе пациентов, получавших противовоспалительную и иммуносупрессивную терапию без электрофореза (срок наблюдения 3 месяца), были определены значения, представленные в табл. 2.

Анализ данных, представленных в табл. 2, показал, что под воздействием лечения при переднем увеите средняя толщина сенсорной части сетчатки в фовеолярной зоне уменьшилась с 295,2 ± 13,7 до 197,4 ± ± 38,5 μm, в парафовеолярной — с 389,2 ± 13,4 до 312,5 ± 25,3 μm, в перипапиллярной зоне — с 453,3 ± ± 21,9 до 347,7 ± 61,8 μm. Исследовалась толщина нервных волокон в локусах максимальной толщины на расстоянии в среднем 200–220 μm от фовеа. Под влиянием лечения при заднем увеите средняя толщина сенсорной части сетчатки в фовеолярной зоне уменьшилась с 357,5 ± 16,1 до 252,1 ± 12,2 μm, в парафовеолярной — с 412,4 ± 15,6 до 377,4 ± 19,9 μm, в перипапиллярной зоне — с 489,4 ± 76,2 до 440,8 ± 64,9 μm.

Морфометрические показатели по данным ОКТ в группе пациентов, получавших противовоспалительную и иммуносупрессивную терапию с электрофорезом Дексаметазона ВФЗ и Ципронекса® (срок наблюдения — 3 месяца), представлены в табл. 3.

Анализ данных, представленных в табл. 3, показал, что под влиянием лечения при переднем увеите средняя толщина сенсорной части сетчатки в фовеолярной зоне уменьшилась с 298,7 ± 18,4 до 186,1 ± 23,3 μm, в парафовеолярной — с 398,3 ± 11,2 до 310,1 ± 21,1 μm, в перипапиллярной зоне — с 468,2 ± 20,7 до 324,1 ± ± 35,2 μm. Под влиянием лечения при заднем увеите средняя толщина сенсорной части сетчатки в фовеолярной зоне уменьшилась с 376,1 ± 12,4 до 223,2 ± ± 11,5 μm, в парафовеолярной — с 432,4 ± 25,3 до 343,2 ± 11,1 μm, в перипапиллярной зоне — с 499,4 ± 87,6 до 420,1 ± 46,4 μm. 

Парафовеолярно толщина сетчатки во время воспаления в обеих группах увеличена на 23,4–55 % (р = 0,001), перипапиллярно — на 6–28 % (р = 0,0001) за счет макулярного отека и нарушения архитектоники сетчатки вследствие экссудации, инфильтрации, а также начального рассасывания экссудата, формирования рубцовых изменений. При передних увеитах после окончания срока наблюдения в обеих группах больных наблюдается истончение сенсорной части в перипапиллярной, парафовеолярной и фовеолярной зонах сетчатки. Уменьшение толщины сетчатки наиболее выражено в группе с использованием электрофореза Дексаметазона ВФЗ и Ципронекса® в зоне фовеа — на 38,8–45,6 % (р = 0,0001), что клинически выражается в уменьшении кистозного и диффузного макулярного отека и повышении остроты зрения. При очаговом и диссеминированном хориоретините (заднем увеите) в период ремиссии показатели толщины сенсорной части сетчатки в области фовеа уменьшились на 38,5 % (р = 0,001), что связано с остатками диффузного отека, возникновением вторичного дистрофического процесса в сетчатке в результате воспаления. Значительной разницы между группами по количеству пациентов с положительной клинической динамикой не было. Клиническое улучшение наблюдалось в 86,6 % случаев (26 глаз) в группе системной терапии и в 91,8 % случаев (34 глаза) в группе с использованием помимо системной терапии электрофореза Ципронекса® и Дексаметазона ВФЗ, p = 0,20. При переднем увеите это выражалось в рассасывании экссудата, прецепитатов, уменьшении плавающих помутнений в стекловидном теле. При заднем увеите произошло рассасывание кровоизлияний, экссудата у очагов, резорбция очагов, а полная резорбция макулярного отека наблюдалась в 52 % случаев в группе системной терапии и в 78 % случаев в группе с электрофорезом Дексаметазона ВФЗ и Ципронекса®, p = 0,02. 

Таким образом, в контроле динамики лечения передних и задних увеитов независимо от этиологии особую роль играет ОКТ, позволяя объективно анализировать состояние макулярной зоны, контролировать макулярный отек и при необходимости своевременно назначать профилактическую терапию. Использование в комплексном лечении электрофореза Ципронекса® и Дексаметазона ВФЗ у больных увеитами независимо от этиологии процесса способствует исчезновению признаков воспаления, стабилизации зрительных функций, повышению остроты зрения в 3,5 раза и расширению поля зрения. Подводя итог вышесказанному, можно отметить, что улучшение состояния сетчатки и остроты зрения отмечалось более чем у двух третей пациентов, получавших системную терапию и электрофорез Дексаметазона ВФЗ и Ципронекса®. При этом физиотерапевтическое введение методом электрофореза Дексаметазона ВФЗ и Ципронекса® сопровождалось более выраженной резорбцией отека и уменьшением толщины сетчатки. К концу периода наблюдения улучшение состояния сетчатки и полная резорбция отека отмечались в 78 % случаев. При передних увеитах после окончания срока наблюдения в обеих группах больных отмечалось истончение сенсорной части в перипапиллярной, парафовеолярной и фовеолярной зонах сетчатки. Уменьшение толщины сетчатки было наиболее выражено в группе с использованием электрофореза Дексаметазона ВФЗ и Ципронекса® в зоне фовеа — на 38,8–45,6 % (р = 0,0001), что клинически выражается в уменьшении кистозного и диффузного макулярного отека и повышении остроты зрения. При очаговом и диссеминированном хориоретините (заднем увеите) в период ремиссии показатели толщины сенсорной части сетчатки в области фовеа уменьшились на 38,5 % (р = 0,001), что связано с остатками диффузного отека, возникновением вторичного дистрофического процесса в сетчатке в результате воспаления.

Выводы

1. Электрофорез Ципронекса® и Дексаметазона ВФЗ у больных увеитами независимо от этиологии процесса способствует исчезновению признаков воспаления, стабилизации зрительных функций, повышению остроты зрения в 3,5 раза и расширению поля зрения. Полная резорбция макулярного отека наблюдалась в 52 % случаев в группе системной терапии и в 78 % случаев в группе с электрофорезом Дексаметазона ВФЗ и Ципронекса®, p = 0,02.

2. Электрофорез Ципронекса® и Дексаметазона ВФЗ хорошо переносится больными и может быть использован в лечении увеитов независимо от этиологии.

Bibliography

1. Авдеева О.Н. Клиническое использование оптической когерентной томографии в оценке ультраструктурных изменений сетчатки на фоне комплексного лечения хориоретинитов различной этиологии / О.Н. Авдеева, Н.Г. Варнавская, М.Ю. Прокопьева // Мат-лы XVI науч.-практ. конф. офтальмологов. — Екатеринбург, 2008. — С. 7-9.

2. Гланц С. Медико-биологическая статистика: Пер. с англ. / С. Гланц. — М.: Практика, 1998. — 459 с.

3. Иваницкая Е.В. Оптическая когерентная томо–графия в диагностике состояния макулярной области сетчатки / Е.В. Иваницкая // Офтальмол. журн. — 2007. — № 5. — С. 71-73.

4. Катаргина Л.A., Хватова А.В. Эндогенные увеиты у детей и подростков / Л.А. Катаргина, А.В. Хватова. — М.: Медицина, 2000. — 320 с.

5. Коновалова Н.В. Изучение состояния сенсорной части сетчатки и сосудистой оболочки глаза у больных увеитами по данным оптической когерентной томо-графии / Н.В. Коновалова, Н.И. Храменко, Шайби Абдеррахим, Е.В. Иваницкая, Н.И. Нарицына // Офтальмологический журнал. — 2014. — № 3. — С. 34-41. 

6. Свирин A.B. Спектральная оптическая когерент-ная томография: принципы и возможности метода / A.B. Свирин, Ю.И. Кийко, Б.В. Обруч, A.B. Богомолов // Клинич. офтальмология. — 2009. — Т. 10, № 2. — С. 50-53.

7. Щуко А.Г. Восьмилетний опыт использования оптической когерентной томографии в офтальмологии / А.Г. Щуко, А.С. Алпатов, С.И. Жукова // Вестник офтальмологии. — 2006. — № 3. — С. 34-36.

8. Alamouti В. Retinal thickness decreases with age: an OCT study / B. Alamouti, J. Funk // Brit. J. Ophthalmol. — 2003. — Vol. 87, № 7. — P. 899-901.

9. Atmaca L. Optical coherence tomography in inflammatory CMV / L. Atmaca, K. Sonmez // 10th International Ocular Inflammation Society (IOIS) Congress: Abstract book. — Prague, 2009. — P. 16.

10. Tomkins-Netzer S., Lightman L. Drye et al. Outcome of treatment of uveitic macular edema. The multicenter uveitis steroid treatment trial: 2-year results // Ophthalmo–logy. — 2015. — Vol. 122. — P. 2351-2359.   

Лекарственные препараты для электрофореза — physiotherapy.ru













































































































































































































































































Лекарственные препараты, используемые для лекарственного электрофореза

Применяемое лекарственное вещество

Концентрация раствора (%) или количество (г, ЕД)

Полярность

Адебит

2-5% в 25% ДМСО

+ —

Адреналина гидрохлорид*

0,1%0,5-1 мл

+

Актовегин

рН – 5,2 подкисл

+

Аминазин

1%

+

Аминалон (гамма –аминомасляная к-та)

2%

Ампициллин*

0,25-0,5г

Анальгин* (метамизол)

2-5%

5-10% в 25% ДМСО

+-

Анаприлин* (обзидан, индерал)

0,1% — 5 мл

+-

Андекалин, очищенный экстракт поджелудочной железы свиньи

5мл-40 ЕД на прокл

Апизатрон (компонент пчелиного яда)

0,01-0,1%

+ —

Апитоксин (пчелиный яд)1 мл


+ —

Апифор

От1 до 10 таблеток растворить в 20 мл.изотонич.р-ра NaCl (перед процедурой)

+

Апрофен (на 100 мл-1мл 1% мезатр)

0,5-1%

+

Аскорбиновая кислота*

2-5%

Аспергин (на 70% спирте)

0,2%

+

Атропина сульфат*

0,1 -1 мл

+

АТФ

1%

+ —

Ацетилсалициловая кислота, радикал* (аспирин)

5-10% в 50% ДМСО

Ацетилхолина хлорид

0,1-0,5%

+

Баралгин

2%

Бензогексоний*

1-2%

+

Беротек* (фенотероламид –бромид, фенотерол)

0,1%

+

Берлитион (этилендиаминовая соль альфалипоевой к-ты)


Биомицин (хлортетрациклина гидрохлорид)

10000едв 1 мл дист.воды

1%


+

Випраксин (змеиный яд)

1 мл

+

Витамины:

  • В1 – тиамина бромид*

2%


+


  • В2 – рибофлавин*

0,1%


  • В6 – пиридоксин*

1-5%

+

  • В12 – цианкобаламин*

100-200мкг на проц.

+

  • РР – никотиновая кислота*

0,5-1%

  • С – аскорбиновая кислота*

2-5%

  • U – метиллметионин-сульфония хлорид

1%

+

  • Е – токоферола ацетат*

2% на 25%ДМСО 0,5 мл на процедуру

+

1%

Вицеин (глазные капли)

1 мл на прокладку

+

Галантамина гидрохлорид (галантамин, нивалин)

0,5%

+

Галоперидол*

0,5%

+

Гамма-глобулин*

В физ. р-ре или дист.воде при рН 8,6-9,0

Ганглерон

0,25-0,5% 2 мл на прокладку

+

Гексаметилентетрамин

5%

+

Гексаметоний

2%

+

Гексоний

2,5%

+

Гепарин* (гепарина натриевая соль)

5000-10000ЕД в 30 мл дистиллированной воды

Гиалуронидаза

0,1-0,2г на 30 мл дистил воды с добавл 5-8 кап 0,1н р-ра соляной кислоты

+

Гистамин дегидрохлорид

0,01% 1 мл

+

Гидрокарбонат натрия

2%

Гидрокортизона сукцинат водорастворимый*

1 амп. растворяют в 0,2% р-ре натрия гидрокарбоната или подщелоченной (до рН=9.0)воде

Гиперсол

2%

+ —

Гистамина гидрохлорид

0,1% 1 мл на прокладку

+

Гистидина гидрохлорид

1-4%

+

Гликозим


+

Глицерризиновая кислота

25-30% р-р

Глутаминовая кислота *

0,5-2г готов. На 1-2% р-ре гидрокарбоната натрия

Гордокс*

½ или 1 ампула (50-100000 ЕД на прокладку)

Гризеофульвин*

1% на физ. р-ре

Грязь (компоненты) лечебная (нативная грязь, грязевой раствор)


+ —

Гумат – натрия


Гумизоль (грязевой р-р)

2-4 мл

+ —

Даларгин

1 мг ампульного порошка в 3 мл дист. воды (рН=5,5)

+

Дезоксипеганин гидрохлорид

1%

+

Дексаметазон* (дексазон)

0,1% на 25% растворе ДМСО

+

Делагил (хингамин)

2-5%

+

Диазепам*(седуксен, реланиум)

0,5%

+

Дибазол*

0,5-2%

+

Дикаин

0,5-1%

+

Дильминал



Димедрол/*

0,25-1%

+

Димекумарин*

1-2%

+

Димексид, диметилсульфоксид, ДМСО

10-50% р-р

+-

Димефосфон (комплексон)

1,5%

+-

Диоксидин

2%

+ —

Дионин (этилморфина гидрохлорид)

0,1-1%

+

Дипразин* (пипольфен)

1%

+

Дифазин

0,5%

на 100 мл 1 мл 0,1% адреналина

+

Дифацил

0,5%

+

Дихлорамин

5%

Допан

0,06% в 50% ДМСО (разовая доза 2 мл)

+

Железа лактат*

3%

+

Изониазид*(тубазид)

1-3%

+

Интал*

1%, 1 капсулу растворить в 3 мл дист.воды

Интерферон*

1 амп на прокладку

+ —

Ихтиол

2-5-10%

Йод* (калия (натрия) йодид)

2-5%

Иманин

1%

Йодбромная вода (минеральная)


Кавинтон*

1 мл (5мг) 0,5% р-ра добавляют в 1 мл ДМСО

+

Калия хлорид* ( йодид)

