Миссенс мутации это: мутация — это… Что такое Миссенс-мутация?

Содержание

мутации — это… Что такое Миссенс-мутации?

Миссенс-мутации
Миссенс-мутации

мутации, возникающие в результате замены оснований в вирусном геноме. М.-м. можно определить по изменению белка, кодируемого мутированным геном, или по изменению функции, связанной с измененным белком.

(Источник: «Словарь терминов микробиологии»)

.

  • Миокамицин
  • Митоген

Смотреть что такое «Миссенс-мутации» в других словарях:

  • Миссенс-мутация — точечная мутация, в результате которой измененный кодон начинает кодировать другую аминокислоту. В зависимости от того, насколько различаются свойства белков, синтезированных на основе измененных кодонов, от свойств изначальных протеинов,… …   Википедия

  • миссенс-супрессия — Форма супрессии, при которой супрессорной мутацией является миссенс мутация; при внутригенной супрессии она может, изменяя мутировавший кодон, обеспечивать включение в мутантный сайт более подходящей аминокислоты, чем у исходных мутантов… …   Справочник технического переводчика

  • Мутации точковые — * мутацыі кропкавыя * point mutations 1. Нормально менделирующие мутации, не связанные со структурными изменениями хромосом и с нарушениями процесса кроссинговера (см.). М. т. это мутации генные, при которых происходит замена (. Трансверсия),… …   Генетика. Энциклопедический словарь

  • МУТАЦИИ — (от лат. mutatio изменение), внезапные (скачкообразные) естественные или вызванные искусственно наследуемые изменения генетич. материала (генома), приводящие к изменению тех или иных признаков организма. Различают генеративные М., возникающие в… …   Химическая энциклопедия

  • Мутации — Эта статья о термине из области биологии, см. также Мутация (значения) Главный мутаген табачного дыма  бензопирен  связанный с одним из нуклеотидов молекулы ДНК. Мутация  стойкое (то есть такое, которое может быть унаследовано потомками данной… …   Википедия

  • миссенс-супрессия — missense suppression миссенс супрессия. Форма супрессии, при которой супрессорной мутацией является миссенс мутация <missense mutation>; при внутригенной супрессии она может, изменяя мутировавший кодон, обеспечивать включение в мутантный… …   Молекулярная биология и генетика. Толковый словарь.

  • гормоны — * гармоны * hormones высокоспецифичные биологически активные органические вещества