1-5%

+

Кальция хлорид*

2%

+

Кальций пантотенат*

2%

Канамицина сульфат*

2 мл на прокладку 0,5 г на процедуру

Карбаин

5%

+

Карбахолин

0,1%

+

Карипазим

10мг разводят в 5-10 мл физ.р-ра + 2-3 капли ДМСО

+

Карипаин

10мг разводят в 5-10 мл физ.р-ра + 2-3 капли ДМСО

+

Кватерон

0,5%

+

Кислота глютаминовая*

Кислота никотиновая* (РР)

Кислота парааминосалициловая *(ПАСК)

Кислота салициловая *(Na)

Кислота фосфорная (Na)

1%

1%

3%

2,5%

3-5%

Кобальт (хлорид, нитрат)

0,5 -1%

+

Кодеина фосфат

1%

+

Кокарбоксилаза*

1 амп 0,025-0,05г на прокладку смоченную физ.р-ром

+

Коллагеназа

подкисл

+

Коллализин

50 КЕ в 10 мл дистил воды

+

Контрикал* (трасилол)

5000-20000ЕД растворить в 10-20 мл дист.воды, подкисленной до рН=6,0-6,2

+

Кортексин*


+

Кофеин* (кофеин бензоат натрия )

А)1%

Б) 1% в 5% р-ре натрия гидрокарбоната

+


Ксантинола никотинат (компламин, теоникол)

5% 5 мл

+

Ксидифон

2%

+

Курантил * (дипиридамол)

0,5%2мл

+

Леводопа* (L-ДОПА)

0,5г в 5 мл физ р-ра

Левомицетин * (сукцинат)

0,5-1г готовят

20% р-р на проц. 2-5 мл 20%

+

Лейкеран

5 мг

Лекопаин

14 МЕ в 50 мл,

рН-5,0 – 7,0

+

Лидаза

(0,1г (64 АЕ)растворяют в 30мл дистил воды с добавлением 5-8 кап 0,1н р-ра хлористоводородной кислоты

+

Лидокаин *(ксикаин)

2-5%

(на 100 мл 1 мл 1% мезатона или 0,1% адреналина

+

Лизоцим

20 мг в 15-20 мл дист воды,рН-7,6

+

Ликозим (папален)

35-70ЕД на прокл 0,5%

+

Линкомицин*

0,5г 500тыс ЕД

+

Литическая смесь (натрий, калий, магний, новокаин)

(эуфиллин, фосфор двузамещенный, бром)



+

Магния сульфат

2-5%

+

Марганца сульфат

2-5%

+

Меди сульфат

2-5%

+

Мезатон*

1-2%

+

Мексидол (мексидант, мексиприм, мексифин)*

2,5%

+

Мелиссин «Апитосин»


+

Мелливенон

1 амп на 10 мл буферного р-ра

+ —

Меркамин гидрохлорид(профилактическое действие при радиации)

10%, 2 мл

+

Метацин

0,1%

+

Метиленовый синий

2%

+

Метиллметионин-сульфония хлорид ( витамин U)

1%

+

Метилурацил

0,01%

+

Метионин

0,5-2г, готовят на дистил.воде + 5-8 кап 0,1н р-ра хлористоводородной кислоты на 30 мл воды или 1-2% р-ре гидрокарбоната натрия

+

Мехолил

0,5%

+

Мидокалм*

1-2 мл 1%

+

Мицин

10000ЕД в 1 мл дист.воды

+

Мономицин

0,5г или 5тыс ЕД в 1мл изотонич.р-ра NaCl

+

Морфина гидрохлорид*

0,2%

+

Мочевина (карбамид)

3%

+

Натрия бромид

205%

Натрия парааминосалицилат(парааминосалициловой кислоты радикал)

1-2%

Натрия фторид

1-2%

Натрия салицилат, хлорид

2-5%

Натрия (магния) тиосульфат (теосерной кислоты радикал)

1-3%

Нафталан (озвученная эмульсия)

10%

+ —

Нейромидин

0,5%

+

Неомицина сульфат*

5000-10000ЕД/мл

+

Нивалин (галантанин)

0,25%

+

Никотиновая кислота*

0,5 — 1%

Нистатин*

(30 тыс ЕД в мл дистил воды)

Нитразепам *(эуноктин)

0,2%, 2 таб. на 5 мл 70% спирта

Нитроглицерин*

0,05% р-ор, 0,5 мл 1%спирт.р-ора в 99,5мл дист.воды

+

Новокаина гидрохлорид*

0,25-5%

+

Новокаинамид*

2-5%

+

Норсульфазол-натрия

1-2%

Но-шпа*

1-2%

+

Обзидан *

0,1%

+

Оксибутират натрия*(гамма-аминомасляной кислоты радикал)

2,5-5%

Оксилидин (бензоилоксихинуклидин)

2%

+

Окситетрациклин гидрохлорид


Окситетрациклина дигидрат (террамицин)

50000ЕД в 1мл физ. р-ра, 0,1г

0,25-0,5г на проц.


+

Оптохин

0,1%

+

Осархил

0,5 растворить в 50мл 0,5%р-ра Na гидрохлорида или (в 0,5% р-ре 1% соды)

+

Осарсол

0,5г в 50мл 0,5% р-ра натрия гидрокарбоната

+

Панангин *(аспарагиновой кислоты радикал)

1-2%(готовится на 1-2%

р-ре гидрокарбоната Na)

Панкреатин

в 5% соды 2-5% р-р

+

Пантоник


+-

Пантрипин

в ДМСО

+

Папаверин гидрохлорид

0,1-0,5%

+

Папаин (лекозим)

0,01 г в 20 мг изиотонич.р-ра

+

Пармидин

2,5% в 50% ДМСО


ПАСК(парааминосалицилат натрия)

3%

Пахикарпин гидрохлорид

1%

+

Педутин-депо


+

Пелоидин


+ —

Пенициллин

5-10тыс ЕД в 1 мл изотонич.р-ра

Пентамин

5%

+

Пентоксифиллин (трентал)

2%

+

Пилокарпина гидрохлорид

0,1-0,5%

+

Пипольфен

1%

+

Пирацетам (ноотропил)

5%

+

Пирикаин

5%

+

Пирилен

0,1-0,5%

+

Платифиллина гидротартрат

0,05-0,1%

+

Плазма крови

10%

+ —

Плазмол


Преднизолона гидрохлорид*

0,1% 0,5%

+

Продигиозан

50мкг

Прозерин *

0,1%

+

Ронидаза

0,5г в 30мл дистил воды +5-8 кап 0,1н р-ра хлористоводородной кислоты

+

Резорцин

0,5%

Роданистый аммоний

2-5%

Салафур (фурагин)

0,1%

Салицилат натрия (салициловая кислота)

2,5%

Салюзид

3%

Сальсолина гидрохлорида

0,1%

+

Семакс

0,1%

+

Сера органическая

ихтиол 10-30%, унитиол 2-5%

Серебра нитрат

1-2%

+

Сероводородная вода

концентрация до 400 мг

Серотонин

1%

+

Синтомицин

0,3-0,5%; 1%

+

Сорбит

20%

+ —

Спазмолитин

0,5% 1%

+

Совкаин

0,25-1%

+

Стрептомицина сульфат

5000-10000 ЕД/мл

+

Строфантин К*


+

Сульфадимезин

1-2%подкисл

+

Сульфапиридазин натрия

1-2%

Супрастин *

2%

+

Танин

2%

Темисал

2%

Теофиллин*

на дистиллирован воде подщелач. до рН=8,5-8,7

Террамицин (окситетрациклина дигидрат)

5000 ЕД/мл

+

Террилитин

1%

+

Тетаман

5-10%

+

Тетрациклина гидрохлорид *

5000-10000ЕД /мл

+

Тизерцин *

2-3 мл 0,25%, разбавить в 30 мл дистил воды

+

Тиокаин

2%

+

Тиосульфат натрия

5%

Тиофосфамид

10 мг в 10 мл воды для инъекц.непосред перед процед.

+

Трилон Б

3%

+

Тримекаин

0,5-2%

+

Трипседил

0,25%

+

Трипсин

5-10мг на 10мл натрия гидрокарбоната ,

5-10 мг на подкисленной дистил воде

ТРИПСИН (Spofa) 0.5-1% на дистил воде с «+»




+

Триседил

0,25%

+

Тропацин

1%

+

Туберкулин

5-25%

+

Туберкулин хлорид (миорелаксант)

1-2%

+

Унитиол (органическая сера)

2-5%

Уродан

20%

+

Уросульфан

в 50% ДМСО

+

Уротропин

2-5%

+

Фенибут*

5%

+

Фенкарол*

0,5% в 25% в ДМСО

+

Фенобарбитал *

1-2%

+

Фибринолизин*



Флакон (20000ЕД разводят в 200 мл одного из растворителей :

1 Дистил вода, подкислен до рН 5-5,2 или ацетатный буфер

2 Дистил вода, подщел до рН=8,6-8,8 (на процедуру – 30мл приготовленного р-ра)

3. в глазной практике 300-400 ЕД в 3-5-10 мл дистил воды (хранить не более 3 суток)




+






+

ФиБС


+ —

Физостигмин салицилат (эзерин)

0,1%

+

Фосфорной кислоты радикал (фосфат натрия)

3-5%

Френолон

0,5%

+

Фторафур

1-2%

Фторид натрия

ex tempore

Фторурацил

1-2%

фубромеган

2%

+

Фуразолин

0,03-0,1%

Фурагин (солафур)

0,1%

Фурадонин

на дистил воде подщелач до рН=8,4-8,8 1-2%

Хинин дигидрохлорид

1%

+

Химотрипсин

в глазной практике, 10мг 0,2% р-ра разводят в 5мл дистил. воды, хранится в течение в течение суток при Т +2-50С

+

Хонсурид

0,05 г в 5 мл 30% ДМСО

Цинка сульфат

1-2%

+

Цистамин

0,1%

+

Цистеин

2-5%

Церебролизин *

подкисл.

+

Цистамин дигидрохлорид

1%

+

Эзерина салицилат(физостигмин)

0,1%

+

Экмолин

0,5%

Эластолитин

20-30 мг в дист. Воде

+

Элениум

0,1%

+

Элкорапан


+-

Эпсилон-аминокапроновая кислота (аминокапроновой кислоты радикал)*

1-5%

+

Эритромицина фосфат*

0,1-0,25 г на проц(готовится на 70% спирте)

+

Этазол натрия

5-10%

Этилморфин гидрохлорид (дионин)

0,1-1%

+

Эуфиллин *

2-5%

+-

Эфедрина гидрохлорид*

0,1-1%

+

Яд змеиный (компоненты), випраксин

1мл

+ —

Яд пчелиный, компоненты:

апизатрон 0,01-0,1%, апитоксин 1мл, апифор 1таб в 10мл буферного р-ра (рН=4,6)

+ —

Янтарная кислота

2-3%

Способ лечения дисфункции слуховой трубы

Изобретение относится к медицине, а именно к оториноларингологии, физиотерапии, и может быть использовано при лечении пациентов с дисфункцией слуховой трубы. Выполняют катетеризацию слуховой трубы, во время которой кончик катетера вводят в устье Евстахиевой трубы. В барабанную полость нагнетают воздух, а затем 1 мл дексаметазона и 1 мл 25% раствора диметилсульфоксида. Выполняют транстубарный электрофорез, для чего в слуховой проход помещают часть ватного тампона, смоченного в смеси растворов дексаметазона и 25% диметилсульфоксида — 1:1. Другую часть тампона располагают в ушной раковине и накладывают на нее анод. Катод накладывают на затылочную область. Плотность тока выбирают в зависимости от процедуры, а именно: 1 процедура — 0,15 мА/см2, 2 процедура — 0,13 мА/см2, 3 процедура — 0,11 мА/см2, 4 процедура — 0,9 мА/см2, 5 процедура — 0,7 мА/см2. Продолжительность воздействия 10 минут. После электрофореза выполняют пневмомассаж барабанных перепонок в течение 10 минут. Курс лечения составляет 5 ежедневных процедур. Способ позволяет повысить эффективность лечения, уменьшить количество рецидивов заболевания за счет суммирования лечебного действия лекарственного препарата и физических факторов, пролонгировать лечебный эффект препарата за счет создания его депо в тканях. 2 з.п. ф-лы, 2 пр.

 

Изобретение относится к области медицины, в частности к оториноларингологии, физиотерапии, и может быть использовано при лечении пациентов с дисфункцией слуховой трубы.

Дисфункция слуховой трубы часто приводит к различным патологическим изменениям в полости среднего уха — от латентного тубоотита до экссудативного, а в последующем адгезивного среднего отита, являющихся важными звеньями развития многих форм тугоухости (Бобошко М.Ю. Вопросы патогенеза, диагностики и лечения дисфункций слуховой трубы: Автореф. дис. … д-ра мед. наук. СПб 2006, Петухова Н.А. Дисфункция слуховой трубы и эндотелиальная дисфункция: современный взгляд на проблему. Вестн. оториноларингологии. №4. 2012. 88-92). Длительное нарушение вентиляционной функции слуховой трубы с выраженным снижением интратимпанального давления способствует формированию ретракционных карманов, развитию острого гнойного среднего отита и его переходу в хронический, а также формированию эпитимпанита с холестеатомой (McNamee L.A., Harmsen A.G. Both Infl uenza-Induced Neutrophil Dysfunction and Neutrophil-Independent Mechanisms Contribute to Increased Susceptibility to a Secondary Streptococcus pneumoniae Infection. Infect Immun 2006; 74: 12: 6707-6721. 7. Nell M.J., Grote J.J. Endotoxin and TNF-alpha in middle ear eff usions: in relation with upper airway infection. Laryngoscope 1999; 109: 1815-1819; Nell M.J., Grote J.J. Endotoxin and TNF-alpha in middle ear eff usions: in relation with upper airway infection. Laryngoscope 1999; 109: 1815-1819).

Известен целый ряд методик лечения дисфункции слуховой трубы. Среди них можно выделить инвазивные методики — с применением функционального шунта (Крюков А.И., Гаров Е.В., Сидорина Н.Г., Царапкин Г.Ю., Загорская Е.Е., Акмулдиева Н.Р. Способ лечения дисфункции слуховой трубы с использованием функционального шунта // Медицинский совет, 2013, №3, с. 37-39). Для его установки проводят тимпанотомию. Наиболее часто данную процедуру выполняют после ринологических операций, что позволяет устранить длительную дисфункцию слуховой трубы и предотвращает развитие экссудативного среднего отита в отдаленном послеоперационном периоде. У данного метода имеются недостатки: необходимость проведения хирургического вмешательства с последующим уходом за шунтом и проведения процедуры удаления шунта в конце лечения.

Среди неинвазивных методов лечения дисфункции слуховой трубы наиболее распространенными являются следующие методы лечения:

1) Способ Полицера (Т.П. Мчелидзе. Оториноларингологический словарь. 2007, СПБ, с. 270) — метод лечения дисфункции слуховой трубы путем резкого повышения воздушного давления в носовой полости. Недостатками данной методики являются: воздействие повышенного воздушного давления действует на оба уха, в том числе и на здоровое ухо при одностороннем процессе; существует риск попадания патологического отделяемого из полости носа в барабанную полость при проведении процедуры с развитием еще большего воспаления, в том числе и в здоровом ухе.

2) Метод катеризации слуховой трубы с введением противоотечных препаратов, гормонов, муколитиков или ферментов (Е.С.Янюшкина Консервативное лечение секреторной стадии экссудативного среднего отита // Автореферат кандидатской диссертации, 2010 г.) Катетеризацию проводят с применением ушного катетера для Евстахиевой трубы по Hartmann, представляющего собой цилиндрическую трубочку длиной 15-18 см, один конец которой расширен в виде раструба, а другой загнут под углом 140-150° и имеет форму закругленного клюва. Имеются катетеры разной ширины просвета от 1 до 3 мм и толщиной стенки от 0,5 до 1 мм. Для нагнетания воздуха служит ушной баллон Полицера, вмещающий 200-250 мл воздуха.

Известна методика катетеризации слуховой трубы с помощью катетера для Евстахиевой трубы по Hartmann (Т.П. Мчелидзе. Оториноларингологический словарь. 2007, СПБ, с. 123). Катетеризацию производят в сидячем положении больного. Голова его должна быть прислонена к твердой подставке в вертикальном положении. Перед катетеризацией больной должен высморкаться. Проводят предварительную анестезию слизистой оболочки полости носа раствором лидокаина 10% — 2 мл.

Техника катетеризации

Под контролем передней риноскопии катетер вводят клювом вниз в нижний носовой ход. Скользя по дну носовой полости, катетер должен попасть в носоглотку. Затем его продвигают до соприкосновения с задней стенкой, поворачивают на 90° так, чтобы его клюв был направлен к уху противоположной стороны, и тянут к себе до тех пор, пока клюв его не наткнется на задний край перегородки, и поворачивают катетер на 180° в сторону исследуемого уха так, чтобы его кольцо было обращено к наружно-верхнему углу глазницы катетеризируемой стороны. Тогда клюв катетера входит в устье Евстахиевой трубы. Можно, не поворачивая клюв катетера, извлекать его до соприкосновения с мягким небом и совершить затем поворот клюва в сторону устья Евстахиевой трубы. После этого в раструб катетера вставляют наконечник баллона и вдувают несколько раз воздух, извлекая баллон после каждого вдувания. Вхождение воздуха в барабанную полость контролируют через резиновую слуховую трубку, один конец которой вставлен в ухо больного, а другой — в ухо врача. Для лечения дисфункции слуховой трубы обычно проводят 10 процедур в зависимости от улучшения степени проходимости слуховой трубы.

Одним из методов лечения дисфункции слуховой трубы является транстубарный электрофорез (В.Н. Ткаченко. К вопросу лечения больных секреторным средним отитом. Журнал ушных, носовых и горловых болезней, Киев, №4, 2007 с. 33-38). Вышеуказанная методика является наиболее близкой к предлагаемому нами изобретению.

Электрофорез — это электрокинетическое явление перемещения частиц дисперсной фазы (коллоидных или белковых растворов) в жидкой или газообразной среде под действием внешнего электрического поля (Парфенов А.П. Электрофорез лекарственных веществ. Л., 1973). Но как метод физиотерапевтического лечения дисфункции слуховой трубы в последнее время его применение практически прекращено ввиду травматичности методики выполнения из-за того, что для его проведения применятся металлический катетер.

Нами была поставлена задача разработки способа лечения пациентов с патологией слуховой трубы, лишенного указанных недостатков.

Разработанный нами способ позволяет добиться следующих технических результатов: повышается качество лечения, сокращается время лечения и количество проводимых процедур, уменьшается количество рецидивов заболевания.

Указанные результаты обусловлены следующим. Диметилсульфоксиду присуща способность усиливать действие вводимых при помощи электрофореза препаратов, так как он обладает выраженным транспортирующим свойством. ДМСО нами был использован, во-первых, в связи с тем, что дексаметазон обладает низкой электрофоретичностью и потому для обеспечения необходимой глубины проникновения электрофрез с ним проводится на растворе диметилсульфоксида (ДМСО). Во-вторых, так как применяемые электроды обладают малой площадью (интратубарный 2 мм2, наружный 25 см2).

Максимальная плотность тока при проведении электрофореза на слизистых оболочках не должна превышать 0,2 мА/см2. Для расчета силы тока применяется формула J=σ⋅S, где J — сила тока, σ — плотность тока, S — площадь прокладки или электрода. При использовании только интратубарного электрода площадью 2 мм2 максимально возможная мощность равняется I=0,2-0,02-0,004 мА, что недостаточно для проведения процедуры электрофореза. Соответственно, нами была выбрана методика биполярного электрофореза с применением наружного электрода 5×5 см=25 см2. Так как при биполярном электрофорезе площади активных электродов при расчете мощности складываются, получаем 0,02+16=16,02 см2, что дает максимально возможную мощность 0,2-25,02=5,004 мА, что обеспечивает хорошее проникновение препарата в ткани. Так как у некоторых пациентов субъективные ощущения достижения максимальной мощности (чувство вибрации, покалывания в области электродов) возникали на мощности 2-3 мА, применение ДМСО давало гарантию того, что даже на такой мощности препарат поступит в ткани в достаточном количестве.

Положительным аспектом применения электрофореза является то, что при этом происходят суммирование лечебного действия препарата и физического фактора, пролонгирование лечебного эффекта препарата за счет создания депо в подлежащих тканях с последующим длительным высвобождением.

Нами было выявлено, что комплексное применение указанных выше лечебных методов дает наилучший эффект, чем их изолированное применение. Катетеризация слуховой трубы с введением лекарственных препаратов является общепринятой методикой лечения тубарной дисфункции, так как вводимые препараты обладают противовоспалительным действием, улучшая проходимость слуховой трубы и, как следствие, аэрацию среднего уха. Электрофорез, проводимый после катетеризации, позволяет создать депо препарата в тканях по ходу слуховой трубы, пролонгируя его действие до 48 часов.

Способ осуществляется следующим образом.

Производится курс катетеризаций слуховой трубы с помощью катетера в количестве 5 процедур 1 раз в день.

Для этого после проведенной местной анестезии раствором лидокаина 10% 2 мл и обработки слизистой оболочки полости носа адреналином в полость носа под контролем эндоскопа 0° вводится катетер для катетеризации слуховой трубы.

Катеризацию целесообразно использовать с помощью катетера, выполненного из эластичного материала — из силиконовой резины, что позволяет снизить риск травмирования тканей.

Катетер продвигают до соприкосновения с задней стенкой носоглотки и поворачивают на 90° в сторону исследуемого уха. Потянув катетер на себя, кончик катетера входит в устье Евстахиевой трубы. После этого на катетер надевают наконечник баллона и нагнетают несколько раз воздух. Вхождение воздуха в барабанную полость контролируют через резиновую слуховую трубку, один конец которой вставлен в ухо больного, а другой — в ухо врача. Убедившись в прохождении воздуха в катетер, нагнетается 1 мл дексаметазона и 1 мл 25% раствора диметилсульфоксида. В качестве активного электрода (анод) используется металлический проводник диаметром 1 мм с закругленным концом с целью препятствия травмирования тканей слуховой трубы. После катетеризации и нагнетания раствора проводник проводится через катетер на заранее известную длину так, чтобы его конец выступал на 2 мм из торцевого края катетера, после чего осуществляется электрофорез.

С целью обеспечения более эффективного воздействия препарата применялся биполярный электрофорез (транстубарный электрофорез) раздвоенным электродом, для чего в слуховой проход помещают часть ватного тампона, смоченного в смеси растворов дексаметазона и 25% диметилсульфоксида -1:1, при этом другую часть тампона располагают в ушной раковине и накладывают на нее электрод (анод).

Катод накладывается на затылочную область (расположение электродов стандартное — по средней линии от С3 до С7). Плотность тока варьируют в ходе лечения. Начинают с 0,15 мА/см2, как максимальной для достижения наилучшего начального эффекта, так как в начале лечения наблюдается наиболее выраженный отек слизистой слуховой трубы, уменьшающийся по мере проведения лечения за счет проводимой противовоспалительной терапии и депонирования препарата в тканях за счет электрофореза, и постепенно снижают по разработанной нами оригинальной схеме:

1 процедура — 0,15 мА/см2,

2 процедура — 0,13 мА/см2,

3 процедура — 0,11 мА/см2,

4 процедура — 0,9 мА/см2,

5 процедура — 0,7 мА/см2.

Так как в процессе лечения происходит депонирование препарата в слизистой слуховой трубы, последующие процедуры можно проводить с меньшей мощностью, что позволяет уменьшить риск повреждения слизистой оболочки электротоком, а применение ДМСО обеспечивает достаточное проникновение препарата в ткани при меньшей силе и плотности тока.

Продолжительность каждой процедуры составляла 10 минут. После проведенного электрофореза проводят пневмомассаж барабанных перепонок в течение 10 минут. Пневмомассаж предпочтительно проводить после электрофореза потому, что в результате проведенной процедуры восстанавливается проходимость слуховой трубы и подвижность барабанной перепонки становится лучше.

Курс лечения состоит из 5 ежедневных процедур катетеризации слуховой трубы с введением 1 мл дексометазона и 1 мл 25% раствора диметилсульфоксида, проведением электрофореза и пневмомассажа барабанных перепонок.

Метод лечения дисфункции слуховой трубы апробирован на 20 больных с острым средним отитом в возрасте от 18 до 57 лет.

Иллюстрацией эффективности метода лечения дисфункции слуховой трубы могут служить 2 истории болезни.

Клинический пример N1

Больная О.Н., 29 лет. Обратилась в КДО НИКИО им. Л.И. Свержевского с диагнозом дисфункция слуховой трубы слева.

При поступлении предъявляла жалобы на заложенность левого уха, ощущение собственного голоса внутри головы.

Со слов пациентки, больна в течение 5 дней после перенесенного ОРВИ. Лечилась самостоятельно применением противовирусных препаратов, на фоне приема препаратов симптомы ОРВИ купировались, однако появилась заложенность левого уха. Жалобы возникли впервые. Ранее заложенности ушей не отмечала.

При отоскопии левого уха наружный слуховой проход широкий, свободный. Барабанная перепонка серого цвета, втянута. Опознавательные знаки укорочены. Шепотная речь 5,5 м, разговорная речь — более 6 м. При отоскопии правого уха наружный слуховой проход широкий, свободный. Барабанная перепонка серого цвета. Опознавательные знаки контурируются. Шепотная речь 6 м, разговорная речь — более 6 м. При проведении опыта Вебера имеется латерализация в левое ухо.

Пациентке проведен курс катетеризации слуховой трубы слева в количестве 5 процедур. После проведенной местной анестезии раствором лидокаина 10% 2 мл и обработки слизистой оболочки полости носа адреналином в полость носа под контролем эндоскопа 0° вводился катетер для катеризации слуховой трубы. Катетер продвигали до соприкосновения с задней стенкой носоглотки и поворачивали на 90° в сторону исследуемого уха. Потянув катетер на себя, кончик катетера входил в устье Евстахиевой трубы. После этого к катетеру вставляли наконечник баллона и нагнетали несколько раз воздух. Вхождение воздуха в барабанную полость контролировали через резиновую слуховую трубку, один конец которой вставлен в ухо больного, а другой — в ухо врача. Убедившись в прохождении воздуха, в катетер нагнетается 1 мл дексометазона и 1 мл 25% раствора диметилсульфоксида. В качестве активного электрода (анод) использовался металлический проводник диаметром 1 мм с закругленным концом. Проводник проводится через катетер так, чтобы его конец выступал на 2 мм из торцевого края катетера, после чего осуществляли биполярный электрофорез раздвоенным электродом, для чего дексаметазон вводился дополнительно через наружный слуховой проход — в слуховой проход помещался ватный тампон, смоченный раствором лекарственного вещества, другим концом заполнялась ушная раковина и накладывался на нее электрод. Катод накладывался на затылочную область. Первую процедуру начинали с 0,15 мА/см2, вторую процедуру — 0,13 мА/см2. Продолжительность каждой процедуры составляла 10 минут. После проведенного электрофореза проводился пневмомассаж барабанных перепонок в течение 10 минут.

После проведения второй процедуры катетеризации слуховой трубы слева пациентка отметила уменьшение заложенности левого уха. Жалобы на аутофонию регрессировали.

Третью процедуру проводили с установкой плотности тока — 0,11 мА/см3, четвертую процедуру — 0,9 мА/см2, пятую процедуру — 0,7 мА/см2.

После проведенной пятой процедуры пациентка жалоб не предъявляет. При объективном осмотре: наружный слуховой проход широкий, свободный. Барабанная перепонка серого цвета. Опознавательные знаки контурируются. Шепотная речь 6 м, разговорная речь — более 6 м. При проведении опыта Вебера латерализации нет.

Клинический пример N2

Больная Г.О., 32 лет. Обратилась в КДО НИКИО им. Л.И. Свержевского с диагнозом правосторонний экссудативный средний отит, дисфункция слуховой трубы справа.

При поступлении предъявляла жалобы на заложенность правого уха, снижение слуха справа, боль в правом ухе.

Со слов пациентки, больна в течение 7 дней после переохлаждения (купалась в проруби). Обращалась в поликлинику по месту жительства, где ЛОР-врачом было назначено консервативное лечение: капли Отипакс в правое ухо, сосудосуживающие капли в нос, продувание по Политцеру справа, пневмомассаж. Однако выраженного клинического эффекта пациентка не отметила. Жалобы возникли впервые. Ранее отитов не было.

При отоскопии левого уха: наружный слуховой проход широкий, свободный. Барабанная перепонка серого цвета. Опознавательные знаки контурируются. Шепотная речь 6 м, разговорная речь — более 6 м. При отоскопии правого уха: наружный слуховой проход широкий, свободный. Барабанная перепонка гиперемирована, выбухает. Опознавательные знаки стерты. Шепотная речь 4 м, разговорная речь — 5 м. При проведении опыта Вебера имеется латерализация в правое ухо. При тимпанометрии: тип «В» справа, тип «А» слева.

Пациентке проведен курс катетеризации слуховой трубы справа в количестве 5 процедур. После проведенной местной анестезии раствором лидокаина 10% 2 мл и обработки слизистой оболочки полости носа адреналином. В правую половину полости носа под контролем эндоскопа 0° вводили катетер для катетеризации слуховой трубы. Катетер продвигали до соприкосновения с задней стенкой носоглотки и поворачивали на 90° в сторону правого уха. Потянув катетер на себя кончик катетера, вводят в устье Евстахиевой трубы справа. После этого к катетеру присоединяли наконечник баллона и нагнетали несколько раз воздух. Вхождение воздуха в барабанную полость контролировали через резиновую слуховую трубку, один конец которой вставлен в правое ухо больного, а другой — в ухо врача. Убедившись в прохождении воздуха, в катетер нагнетался 1 мл дексометазона и 1 мл 25% раствора диметилсульфоксида. В качестве активного электрода (анод) использовался металлический проводник диаметром 1 мм с закругленным концом. Проводник проводится через катетер так, чтобы его конец выступал на 2 мм из торцевого края катетера, после чего осуществляли биполярный электрофорез раздвоенным электродом, для чего дексаметазон вводился дополнительно через наружный слуховой проход — в слуховой проход помещался ватный тампон, смоченный раствором лекарственного вещества, другим концом заполнялась ушная раковина и накладывался на нее электрод.

Катод накладывался на затылочную область. Первую процедуру начинали с 0,15 мА/см2, вторую процедуру — 0,13 мА/см2, третью процедуру — 0,11 мА/см2. Продолжительность каждой процедуры составляла 10 минут. После проведенного электрофореза проводился пневмомассаж барабанных перепонок в течение 10 минут.

После проведения третьей процедуры катетеризации слуховой трубы справа пациентка отметила уменьшение болей в правом ухе. Жалобы на заложенность, снижение слуха справа регрессировали.

Четвертую процедуру проводили с установкой плотности тока — 0,9 мА/см2, пятую процедуру — 0,7 мА/см2. После проведенной пятой процедуры пациентка жалоб не предъявляет. При объективном осмотре: наружный слуховой проход широкий, свободный. Барабанная перепонка серого цвета. Опознавательные знаки контурируются. Шепотная речь 6 м, разговорная речь — более 6 м. При проведении опыта Вебера латерализации нет. Пациентке проведена контрольная тимпанометрия: тип «А» с 2-х сторон.

1. Способ лечения дисфункции слуховой трубы, включающий катетеризацию слуховой трубы, во время которой кончик катетера вводят в устье Евстахиевой трубы, в барабанную полость нагнетают воздух, а затем 1 мл дексаметазона и 1 мл 25% раствора диметилсульфоксида, после чего выполняют транстубарный электрофорез, для чего в слуховой проход помещают часть ватного тампона, смоченного в смеси растворов дексаметазона и 25% диметилсульфоксида — 1:1, при этом другую часть тампона располагают в ушной раковине и накладывают на нее анод, катод накладывают на затылочную область, при этом плотность тока выбирают в зависимости от процедуры, а именно:

1 процедура — 0,15 мА/см2,

2 процедура — 0,13 мА/см2,

3 процедура — 0,11 мА/см2,

4 процедура — 0,9 мА/см2,

5 процедура — 0,7 мА/см2;

продолжительность воздействия 10 минут, после электрофореза выполняют пневмомассаж барабанных перепонок в течение 10 минут; курс лечения составляет 5 ежедневных процедур.

2. Способ по п. 1, в котором предварительно проводят местную анестезию раствором лидокаина 10% 2 мл и обработку слизистой оболочки полости носа раствором адреналина.

3. Способ по п. 1, в котором катетеризацию выполняют с помощью катетера, изготовленного из эластичного материала.

Электрофорез — цена на услугу в Таганроге


Электрофорез – один из самых распространённых, проверенных временем классических методов физиотерапии. Во время процедуры лекарственный препарат под действием слабого электрического тока глубоко проникает в кожу, не повреждая ее.


Суть процедуры заключается в том, что на кожу человека с двух сторон кладутся тканевые прокладки, пропитанные лекарственным раствором, и прижимаются к коже электродами. Под действие тока медикамент распадается на ионы, что способствует быстрому проникновению действующего вещества через кожу и слизистые и равномерному распределению в клетках и межклеточной жидкости. Из эпидермиса и дермы лекарство хорошо всасывается в кровь и лимфу и доставляется ко всем органам и тканям, хотя и достигает максимальной концентрации в области введения.


Ожидаемый положительный эффект электрофореза:

  • улучшение обмена веществ не только в местных тканях, но и во всём организме
  • снижение выраженности воспалительного процесса
  • устранение отеков
  • болеутоляющее действие
  • стимуляция выработки веществ с биологической активностью
  • повышение иммунитета
  • успокаивающий эффект, благотворное влияние на ЦНС
  • улучшение микроциркуляции крови
  • ускорение регенерации тканей


Показания:

  • травмы и заболевания опорно-двигательного аппарата
  • болезни центральной и периферической нервной системы
  • болезни дыхательной системы
  • патологии сердечно-сосудистой и пищеварительной систем
  • болезни органов слуха и зрения
  • стоматологические и кожные болезни
  • болезни мочеполовой и эндокринной системы
  • послеоперационная реабилитация (послеоперационные раны и рубцы)


Противопоказания


Метод электрофореза достаточно безопасен, но его нельзя применять при некоторых патологиях:

  • лихорадка
  • нарушение кожных покровов в области наложения электродов
  • гнойные воспалительные заболевания
  • злокачественные новообразования
  • бронхиальная астма в тяжелой форме
  • индивидуальная непереносимость медикаментов
  • наличие кардиостимулятора

Физиотерапия — «Стоматологическая поликлиника №19»

В кабинете физиотерапии

Рациональное сочетание медикаментозной терапии и физических факторов в значительной мере  увеличивает эффективность лечения и медицинской реабилитации больных.

Лечебные физические факторы имеют ряд преимуществ перед традиционными методами лечения. Они крайне редко вызывают осложнения, то есть чрезвычайно физиологичны. На практике методы физиотерапии чаще применяют в комплексном лечении, но они зачастую эффективны и в случае монотерапии.

В связи с особенностями иннервации и микроциркуляции челюстно-лицевой области все физиотерапевтические воздействия на неё, помимо местных реакций, вызывают мощный регуляторный ответ целостного организма. Для уменьшения рефлекторных реакций и повышения качества лечения широко используется внутриполостные методики (в полости рта, зуба), что позволяет локализовать воздействие и уменьшить энергетическую нагрузку на организм.

При множественном кариесе, гипоплазии и флюорозе используется 10% раствор глюконата кальция для электрофореза внутриротового (используется поперечная и продольная методики .

— Для снятия болевых ощушений синдромов различной этиологии применяем флюктооризацию и диадинамотерапию.

— Мягкое воздействие токов дАрсонваля  применяем на кожу и слизистую оболочку полости рта для улучшения питания тканей и их кровоснабжения при заболеваниях пародонта, повреждениях целостности кожи и слизистой оболочки воспалительного и травматического характера.

— Противоотёчное действие электромагнитных полей и магнитотерапии используется при острых воспалительных заболеваниях челюстно – лицевой области.

— При заболеваниях височно – нижнечелюстного сустава (артритах и артрозах) применяем магнитотерапию, ультразвукотерапию и фонофорез 5 % мази   хондроитина или 5 % хондроксида.

— Фонофорез и электрофорез лидазы  применяем при  рубцовых изменениях кожи и слизистой.

— Ультрафиолетовое облучение слизистой оболочки полости рта применяем при воспалительных заболеваниях -стоматитах.

Инфракрасное и красное лазерное излучение применяется при невралгиях ветвей тройничного нерва, парестезии слизистой, воспалительных заболеваниях слизистой и пародонта.

Используемые методы ФТЛ:

Клинические исследование Множественная миелома: перифозин, дексаметазон — Реестр клинических исследований

Критерии включения:

Основные критерии:

1. Плазмацитомы при биопсии ткани.

2. Плазмацитоз костного мозга (> 30% плазматических клеток).

3. Пик моноклонального иммуноглобулина при электрофорезе сыворотки иммуноглобулина G (IgG)> 3,5 г / дл или иммуноглобулин А (IgA)> 2,0 г / дл; экскреция легкой цепи каппа или лямбда> 1 г / день при 24-часовом электрофорезе белков мочи.

Второстепенные критерии:

1. Плазмацитоз костного мозга (от 10 до 30% плазматических клеток)

2. Моноклональный иммуноглобулин присутствует, но в меньшей степени, чем в основных критерии

3. Литические поражения костей.

4. Нормальный иммуноглобулин M (IgM) <50 мг / дл, IgA <100 мг / дл или IgG <600 мг / дл.

Любой из следующих наборов критериев подтвердит диагноз множественной миеломы:

1. Любые два основных критерия.

2. Основной критерий 1 плюс второстепенный критерий b, c или d.

3. Основной критерий 3 плюс второстепенный критерий a или c.

4. Второстепенные критерии a, b и c или a, b и d.

Критерий исключения:

1. Почечная недостаточность (уровень креатинина сыворотки> 3 мг / дл).

2. Пациенты с уровнем АЛТ или АСТ ≥ 2,5 X верхней границы нормы.

3. История аллергических реакций, связанных с химическими или биологическими соединениями. состав к перифозину (милтефозин или эдельфозин).

4. Лекарства сопутствующей терапии, которые включают кортикостероиды (кроме указанных для другие медицинские условия, или до 100 мг гидрокортизона в качестве премедикации для прием определенных лекарств или продуктов крови) или другой химиотерапии, которая или может быть активным против миеломы, или химиотерапия в течение 3 недель до День 1. Нитрозомочевины необходимо прекратить за 6 недель до дня 1.

5. Субъекты с гемоглобином <8,0 г / дл.

6. Любое состояние, включая лабораторные отклонения, которое, по мнению Исследователь подвергает субъекта недопустимому риску, если он / она будет участвовать в изучение.

7. Женщины детородного возраста (WCBP), беременные, кормящие грудью, мужчины и исключаются женщины, не использующие адекватные средства контрацепции.

8. Плазменно-клеточный лейкоз.

Как лечить артроз плечевого сустава?

« Назад

18.03.2020 00:00

Артрозы – это такие поражения суставов, которые возникают по причине нарушения обмена веществ в околосуставных тканях и из-за изнашивания ткани сустава. Чаще всего артроз проявляет себя у людей старше 40 лет.

Артроз не надо путать с артритом, под которым подразумеваются воспалительные процессы, проходящие в суставе, причиной которых являются изменения в суставной жидкости. А при артрозе изменяется сама структура хряща, и появляются признаки его преждевременной изнашиваемости – в основном это микротрещинки.

Что касается артроза плечевого сустава, то для него характерно отложение солей в местах повреждения хряща. Поэтому, если не начать своевременное лечение, то заболевание может привести к появлению контрактуры, дефекту, который будет блокировать некоторые движения.

Симптомы артроза плечевого сустава:

— появление болевых ощущений при физических нагрузках;
— ограниченная подвижность сустава;
— хруст в суставе;
— периодическое появление отёчности сустава;
— напряженность мышц при выполнении обычных действий;
— невозможность сделать некоторые движения.

Для того чтобы заподозрить артроз, достаточно отметить хотя бы пару из этих симптомов. В таком случае Здоровая жизнь рекомендует поскорее обратиться к специалисту для уточнения диагноза и назначения необходимого лечения.

Причины появления артроза плечевого сустава могут быть разными:
— травма или неожиданная чрезмерная физическая нагрузка;
— образ жизни, который ограничивает подвижность плечевого сустава;
— наследственность.

Как лечить артроз плечевого сустава?

Выбор препаратов для лечения и необходимых процедур делается с учетом ряда обстоятельств. Сначала проводят рентген сустава, чтобы точно выявить, какие изменения в суставе имеются, и какое лечение потребуется.

Если выявлен первичный артроз, то для восстановления кровообращение в суставе назначают медикаменты, процедуры, советуют внести коррективы в образ жизни. Лучше всего, чтобы лечение носило комплексный характер: медикаменты сочетались с физиопроцедурами, а потом проводилось санаторно-курортное лечение.

Чтобы снять воспаление плечевого сустава, назначают такие нестероидные препараты, как ортофен, индометацин, диклофенак. А чтобы восстановить микроциркуляцию крови в плечевом суставе, обычно приписывают применять гепарин, АТФ, никошпан, троксевазин, трентал, продектин и т.д.

Для улучшения усвоения тканями кислорода необходимо принимать витамины группы В. Кроме названных препаратов хорошо себя зарекомендовал в лечении артроза и аспирин для получения обезболивающего и противовоспалительного эффекта.

Если у больного артрозом имеются болезни желудочно-кишечного тракта или язва желудка, то назначают препарат с щадящим действием на желудок – это Фепразон.

Чтобы снизить проявления дистрофических изменений на суставах назначают такие препараты, как артепарон, хлорохин, румалон.

Иногда врач может приписать внутрисуставное введение дексаметазона, гидрокортизона и иных подобных препаратов.

Чтобы лечение было комплексным, при артрозе плечевого сустава применяют физиотеревтические процедуры: ультразвуковое воздействие, электрофорез, скипидарные или хлоридно-натриевые ванны. Если клиника обладает современным оборудованием, то больному могут прописать посещение сеансов лазерного лечения, криотерапии, вакуумного массажа и т.д.

При артрозе с отёками следует соблюдать низкосолевую диету с достаточным количеством жидкости. То есть следует снизить потребление соленых блюд, острых приправ, помидоров и шпината. Такая диета помогает избавляться от лишней жидкости, что способствует снятию отеков.

 

 

Источник

 

 

% PDF-1.5
%
1 0 объект
> / OCGs [7 0 R] >> / Страницы 2 0 R / Тип / Каталог >>
эндобдж
38 0 объект
> поток
2021-06-12T11: 19: 23-07: 002006-09-16T13: 56: 52 + 08: 002021-06-12T11: 19: 23-07: 00uuid: f6b067da-9773-41b4-98ec-da7c98009953uuid: a47f7817- 1dd1-11b2-0a00-bf006872c9ffприложение / pdf
конечный поток
эндобдж
2 0 obj
>
эндобдж
33 0 объект
> / Font> / T1_1> / T1_2> / T1_3> / T1_4> / T1_5 42 0 R >> / ProcSet [/ PDF / Text / ImageB] / Properties> / XObject >>> / Type / Page >>
эндобдж
28 0 объект
> / Font> / T1_1> / T1_2> / T1_3 42 0 R >> / ProcSet [/ PDF / Text / ImageB] / Properties> / XObject >>> / Type / Page >>
эндобдж
23 0 объект
> / Font> / T1_1> / T1_2> / T1_3> / T1_4 42 0 R >> / ProcSet [/ PDF / Text / ImageB] / Properties> / XObject >>> / Type / Page >>
эндобдж
18 0 объект
> / Font> / T1_1> / T1_2> / T1_3> / T1_4 42 0 R >> / ProcSet [/ PDF / Text / ImageB] / Properties> / XObject >>> / Type / Page >>
эндобдж
5 0 obj
> / Font> / T1_1 42 0 R >> / ProcSet [/ PDF / Text / ImageB / ImageC] / Properties> / XObject >>> / Type / Page >>
эндобдж
39 0 объект
> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >>
эндобдж
51 0 объект
[57 0 R 58 0 R 59 0 R 60 0 R 61 0 R]
эндобдж
52 0 объект
> поток
q
540.0594177 0 0 68.6011963 35.9702911 675.3988037 см
/ Im0 Do
Q
BT
/ T1_0 1 Тс
10 0 0 10 85,56995 576,99985 тм
(1973; 33: 542-546.) Tj
/ T1_1 1 Тс
-5.55699 0 Тд
(Рак Res \ 240) Tj
/ T1_0 1 Тс
0 1 ТД
(\ 240) Tj
0 1.00001 TD
(Джон Д. Скрибнер и Томас Дж. Слага) Tj
/ T1_2 1 Тс
0 1 ТД
(\ 240) Tj
/ T1_3 1 Тс
18 0 0 18 30 616,99997 тм
(Гиперплазия, вызванная промотором опухоли) Tj
Т *
(Множественные эффекты дексаметазона на синтез белка и) Tj
ET
30 522 552 35 рэ
0 0 мес.
S
BT
/ T1_0 1 Тс
11 0 0 11 120.94202 529.99997 тм
(\ 240) Tj
/ T1_3 1 Тс
-7.55696 1 тд
(Обновленная версия) Tj
ET
BT
/ T1_2 1 Тс
10 0 0 10 141 521,99994 тм
(\ 240) Tj
/ T1_0 1 Тс
22.06695 1 тд
() Tj
0 0 1 рг
-22.06695 0 Тд
(http://cancerres.aacrjournals.org/content/33/3/542)Tj
0 г
0 1.00001 TD
(Последнюю версию этой статьи можно найти по адресу:) Tj
ET
BT
/ T1_2 1 Тс
10 0 0 10 30 501,99997 тм
(\ 240) Tj
0 1 ТД
(\ 240) Tj
ET
BT
/ T1_2 1 Тс
10 0 0 10 30 481,99997 тм
(\ 240) Tj
Т *
(\ 240) Tj
ET
BT
/ T1_2 1 Тс
10 0 0 10 30 461,99997 тм
(\ 240) Tj
Т *
(\ 240) Tj
ET
30 347 552 115 рэ
0 0 мес.
S
BT
/ T1_0 1 Тс
11 0 0 11 120.94202 429,99997 тм
(\ 240) Tj
/ T1_3 1 Тс
-5.66901 1 тд
(Оповещения по электронной почте) Tj
ET
BT
/ T1_0 1 Тс
10 0 0 10 295,4996 442 тм
(относится к этой статье или журналу.) Tj
0 0 1 рг
-15.44996 0 Тд
(Подпишитесь, чтобы получать бесплатные уведомления по электронной почте) Tj
ET
BT
0 г
/ T1_0 1 Тс
11 0 0 11 120.94202 396.99994 тм
(\ 240) Tj
/ T1_3 1 Тс
-6.38997 1 тд
(Подписки) Tj
0,556 1,00001 тд
(Отпечатки и) Tj
ET
BT
/ T1_0 1 Тс
10 0 0 10 141 399,99994 тм
(\ 240) Tj
13,46496 1 тд
(.) Tj
0 0 1 рг
-6.85098 0 Тд
([email protected]) Tj
0 г
-6.61398 0 Тд
(Отделение) Tj
0 1.00001 TD
(Чтобы заказать перепечатку статьи или подписаться на журнал, свяжитесь с нами \
t Публикации AACR) Tj
ET
BT
/ T1_0 1 Тс
11 0 0 11 120,94 202 374,99997 тм
(\ 240) Tj
/ T1_3 1 Тс
-5.66901 1 тд
(Разрешения) Tj
ET
BT
/ T1_0 1 Тс
10 0 0 10 141 346,99988 тм
(\ 240) Tj
0 1 ТД
(Сайт Rightlink.) Tj
0 1.00001 TD
(Нажмите «Запросить разрешения», чтобы перейти на страницу защиты авторских прав \
раннс Центр \ (CCC \)) Tj
22.06695 1 тд
(.) Tj
0 0 1 рг
-22.06695 0 Тд
(http://cancerres.aacrjournals.org/content/33/3/542)Tj
0 г
0 1 ТД
(Чтобы запросить разрешение на повторное использование всей или части этой статьи, используйте это li \
nk) Tj
ET
BT
/ T1_0 1 Тс
9 0 0 9 255.\ q

Моделирование искусственной нейронной сетью электрофоретической подвижности дексаметазона и двух добавок в мицеллярной электрокинетической капиллярной хроматографии

Искусственное нейросетевое моделирование электрофоретической подвижности дексаметазона и двух добавок в мицеллярной электрокинетической капиллярной хроматографии

Одновременная оптимизация с множественным откликом была использована для разработки метода мицеллярной электрокинетической капиллярной хроматографии (MEKC) для определения дексаметазона натрия фосфата (DEX) и двух добавок, креатинина (CRE) и пропилпарабена (PRO) в ампулах DEX.Цель состоит в том, чтобы оптимизировать параметры разделения для достижения максимального разрешения между тремя компонентами за разумное время работы. Состав и напряжение буфера были оптимизированы с помощью искусственной нейронной сети (ИНС). Использовалась лучшая нейронная сеть со структурой «2-10-4» и 150 эпохами. Для построения ИНС использовался алгоритм обратного распространения с функцией сигмоидального преобразования в узлах. Способность к обобщению была изучена путем обращения к сети с тестовыми данными и расчета параметров производительности, e.грамм. Корреляция ( R ), среднеквадратичная ошибка (MSE), среднеквадратичная ошибка (RMSE) и относительная ошибка в процентах ( E r %). Прогнозируемые результаты хорошо согласуются с экспериментальными значениями, что указывает на то, что нейронная сеть является потенциальным методом выбора условий разделения в MEKC. Оптимальное разделение было достигнуто при использовании фонового электролита 20 мМ боратного буфера, содержащего 30 мМ додецилсульфата натрия (SDS), при pH 9.5 вместе с подачей высокого напряжения (30 кВ) на капилляр. Полное разделение было достигнуто за 4,39 мин. Этот оптимизированный метод был применен для анализа коммерческих ампул DEX. Метод был полностью проверен в соответствии с рекомендациями ICH.

У вас есть доступ к этой статье

Подождите, пока мы загрузим ваш контент…

Что-то пошло не так. Попробуй еще раз?

Идентификация Yb-глутатион-S-трансферазы как основного белка печени крысы, меченного 21-метансульфонатом дексаметазона на JSTOR

Abstract

Дексаметазон 21-метансульфонат, аффинная метка для глюкокортикоидсвязывающих белков, инкубировали с препаратами цитозоля печени крысы.Преобладающий ковалентно меченый компонент был идентифицирован как Yb-глутатион-S-трансфераза на основании хроматографических свойств, электрофоретической подвижности и специфического удерживания анти-Yb-иммуноадсорбентом. Мечение аффинности этого белка блокировалось избытком дексаметазона. Предпочтительная реакционная способность 21-метансульфоната дексаметазона с подклассом Yb глутатион-S-трансферазы (глутатионтрансфераза, EC 2.5.1.18) также была очевидна для смесей, содержащих множественные формы фермента.Yb-глутатион-S-трансфераза, ненасыщаемый глюкокортикоидсвязывающий компонент цитозоля печени крысы, поэтому должна быть переклассифицирована; из-за своей высокой концентрации и избирательного взаимодействия со стероидами этот фермент может быть внутриклеточным глюкокортикоидсвязывающим белком и, таким образом, влиять на транспорт, метаболизм и действие стероидов.

Информация о журнале

PNAS — это самый цитируемый в мире междисциплинарный научный сериал.
Он публикует высокоэффективные исследовательские отчеты, комментарии, мнения, обзоры и т. Д.
доклады коллоквиума и акции Академии.В соответствии с руководящими
принципы, установленные Джорджем Эллери Хейлом в 1914 году, PNAS издает
краткие первые объявления членов Академии и иностранных партнеров подробнее
важный вклад в исследования и работу, которая, по мнению Участника,
иметь особое значение.

Информация об издателе

Национальная академия наук (НАН) — это частная некоммерческая организация ведущих исследователей страны. НАН признает и продвигает выдающуюся науку путем избрания в члены; публикация в своем журнале PNAS; и его награды, программы и специальные мероприятия.Через Национальные академии наук, инженерии и медицины NAS предоставляет объективные, научно обоснованные советы по важнейшим вопросам, затрагивающим нацию.

Пренатальное воздействие дексаметазона увеличивает восприимчивость к аутоиммунитету у потомков крыс путем эпигенетического программирования глюкокортикоидного рецептора

Цель . Пренатальные глюкокортикоиды (ГК) могут оказывать долгосрочное воздействие на здоровье потомства. Тем не менее, количество сообщений и связанных с ними исследований, касающихся пролонгированного действия пренатальных ГК на развитие аутоиммунитета, ограничено.Здесь мы стремились изучить иммунологические эффекты воздействия дексаметазона (DEX) на молодых людей и участие глюкокортикоидных рецепторов (GR) в этом процессе. Методы . Крысам Wistar давали DEX во время беременности. Восприимчивость к аутоиммунным заболеваниям у потомства оценивали с использованием экспериментальных моделей животных с аутоиммунным энцефаломиелитом (EAE) и адъювантом-индуцированным артритом (AIA). Чтобы выявить возможный механизм, в мононуклеарных клетках периферической крови (PBMC) измеряли глюкокортикоидный ответ, экспрессию GR и статус метилирования. Результатов . Наши результаты показали, что крысы, получавшие DEX, имели более высокую восприимчивость к EAE (100% против 62,5%) и AIA (63,6% против 0%), чем контрольная группа, получавшая физиологический раствор. Глюкокортикоидный ответ и экспрессия GR были снижены у крыс DEX. Существенная разница была также обнаружена в уровнях метилирования экзона 1-10 GR в область экзона 1-11. Выводы . Пренатальное введение DEX увеличивает восприимчивость к аутоиммунным заболеваниям, которые потенциально опосредованы программированием статуса метилирования GR и чувствительности к глюкокортикоидам.

1. Введение

Глюкокортикоиды необходимы для созревания систем органов плода и нормального развития. Во время беременности у человека лечение глюкокортикоидами (ГК) часто назначается, когда ожидаются преждевременные роды. Это лечение успешно способствует созреванию легких плода и снижает частоту респираторного дистресс-синдрома. Однако появляются новые данные, указывающие на то, что антенатальные глюкокортикоиды могут вызывать программирование плода, что приводит к побочным эффектам во взрослом возрасте, таким как гипертония, метаболический синдром и аллергия [1-3].Эта передача эффектов GC от поколения к поколению в основном опосредуется эпигенетическими механизмами [2, 4, 5]. У животных влияние пренатальной ГК на развитие иммунной системы было оценено в небольших сериях, которые показали, что пренатальная ГК может привести к изменению воспалительных факторов [6, 7] и, таким образом, способствовать нарушению иммунной системы. иммунная система. Однако сообщений о механизме, связанном с пренатальным воздействием ГК и аутоиммунитетом, немного. Передача сигналов GC и глюкокортикоидных рецепторов (GR) играет решающую роль в регуляции иммунной системы.Наши предыдущие исследования показали, что аутоиммунитет тесно связан с устойчивостью к глюкокортикоидам и дисфункцией GR, которые потенциально служат механизмом аутоиммунного заболевания [8, 9]. Взяв эти ключи вместе, мы предполагаем, что пренатальное воздействие ГК может вносить вклад в этиологию аутоиммунного заболевания через эпигенетическую модификацию ГР и глюкокортикоидного ответа [9]. Настоящее исследование было разработано для проверки нашей гипотезы, которая может дать представление о ранней патогенности некоторых аутоиммунных заболеваний (например,g., системная красная волчанка, рассеянный склероз и диабет) и способствуют разработке профилактических и терапевтических стратегий.

2. Материалы и методы
2.1. Дизайн исследования

Все эксперименты проводились в соответствии с руководящими принципами, разработанными Китайским советом по уходу за животными, и протокол был одобрен Комитетом по уходу за животными Университета Сунь Ятсена. Крысы Wistar (200–250 г) и морские свинки (300–500 г) были получены из Университета Сунь Ятсена (Гуанчжоу, Китай) и содержались в помещении для животных при ° C и относительной влажности%, в 12 Цикл ч свет / 12 ч темнота (свет включается в 8 утра и выключается в 8 вечера) с неограниченным доступом к пище и водопроводной воде.Самцов крыс Wistar помещали в клетки с отдельными самками до подтверждения спаривания. После спаривания самок крыс случайным образом разделили на две группы (/ группу): обработанные DEX и обработанные физиологическим раствором. Крысам подкожно вводили дексаметазон натрия фосфат 0,1 мг / кг / сут (Tianxin Pharmaceutical Factory, Китай, с первичной концентрацией 5 мг / мл, разбавленный до 2 мг / мл стерильным физиологическим раствором при использовании, концентрация составляет половину объема инъекции. вес крыс) или физиологический раствор 0,05 мл / кг / день после аурема, от 14 до 20 дней гестации для проведения пренатальной модели воздействия DEX или контроля носителя.Объем инъекции варьировался от 0,15 до 0,19 мл в зависимости от веса крыс.

Щенков определяли по полу при рождении, считали и взвешивали. В каждом помете было выбрано шесть детенышей (3 самца и 3 самки), и все детеныши содержались со своей биологической матерью до отлучения от груди в постнатальный день (PD) 25. На PD50 потомство крыс было случайным образом выбрано для различных экспериментальных процедур. За состоянием здоровья животных следили ежедневно.

Все исследователи были должным образом обучены и имели опыт распознавания знаков, продемонстрированных в эксперименте.Перед любыми пункциями или операциями всех крыс и морских свинок (готовящихся к выделению антигена для индукции ЕАЕ) анестезировали 7% хлоралгидратом, вводимым внутрибрюшинно (0,5 мл / 100 г), и эксперимент начинали только тогда, когда животных подвергали глубокой анестезии. После операции животных помещали в мягкие и чистые клетки и тщательно наблюдали четыре раза в день. Если крысы не могли получить доступ к пище после операции или не могли восстановиться, чтобы встать после экспериментов, они получали конечные точки для человека и их анестезировали с помощью 20% хлоралгидрата (1 мл / 100 г), вводимого внутрибрюшинно.

2.2. Оценка восприимчивости к ЕАЕ

ЕАЕ индуцировали у 10 крыс DEX (5 самцов и 5 самок) и 8 крыс с физиологическим раствором (4 самцов и 4 самки) с использованием ранее установленной процедуры с модификациями [10]. Вкратце, спинной мозг отделяли от морских свинок (g) и гомогенизировали на льду в равном объеме (мас. / Об.) Стерильного физиологического раствора с помощью электронного гомогенизатора. Затем спинной мозг эмульгировали с равным объемом полного адъюванта Фрейнда, содержащего 6 мг / мл убитого нагреванием Butyribacteriumrettgeri (Difco, США) при 4 ° C.На PD50 EAE вызывали подкожной инъекцией эмульсии в объеме 0,1 мл на подушечку во все четыре подушечки стопы. Затем крысам внутрибрюшинно вводили левомизол (10 мг / кг; Sigma-Aldrich, США) через 0, 24 и 48 ч иммунизации. После иммунизации ежедневно исследовали массу тела и неврологические признаки крыс. Клинические баллы этих моделей оценивали по стандартной шкале [11]. На 30 день после иммунизации крыс умерщвляли, и их поясничные связки иссекали для патологического исследования.

2.3. Оценка восприимчивости к AIA

AIA была индуцирована у 11 крыс DEX (6 самцов и 5 самок) и 8 крыс с физиологическим раствором (4 самцов и 4 самки) в соответствии с ранее установленным протоколом с модификациями [12]. Вкратце, на PD50 0,15 мл полного адъюванта Фрейнда, содержащего 10 мг / мл убитого нагреванием M. tuberculosis h47Ra (Chondrex, США), вводили подкожно в подушечку одной задней лапы каждой крысе. Через неделю крысы получили вторую инъекцию того же объема в подушечку другой задней лапы.После второй иммунизации крыс ежедневно осматривали визуально на предмет признаков артрита, эритемы и кожных узелков, особенно на ушах и хвосте. Клинические показатели, включающие артрит и системные симптомы, оценивались по стандартной шкале двумя наблюдателями, не имеющими отношения к информации, позволяющей идентифицировать группу [13]. Максимальные баллы, рассчитанные на пике заболевания путем сложения наибольших баллов для каждого показателя, сравнивались между двумя группами. Через двадцать дней после второй иммунизации крыс умерщвляли и удаляли их суставы для патологического исследования.Все гистологические процедуры были выполнены в гистологической лаборатории Первой дочерней больницы Университета Сунь Ятсена, Китай.

2.4. Анализ чувствительности мононуклеарных клеток периферической крови к GC

Чувствительность мононуклеарных клеток периферической крови (PBMC) к GC оценивали путем измерения их апоптотического ответа на стимуляцию DEX в течение 18 часов. Кровь 15 крыс DEX (7 самцов и 8 самок) и 12 крыс с физиологическим раствором (6 самцов и 6 самок) на PD50 собирали путем пункции сердца в гепаринизированные вакууционеры (BD Biosciences, США).Пункция сердца выполнялась под наркозом путем внутрибрюшинного введения 7% хлоралгидрата (0,5 мл / 100 г). Крысы погибли из-за сердечной пункции, но не от эвтаназии. Мы описали возможность смерти животных без эвтаназии в нашем протоколе исследования, представленном в наш институциональный комитет. PBMC немедленно очищали с помощью Ficoll (KeyGen, Китай) и инкубировали с 10 ммоль / л дексаметазона (Sigma-Aldrich, США, порошок дексаметазона, растворенный в абсолютном спирте) при 37 ° C в увлажненной атмосфере, содержащей 5% CO 2 .Через 18 ч клетки собирали, окрашивали аннексином-V для выявления воздействия фосфатидилсерина на клеточные мембраны (показатель апоптоза) и окрашивали йодидом пропидия (PI; Keygen, Китай) для обнаружения некроза. Окрашивание как аннексином-V, так и PI измеряли с помощью проточного цитометра, оснащенного программным обеспечением CXP (BD Biosciences, США). Чувствительность PBMC к DEX рассчитывали путем вычитания апоптических PBMC в отсутствие стимуляции из чувствительности, наблюдаемой после стимуляции DEX.

2,5. Анализ экспрессии генов, ассоциированных с GR и метилированием.

На PD50 девять крыс DEX и семь крыс с физиологическим раствором были умерщвлены для молекулярного анализа.Тотальную РНК выделяли из PBMC с использованием TRIzol (Takara, Japan) в соответствии с инструкциями производителя. Чистоту и концентрацию РНК определяли на ультрафиолетовом спектрофотометре (NanoDrop, США). кДНК синтезировали из общей РНК с использованием набора реагентов PrimeScript RT (Takara, Япония) и амплифицировали с помощью полимеразной цепной реакции (ПЦР) в двух экземплярах (общий реакционный объем 25 мкл л) с использованием SYBR Premix Ex Taq (Takara, Япония) и ПЦР-циклер Applied Biosystems 7500. Параметры цикла составляли 95 ° C в течение 30 секунд, затем 40 циклов 95 ° C в течение 5 секунд, 59 ° C в течение 30 секунд и 72 ° C в течение 34 секунд, с последним одним циклом 95 ° C в течение 15 секунд, 60 ° C в течение 1 мин и 95 ° C в течение 15 с.Правильный размер каждого продукта ПЦР проверяли по одному пику на кривых плавления. Относительное количество копий мРНК генов-мишеней рассчитывали методом с использованием программного обеспечения SDS 2.0 (Applied Biosystems, США). Ген глицеральдегид-3-фосфатдегидрогеназы (GAPDH) «домашнего хозяйства» использовали в качестве внутреннего контроля. Праймеры для генов, связанных с GR, GAPDH и метилированием, разработанные с помощью программы Primer 5, показаны в таблице 1.

900GACTAG 3 ‘

′ -AACCTTGACTGTAGCTCCTC-3 ′

900CCT GACTCCT RACTAG: 3 ‘

Имя Регистрационный номер Праймеры Длина (п.о.) (° C)

GAPDH NM_017008 F: 5′-GCAAGTTCAACGGCACAG-3 ‘ 140 60.5
R: 5′-GCCAGTAGACTCCACGACAT-3 ‘

GR AJ271870 F: 5′-ACTGCTGGAGGTGATTGA-3′ 157 09 53,2 5′-GTTTCTGAAGCCTGGTAT-3 ‘

Экзон 1-1 AJ271870 F: 5′-CCAGGAAGAAGTTTCAGAT-3′ 195 57
GCTACTAT: -3 ‘

Экзон 1-4 AJ271870 F: 5′ -CCCCAAAGCAACACCGTA-3 ‘ 186 56.1
R: 5′-CAGGGACTTCGTCTCTACCAG-3 ‘

Экзон 1-5 AJ271870 F: 5′-GGCATGCAACTTCCTCCGAGTTTA-3′

9

9

9

9

9

9

9

9

9

9

R: 5′-AGGGCGAAGATGCAGAAACCTTGA-3 ‘

Экзон 1-6 AJ271870 F: 5′-GGGCTCACATTAATATTTTGC-3′ 149 0: 5 ‘ 149 0 ‘-AAACCTTGACTGTAGCTCCTC-3’

Экзон 1-7 AJ271870 F: 5′-AAGAAACTCGGTTTCCCT-3 ‘ 167 55

Экзон 1-8 AJ271870 F: 5′-CGACAGTCGCCAACAGTTAAT-3′ 81 57.3
R: 5′-TGCCAGGGACTTCGTCTCTA-3 ‘

Экзон 1-9 AJ271870 F: 5′-CGGGGACGGATTCTAAT-3′ 164 164 R: 5′-AGATGCAGAAACCTTGACTGT-3 ‘

Экзон 1-10 AJ271870 F: 5′-CGCCGACTTGTTTATCTG-3′ 200 0 53,7 0 53,7

Экзон 1-11 AJ271870 F: 5′-GCCGCAGAGAACTCAACAGT-3 ′ 152 58

Экспрессию белка GR измеряли с помощью вестерн-блоттинга, как описано ранее [8, 14].Равное количество белка (25 мкл г / дорожка) из каждого клеточного лизата отделяли гель-электрофорезом (электрофорез додецилсульфата натрия-полиакриламида) и электрофоретически переносили на поливинилидендифторидные мембраны (Immobilon, Millipore, Billerica, MA, USA). Мембраны блокировали в течение ночи с последующей инкубацией в течение 1-2 часов с антителом, специфически распознающим GR (1 мкМ мкг / мл; номер по каталогу: sc-1004; Santa Cruz Biotechnology, Inc.) и β -актин (Sigma -Олдрич, Св.Луис, Миссури). Антитело GR распознало N-конец клона GR- α . После промывки блоты затем инкубировали с вторичным антикроличьим антителом, связанным с пероксидазой (1: 20 000; Sigma-Aldrich, Сент-Луис, Миссури). После трехкратной промывки TBS-T комплексы антиген-антитело на мембранах были обнаружены 3,3-диаминобензидином (Sigma-Aldrich, Сент-Луис, Миссури, США). Измерение денситометрии (интегрированное значение плотности IDV) использовали для сравнения данных вестерн-блоттинга (Alpha Innotech, Сан-Леандро, Калифорния).

2.6. Анализ метилирования ДНК

Геномную ДНК выделяли из крови с помощью набора для экстракции ДНК (Omega, США). Концентрацию и качество ДНК измеряли с помощью ультрафиолетового спектрофотометра (NanoDrop, США). Метилирование ДНК NR3C1 внутри экзонов 1-4, 1-5, 1-6, 1-7, 1-10 и 1-11, интронов между экзоном 1 и интрона, предшествующего экзону 2, было обнаружено с использованием метода метилирования Sequenom MassARRAY ( Boao Biotechnology Company, Китай), как описано ранее [15]. Праймеры были разработаны с использованием Epidesigner (http: // www.epidesigner.com). К 5′-концу смысловых праймеров добавляли 10-мерную метку для балансировки реакции ПЦР, а последовательность промотора Т7 добавляли к 5′-концу антисмысловых праймеров для последующей транскрипции in vitro. Все праймеры показаны в таблице 2. Поскольку экзон 1 содержит большое количество сайтов CG (207), которые создают препятствия при разработке праймеров, мы разделили эту область на следующие семь частей, а затем протестировали каждую часть отдельно: ген 1, соответствующий промотор экзона 1-4; ген 2, соответствующий экзону 1-4 и промотору экзона 1-5; ген 3, соответствующий промотору как экзона 1-5, так и экзона 1-6; ген 4, соответствующий промотору как экзона 1-6, так и экзона 1-7; ген 5, соответствующий части экзона 1-10 и промотору экзона 1-11; ген 6, соответствующий промотору как экзона 1-11, так и экзона 2; и ген 7, соответствующий промотору экзона 2 (таблица 2).

AACAACAactActAggAgaactaCagtaCagtaCagAagAgaAga 900ACTATCAGCAGCAGCATCATCACCTACT

AcagactAcTACT

R: 5g’cagactAcTAC


Имя Праймеры Длина (п.о.) Сайты CG Регион

Ген 1 F: 5′-ТАГТАГАГАГАГТТААГТГТГТГА ‘ 455 24 Промотор экзона 1-4
R: 5’cagtaatacgactcactatagggagaaggctATAACCATAACTCCACCTCATNACC-3′
Ген 2 90TGATGATG5
990TGATGATGATGATGATGAT 9 900TGATGATGATGATGAT 9 Экзон 1-4 и промотор экзона 1-5
R: 5’cagtaatacgactcactatagggagaaggctTTTCTAAATTCCAAAAACCCCTCTA-3 ‘
Ген 3 F: 5’cagtaatacgactcactatagggagaaggctTTTCTAAATTCCAAAAACCCCTCTA-3′
Ген 3 F: 5’TTT’-aggaagag10TGAAGT9

Промотор как экзона 1-5, так и экзона 1-6
R: 5’cagtaatacgactcactatagggagaaggctAATTACAAAACAAAACCCACCCT-3 ’90 089
Ген 4 F: 5′-aggaagagagGGTGGGTTTTGTTTTTGTAATTTTT-3 ‘ 459 45 Промотор как экзона 1-6, так и экзона 1-7 900TATTATTTTTTTTTcTacTagCTC89RTacg’cagTCTC89: 5’cagCagTCTC
Ген 5 F: 5′-aggaagagagTTTTTTTATGGAGAAGAGGGGG-3 ‘ 428 50 Часть экзона 1-10 и промотора экзона 1-11
Ген 6 F: 5′-aggaagagagGTTTTTTTTGGTTTTTGTTTTTGT-3 ‘ 448 26 Промотор как экзона 1-11, так и экзона 2
R: 5g’cagactCATCACTACCATCA

R: 5g’cagactCATCT

Ген 7 F: 5′-aggaagagagTTGATTTTTTTGAGTGGTTTTTTTTT-3 ‘ 498 18 Промотор экзона 2
R: 5’c agtaatacgactcactatagggagaaggctAAATCCCCAATACAATAATAAACTTTTCC-3 ‘

2.7. Статистический анализ

Все расчеты были выполнены с использованием статистического программного обеспечения SPSS V.13.0 (Чикаго, Иллинойс, США). Непарный критерий Стьюдента t или непараметрический критерий Манна – Уитни применяли, когда групповые дисперсии не были равны или данные не были нормально распределены, для сравнения средних значений двух групп. При анализе пропорциональных данных использовался критерий хи-квадрат. Рисунки были нарисованы с использованием Graphpad Prism 5 (GraphPad Software Inc., Сан-Диего, Калифорния, США). Значение меньше 0.05 считалось значительным.

3. Результаты
3.1. Характеристики при рождении

Размер помета и соотношение полов не различались между группой DEX и контрольной группой (размер помета по сравнению с соотношением самок и самцов). Однако по сравнению с крысами, получавшими физиологический раствор, крысы DEX при рождении были меньше по весу (по сравнению с g,).

3.2. Восприимчивость к EAE и AIA

По сравнению с крысами, получавшими физиологический раствор, крысы DEX с EAE показали более высокую заболеваемость (100% против 62,5%), более раннее проявление симптомов (12 дней против 13 дней).5 г,), более высокий клинический балл на пике заболевания (4,75 против 1,93,, рисунок 1 (а)) и более серьезные патологические результаты (рисунки 1 (б) и 1 (с)). Таким образом, крысы DEX были более восприимчивы к EAE, чем крысы с физиологическим раствором.

По сравнению с крысами, получавшими физиологический раствор, крысы DEX с AIA демонстрировали большую заболеваемость, измеренную как артрит передних конечностей и системное воспаление, чем крысы, получавшие физиологический раствор (63,6% против 0%). Клиническая оценка и патологические проявления крыс DEX на пике заболевания также были выше, чем у крыс, получавших физиологический раствор (9.72 по сравнению с 7.0« Рисунки 1 (d), 1 (e) и 1 (f)). Кроме того, сразу после введения антигена очаговые воспалительные реакции у крыс DEX были более серьезными, чем у крыс с физиологическим раствором. Время начала и заболеваемость артритом задних конечностей существенно не различались между двумя группами. В совокупности эти наблюдения показывают, что крысы DEX были более восприимчивы к AIA, чем крысы с физиологическим раствором.

3.3. Чувствительность PBMC к GC

Стимуляция PBMC от крыс DEX и крыс с физиологическим раствором с той же концентрацией дексаметазона в течение того же периода вызвала меньший апоптоз у крыс DEX (средняя скорость апоптоза 13.30%), чем у крыс с физиологическим раствором (средняя скорость апоптоза 19,15%). Таким образом, чувствительность PBMC крыс DEX к GC была ниже, чем у крыс с физиологическим раствором.

3.4. Экспрессия GR в PBMC

Поскольку этот ген GR содержит 11 нетранслируемых альтернативных первых экзонов и каждый экзон процессируется отдельным промотором, в нашем исследовании оценивали общую мРНК GR и экспрессию каждого экзона 1. Наши данные показали, что общий GR, экзон 1-1, экзон 1-6, экзон 1-10 и экзон 1-11 в PBMC были ниже у крыс DEX, чем у крыс с физиологическим раствором () (рис. 2 (а)).Эти результаты были дополнительно подтверждены Вестерн-блоттингом, поскольку белок GR погиб у крыс DEX (Фигуры 2 (b) и 2 (c)).

3.5. Анализ метилирования ДНК

Уровень метилирования 207 сайтов CG, обнаруженных в 7 областях экзона 1 GR, находится в диапазоне от 0 до 0,83, в большинстве случаев менее 0,3. На большинстве участков уровни метилирования существенно не различались между DEX и крысами, получавшими физиологический раствор. Однако в области промотора экзона 1-10 и экзона 1-11 крысы DEX показали более высокие уровни метилирования, чем крысы, обработанные физиологическим раствором (рис. 2 (d)).

4. Обсуждение

Неблагоприятные события в раннем периоде жизни и их долгосрочные последствия привлекают все больше и больше внимания в последние годы. И развитие эпигенетической теории и технологий продвинуло наше понимание в этой области [16, 17]. Предполагается, что забота о матери, стресс и введение экзогенных глюкокортикоидов оказывают сильное влияние на здоровье потомства [18, 19]. Однако имеется мало сообщений о пренатальном воздействии DEX и его долгосрочных программных эффектах аутоиммунитета.Здесь мы оценили иммунное программирование под влиянием пренатального DEX-лечения и роль GR в этом процессе.

Для проверки нашей гипотезы беременным крысам линии Wistar подкожно вводили DEX. Крысы Wistar широко используются в токсикологии, тератологии, экспериментальной онкологии, экспериментальной геронтологии, исследованиях сердечно-сосудистой системы и иммунологии [6, 20]. Крысы имеют короткое и ускоренное детство по сравнению с людьми и становятся половозрелыми примерно в 6-недельном возрасте [5]. При рассмотрении различных фаз жизни крысы мы выбрали 50-й день крысы для представления взрослых стадий.Две экспериментальные модели аутоиммунного заболевания, EAE и AIA, были выполнены на потомстве крыс в зрелом возрасте. Поскольку половые гормоны в некоторой степени влияют на развитие аутоиммунных заболеваний, мы попытались уравнять соотношение женщин и мужчин между группами, чтобы избежать возможной путаницы, связанной с различием полов [21]. Гистопатологический и клинический анализ оценок между группами в моделях EAE и AIA также предоставил доказательства того, что введение DEX во время беременности увеличивало восприимчивость к аутоиммунным заболеваниям у потомства, поскольку группа DEX показала более тяжелые гистопатологические проявления и клинические признаки.Во время беременности ГК часто назначают, когда ожидаются преждевременные роды, что успешно стимулирует развитие легких плода. Однако появляющиеся данные указывают на то, что пренатальное воздействие ГК может привести к длительным побочным эффектам у потомства. В нашей модели на животных общая доза дексаметазона, используемая у крыс, намного выше, чем доза, используемая при преждевременных родах, из-за непрерывного введения DEX до 7 дней. Воздействие пренатальных ГК существовало не только при лечении преждевременных родов, но и у матерей с различными пренатальными стрессами [17, 22].Чтобы охватить различные виды пренатального воздействия ГК, мы продлили период применения DEX. Наши результаты также показали, что частота аутоиммунных заболеваний (как EAE, так и AIA) увеличивается в группе DEX. Эти результаты подтверждают нашу первоначальную гипотезу о том, что пренатальное воздействие ГК увеличивает восприимчивость к аутоиммунным заболеваниям.

Для дальнейшего изучения механизмов, вызывающих такие эффекты, во-первых, мы протестировали апоптотические ответы PBMC от крыс с DEX и физиологическим раствором на стимуляцию дексаметазоном.PBMC, которые в основном представляют собой лимфоциты и моноциты, являются клетками-мишенями иммуномодуляции и исполнительными органами иммунного ответа. Сообщалось, что снижение ответа GC в PBMC тесно связано с аутоиммунитетом [23]. Наши эксперименты показали, что дексаметазон индуцировал меньшее увеличение апоптоза в PBMC от крыс DEX, чем у крыс с физиологическим раствором, что указывает на то, что PBMC от крыс DEX были более устойчивы к DEX. GC физически связывается с GR в иммунных органах и клетках, вызывая апоптоз и тем самым подавляя иммунную реакцию.Снижение глюкокортикоидного ответа в основном вызвано дисфункцией и аномальной экспрессией GR. Итак, мы проанализировали экспрессию GR в PBMC крыс. Согласно измерениям с помощью ПЦР в реальном времени и вестерн-блоттинга, общая экспрессия GR у крыс DEX значительно снижена, что свидетельствует о дифференциальном ответе клеток на GC. В публикациях Лу и Цидловски указано, что множественные функциональные внутренние кодоны инициации трансляции ATG для GR приводят к множественным формам белка GR, а GR-B, GR-C и GR-D могут составлять до 50% от общего транслируемого белка Gr альфа. изделия [24, 25].Однако мы обнаружили только одну полосу на нашем участке из-за антител, использованных в нашем исследовании. Клон M20, используемый в этом исследовании, имеет эпитоп в N-концевой области GR, который не присутствует в изоформах GR-B, GR-C и GR-D. С помощью этого антитела мы обнаружили только основную изоформу (GR-A), но не все изоформы GR. Невозможность обнаружить эти более короткие изоформы GR является ограничением нашего исследования. Поскольку этот экзон1 GR содержал большое количество сайтов CG и дифференцированно регулировал экспрессию GR, различные фрагменты экзона 1, богатые сайтами CG, также измеряли с помощью ПЦР в реальном времени.Наши результаты показали, что экзон 1-6, экзон 1-10 и экзон 1-11 в PBMC были ниже у крыс DEX, чем у крыс с физиологическим раствором. Эти результаты показывают, что снижение экспрессии GR может быть вызвано метилированием экзона 1 GR. Мы исследовали метилирование ДНК экзона 1 в гене NR3C1, которое включает 207 сайтов CG, покрывающих экзоны 1-4, 1-5, 1-6, 1-7, 1-10 и 1-11 и интроны между ними (заполнены интенсивный дизайн праймера для предотвращения GC, другие сайты не обнаружены), и сравнили уровень их метилирования в PBMC у крыс с физиологическим раствором и DEX.Мы обнаружили, что область, обогащенная сайтами CG, которая распространялась от экзона 1-10 до экзона 1-11, была по-разному метилирована у крыс с DEX и физиологическим раствором. Хотя точный механизм того, как эта область контролирует транскрипцию GR, все еще неизвестен, обычно считается, что гиперметилирование в этой области приводит к ингибированию транскрипции [26, 27]. В настоящее время сообщения о пролонгированном влиянии пренатальных ГК на уровень метилирования иммунных клеток немногочисленны. Однако пренатальный стресс или воздействие GC могут изменить уровень метилирования гена GR в гиппокампе, букке и почках, что также подтверждает наши результаты [19, 28, 29].Наши данные добавили к текущей литературе, что пренатальное воздействие GC изменяет уровень метилирования GR и вызывает снижение экспрессии GR и ответа GC в PBMC, что тесно связано с развитием аутоиммунитета.

В заключение, мы обнаружили, что пренатальное воздействие ГК увеличивает восприимчивость к аутоиммунитету, который потенциально вызван эпигенетически запрограммированной экспрессией ГР и ответом на глюкокортикоиды.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Вклад авторов

Яньхун Сунь и Сяоянь Ван внесли равный вклад в эту работу.

Благодарности

Это исследование было поддержано грантами NSFC (Фонд естественных наук Китая) (№ 81072490 и № 81101316).

Исследование множественных констант связывания дексаметазона с сывороточным альбумином человека с помощью капиллярного электрофореза — фронтального анализа и многомерной регрессии

  • 1.

    Holford NHG, Benet LZ, Katzung BG (1998) Основная и клиническая фармакология, 7-е изд.Эпплтон и Ланге, Стэмфорд

    Google Scholar

  • 2.

    Su TJ, Lu JR, Cui ZF, Thomas RK (2000) J Membrane Sci 173: 167–178

    Google Scholar

  • 3.

    Gonzalez-Alonso I, Sanchez-Navarro A (1998) Biofarmacia y farmacocinética II. Síntesis, Madrid, p 467

  • 4.

    Evans WE, Schentag JJ, Jusko WJ, Relling MV (1992) Прикладная фармакокинетика — принципы терапевтического мониторинга лекарственных средств.Братья Эдвардс, Ванкувер

    Google Scholar

  • 5.

    Kwong TC (1985) Clin Chim Acta 151: 193

    Статья
    CAS

    Google Scholar

  • 6.

    Курц Х. (1986) Связывание с лекарственным белком. Praeger, New York

  • 7.

    Ascoli G, Bertucci C, Salvadori P (1995) J Pharm Sci 84: 737

    Article
    CAS

    Google Scholar

  • 8.

    He X, Munson SH, Twigg PD, Gernert KM, Broom MB, Miller TY, Carter DC (1989) Science 244: 1195

    Статья

    Google Scholar

  • 9.

    Birkett DJ, Wade DN, Sudlow G (1976) Mol Pharmacol 12: 1052

    Google Scholar

  • 10.

    Heegaard NHH, Kennedy RT (1999) Electrophoresis 20: 3122–3133

    Article
    CAS

    Google Scholar

  • 11.

    Kraak JC, Busch S, Poppe H (1992) J Chromatogr 608: 257–264

    Статья
    CAS

    Google Scholar

  • 12.

    Busch MHA, Carels LB, Boelens HFM, Kraak JC, Poppe H (1997) J Chromatogr A 777: 311–328

    Артикул
    CAS

    Google Scholar

  • 13.

    Tanaka Y, Terabe S (2002) J Chromatogr B 768: 81–92

    Статья
    CAS

    Google Scholar

  • 14.

    Saux TL, Varenne A, Perreau F, Siret L, Duteil S, Duhau L, Gareil P (2006) J Chromatogr A 1132: 289

    Артикул

    Google Scholar

  • 15.

    Yan W, Colyer CL (2006) J Chromatogr A 1135: 115–121

    Статья
    CAS

    Google Scholar

  • 16.

    Мартинес-Гомес М.А., Саградо С., Вильянуэва-Каманас Р.М., Медина-Эрнандес М.Дж. (2006) Электрофорез 27: 3410–3419

    Статья

    Google Scholar

  • 17.

    Martínez-Gómez MA, Carril-Aviles MM, Sagrado S, Villanueva-Camanas RM, Medina-Hernández MJ (2007) J Chromatogr A 1147: 261–269

    Статья

    Google Scholar

  • 18.

    Yu XM, Zhao P, Zhang WB, Zhang LH, Zhang YK (2007) J Pharm Biomed Anal 45: 701–705

    Статья
    CAS

    Google Scholar

  • 19.

    Jensen H, Ostergaard J, Thomsen AE, Hansen SH (2007) Electrophoresis 28: 322–327

    Article
    CAS

    Google Scholar

  • 20.

    Jensen H, Ostergaard J, Hansen SH (2007) Электрофорез 28: 2975–2980

    Статья
    CAS

    Google Scholar

  • 21.

    Zhou N, Liang YZ, Wang B, Wang P, Chen X, Zeng MM (2008) Biomed Chromatogr 22: 223–231

    Статья
    CAS

    Google Scholar

  • 22.

    Лу QH, Ba CD, Chen DY (2008) J Pharm Biomed Anal 47: 888–891

    Статья
    CAS

    Google Scholar

  • 23.

    Лю X, Чен X, Юэ Y, Zhang J, Song Y (2008) Электрофорез 29: 2876–2883

    Google Scholar

  • 24.

    Клотц И.М., Ханстон Д.Л. (1971) Биохимия 10: 3065

    Статья
    CAS

    Google Scholar

  • 25.

    Klotz IM, Hunston DL (1975) J Biol Chem 250: 3001–3009

    CAS

    Google Scholar

  • 26.

    Klotz IM, Hunston DL (1984) J Biol Chem 259: 10060–10062

    CAS

    Google Scholar

  • 27.

    Klotz IM (1993) Proc Natl Acad Sci USA 90: 7191–7194

    Статья
    CAS

    Google Scholar

  • 28.

    Klotz IM (1996) Proc Natl Acad Sci USA 93: 14411–14415

    Article
    CAS

    Google Scholar

  • 29.

    Huang Y, Zhang Z (2004) J Pharm Biomed Anal 35: 1293–1299

    Статья
    CAS

    Google Scholar

  • 30.

    Gao ZB, Ding PT, Xu H, Zhang L, Wei J, Chen DW (2007) Pharmazie 62: 115–116

    CAS

    Google Scholar

  • 31.

    Scatchard G (1949) Ann NY Acad Sci 51: 660

    Google Scholar

  • 32.

    Zhou D, Li F (2004) J Pharm Biomed Anal 35: 879–885

    Статья
    CAS

    Google Scholar

  • Ионтофорез в обезболивании

    Было показано, что ионтофорез в сочетании с другими консервативными методами лечения и вмешательствами эффективно устраняет болезненные симптомы, связанные с поверхностными тканевыми структурами, у самых разных пациентов.

    Есть несколько распространенных методов, которые врачи используют для приема лекарств. Один из методов, который набирает популярность, — это трансдермальная доставка лекарств. К неотъемлемым преимуществам этого метода относится возможность использования широкого спектра соединений, обладающих обезболивающим или противовоспалительным действием, которые наносятся непосредственно на целевую область. Это позволяет использовать меньшую дозу лекарства, чем потребовалось бы при других способах введения. Это меньшее количество лекарств снижает вероятность побочных эффектов лекарств — всегда желаемый результат.

    В этой статье основное внимание будет уделено ионофорезу, форме трансдермальной доставки лекарств (TDD), которая использует электрический ток для продвижения или проталкивания ионизированных лекарств через самый внешний слой кожи (роговой слой), который обычно является основным барьером для транспорта лекарств. Используя правило «любит отталкивать», практикующий выбирает лекарства, совместимые с используемым активным полюсом, так что положительно заряженное лекарство загружается в положительную сторону подушки доставки или электрода. Поскольку одинаковые заряды отталкиваются, положительно заряженные молекулы проходят через кожу под действием положительного тока, а отрицательно заряженные лекарства проникают под отрицательный полюс.Как только лекарство проходит через кожный барьер, естественная диффузия и местная циркуляция (перфузия) вступают во владение и в конечном итоге определяют, как лекарство распределяется.

    Общие способы применения ионофореза

    В реабилитационной медицине, включая физиотерапию, ионтофорез используется для уменьшения воспаления, которое может наблюдаться при заболеваниях опорно-двигательного аппарата, таких как латеральный эпикондилит, медиальный эпикондилит, подошвенный фасциит, тендонит / бурсит, ревматоидный артрит. энтезопатические состояния различного происхождения.Самым популярным и хорошо изученным методом ионофореза является использование дексаметазона, кортикостероида в растворе фосфата натрия. В этой форме лекарство состоит из отрицательно заряженных ионов дексаметазонфосфата, и при загрузке в отрицательно заряженный резервуар или электродную площадку электрическая сила подобных зарядов толкает молекулы лекарства в желаемую область. Есть два обычно используемых способа применения ионтофореза; Первый — это традиционный метод использования генератора тока с подводящими проводами, подключенными к активной площадке и диспергирующей площадке (см. рисунок 1).Лекарство загружается в активную подушечку обычно с помощью шприца. Диспергирующая подушка является полярно противоположной подушкой и расположена вдали от места лечения. Лечение проводится клинически по 15-20 минут на сеанс. В условиях физиотерапии ионтофорез обычно является одним из нескольких применяемых лечебных вмешательств, поэтому добавление еще 15-20 минут к ранее существовавшей 60-минутной программе для некоторых пациентов является бременем времени. Один производитель ионтофореза отреагировал на эту ситуацию, представив более мобильное решение для лечения ионтофорезом — продаваемое под торговой маркой IontoPatch® — которое пациент может носить в течение 24-часового периода.Таким образом, клинический временной компонент этого лечения полностью исключается, и пациент получает более устойчивый 24-часовой эффект. Эти мобильные IontoPatches содержат небольшую плоскую батарею, которая обеспечивает крошечный электрический «толчок» целевого лекарства (например, дексаметазона; см. Рисунок 2).

    Рис. 1. — иллюстрация типичной системы клинического ионтофореза с генератором тока и двумя проводами и электродами (положительно-красным и отрицательно-отрицательным). На этой иллюстрации пациент получает дексаметазон 4 мг / мл в водном растворе, который направляется от отрицательного полюса (черный) через болезненную латеральную надмыщелковую область локтя (теннисный локоть).Используемое устройство представляет собой систему доставки лекарств Phoresor® PM900. Фото любезно предоставлено корпорацией Iomed.

    Период дозирования, рекомендуемый для ионтофореза, рассчитывается на основе величины протекающего тока вместе с истекшим временем лечения. Доза выражается в миллиампер-минутах (мА-мин) с рекомендуемой дозой в миллиампер-минуте в зависимости от используемого электрода. Для большинства электродов, используемых сегодня, типичная дозировка составляет 40 мА · мин и может быть доставлена ​​разными способами, если произведение двух членов равно 40 (например.g., 4 мА x 10 минут или 2 мА x 20 минут и т. д.). Настройка тока выбирается в зависимости от комфорта пациента, и после определения величины тока генератор тока выбирает соответствующее количество времени, необходимое для достижения предварительно установленной дозы в мА-мин. При использовании мобильных патчей ток в микроампер используется в течение гораздо более длительных периодов времени.

    Электродные пластыри имеют уникальный состав, который позволяет ионам перемещаться в ткани кожи человека. Один пластырь, например, состоит из встроенных электродов из цинка и хлорида серебра и активируется, когда лечебный раствор, омывающий один электрод, вступает в контакт с физиологическим раствором, омывающим противоположный электрод.Это создает необходимый заряд, чтобы направить молекулы в ткани-мишени. Пластыри состоят из полупроницаемой адгезивной мембраны, которая должна плотно прилегать к коже для оптимального проникновения.

    Ионтофорез при воспалении

    Существует ряд лекарств, которые можно вводить в подкожные ткани, включая стероиды, НПВП, местные анестетики, салицилаты и отдельные вещества, такие как оксид цинка, йод, уксусная кислота и хлорид кальция. немного.Список наиболее часто используемых лекарств и их применения см. В Таблице 1. Считается, что дексаметазон (DEX) может проникать в ткани на глубину до 20 мм, причем концентрация в тканях экспоненциально уменьшается с глубиной ткани. Недавно были определены другие факторы, определяющие доставку лекарств, включая отношение размера пор кожи к размеру молекулы лекарственного средства, полярность и важность напряженности электрического поля. 1 Исследования показывают, что увеличение плотности тока под мембраной может вносить лишь определенный вклад в общее поглощение конкретной молекулы лекарства, при этом пассивный поток растворителя отвечает за значительную часть общего поглощенного количества. 2 Чем более поверхностна структура-мишень, тем больше лекарственного средства будет доступно для взаимодействия. И наоборот, чем глубже структура, тем меньше вероятность терапевтического взаимодействия, поскольку лекарство становится более разбавленным по мере увеличения расстояния между электродом и тканью-мишенью. Это делает ионофорез предпочтительным для лечения поверхностных структур мягких тканей.

    Кортикостероиды — это основные препараты, используемые с ионофорезом в физиотерапии и реабилитационной медицине в целом.Молекула кортикостероида, представленная в виде водорастворимой соли, имеет отрицательный заряд, поэтому необходимо использовать резервуар с лекарством на отрицательном электроде. При применении лечения ионтофорезом обрабатываемая область должна быть очищена или обработана спиртом, а затем активный электрод размещен как можно ближе к целевой области. Как и при любой лекарственной терапии, клиницист должен обсудить с пациентом возможные противопоказания и побочные эффекты до начала лечения. Кроме того, важно проверить обрабатываемую область, чтобы убедиться, что кожа не повреждена и не повреждена.Другой электрод размещается на расстоянии 4-6 дюймов при использовании типа блока электрогенератора (с выводами и электродами). При использовании IontoPatch расстояние между электродами устанавливается заранее и не имеет значения. Затем врач устанавливает желаемую электрическую дозу (в мА-мин) на уровне, удобном для пациента. Несмотря на то, что после сеанса лечения обычно появляется некоторая эритема на участках электродов, после процедуры следует осмотреть кожу, чтобы убедиться, что не произошло ожогов. Не рекомендуется одновременно прикладывать тепло или лед как к электроду, так и к коже, поскольку и то, и другое значительно изменяет кровоток и уровни чувствительности кожи — и то и другое должно быть на нормальном уровне для безопасного лечения.Это относится как к клинической, так и к домашней (IontoPatch) версии этого лечения. Следует соблюдать аналогичные меры предосторожности при трансдермальной доставке опиоидных препаратов, таких как пластырь с фентанилом, особенно в отношении воздействия тепла или холода на пластырь. В отличие от рецептурных лекарств TDD, использование ионофореза не влияет на одновременный прием других системных лекарств. Одно из преимуществ ионтофоретических препаратов заключается в том, что они доставляются локально, а не системно, поэтому побочные реакции и взаимодействия с ними сводятся к минимуму.При ионофорезе количество лекарства, необходимое для уменьшения воспаления в данной области, намного меньше, чем при пероральном приеме.

    Рис. 2. На этой иллюстрации изображен пациент, недавно перенесший тотальное эндопротезирование коленного сустава и страдающий от боли в медиальном колене, который лечится с помощью новой, автономной формы ионтофореза (IontoPatch® от Iomed Corp). Отрицательный полюс проталкивает дексаметазон локально в воспаленную медиальную околосуставную ткань для облегчения боли.Фото любезно предоставлено корпорацией Iomed.

    Кальцифицирующие отложения

    В последнее время было много споров относительно эффективности ионтофоретической доставки уксусной кислоты (уксуса) при таких состояниях, как кальцинозный тендинит надостной мышцы (CST). Это состояние, по сути, представляет собой отложение кристаллов кальция в матрице вещества сухожилия общей вращательной манжеты. Для обнаружения отложений карбоната кальция использовались УЗИ и МРТ. В течение многих лет постулировалось, что нанесение уксусной кислоты на пораженную ткань может оказывать положительное влияние на это состояние за счет превращения карбоната кальция в цитрат кальция, гораздо более растворимое соединение, которое легче усваивается местным кровообращением. .Справедливость этого утверждения продолжает оставаться предметом исследования, как и утверждение о том, что кальцинированные отложения обязательно являются причиной боли в плече. Однако исследования показывают, что это не всегда так. 3-5

    Таблица 1. Ионтофорез Перекрестная ссылка
    Лекарство Заряд +/- Состояние
    Уксусная кислота Отрицательный Отложения кальция
    Хлорид Отрицательный Рубцовая ткань
    Дексаметазон Отрицательный Воспаление-тендинит / бурсит
    Кальций Положительный Мышечный спазм / мышечная дисфункция
    Гидрокортизон Положительный стероид

    Оксид цинка Положительный Антисептик / заживление ран
    Салицилаты Отрицательный Артралгия / миалгия
    Лидокаин Положительный Теносиновит
    Сульфат атропина Положительный Гипергидроз
    Магний Положительный Миорелаксант
    Оксид цинка Положительный антисептик Заживляющий антисептик W

    Частота кальцификации вращательной манжеты плеча без симптомов плеча в общей популяции составляет 3-20% по разным данным.Самый высокий уровень заболеваемости у взрослых в возрасте от 30 до 50 лет. Общая заболеваемость кальцифицирующим тендинитом снизилась за последние несколько десятилетий. Эпидемиология этого состояния, по-видимому, в большей степени благоприятствует женщинам, чем мужчинам, и чаще проявляется в доминирующем плече. Отложения обычно появляются на расстоянии 1-2 см проксимальнее от места прикрепления вращательной манжеты на большем бугорке плечевой кости. Нехирургическое лечение остается стандартом лечения, и отчеты показывают, что консервативные методы, такие как ультразвук, холодный лазер, ионтофорез, фонофорез и лечебные упражнения, могут в конечном итоге привести к полному восстановлению функции. 6

    Заключение

    Ионтофорез — это эффективный и хорошо переносимый метод доставки ионизированных лекарств через дерму с использованием контролируемого электрического тока. Этот метод лечения приносит пользу при широком спектре заболеваний опорно-двигательного аппарата. В физиотерапии использование дексаметазона при воспалениях и уксусной кислоты при отложениях кальция использовалось в течение многих лет во многих клинических условиях. Было показано, что ионтофорез в сочетании с другими консервативными методами лечения и вмешательствами эффективно справляется с болезненными симптомами, связанными с поверхностными тканевыми структурами, у самых разных пациентов.

    Благодарность

    Мы благодарим корпорацию Iomed за предоставленные фотографии Companion 80 Ionto-Patch®, описанные в этой статье.

    Последнее обновление: 21 февраля 2011 г.

    Гистологические и генетические исследования действия дексаметазона на вилочковую железу взрослого самца крысы-альбиноса

    Несмотря на то, что глюкокортикоиды обладают хорошо известным иммунодепрессивным действием, мало что известно об их индукции гибели лимфоидных клеток посредством активации запрограммированной гибели клеток, известной как апоптоз.Эта работа была предпринята с целью изучения гистологических и генетических изменений вилочковой железы крыс-альбиносов после введения и отмены дексаметазона с использованием различных доз. В настоящем исследовании использовались 36 взрослых крыс-самцов-альбиносов весом 180-200 г. Крысы были разделены на три равные группы [по 12 животных в каждой]. Группа I [контроль], ежедневно внутрибрюшинно [IP] вводили 1 мл дистиллированной воды. Группа H, ежедневно вводившая [IP] низкую дозу дексаматазона [1 г / кг b.w.] в течение семи дней и группе III ежедневно вводили [IP] высокую дозу дексаматазона [2 г / кг b. w.] в течение семи дней. Образцы были взяты через день после 1-й, 3-й и 7-й инъекции, и по 3 животных из каждой группы были оставлены на выздоровление и умерщвлены через семь дней после прекращения лечения. От каждого образца часть была взята для гистологического и иммуногистохимического исследований под световой микроскопией, а другая часть была обработана для гель-электрофореза. Гистологические результаты продемонстрировали апоптотические изменения тимоцитов после однократного приема дексаметазона, более выраженные при повышении дозы.В коре головного мозга наблюдалась агрегация апоптотических лимфоцитов и множество крупных макрофагов, поглощающих апоптотические материалы. Апоптотические изменения были подтверждены положительной реакцией на иммунную активность Fas-лиганда после однократной инъекции дексаметазона. Тяжелая атрофия железы чаще наблюдалась при высокой дозе, когда кора головного мозга казалась обедненной лимфоцитами. Отмена препарата выявила значительную степень разрешения. Лимфоциты выглядели морфологически нормальными с разбросом их ядерного хроматина.Наши результаты были подтверждены результатами, полученными с помощью гель-электрофореза, который показал лестницы ДНК после одного дня инъекции как в низких, так и в высоких дозах и полное исчезновение лестниц после семи дней лечения и у выздоровевших животных. На основании этого исследования был сделан вывод, что дексаметазон индуцировал апоптотические изменения в тимоцитах на ранней стадии после короткого периода введения, и эти изменения были временными и дозозависимыми с периодами восстановления, пропорциональными дозе

    .

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *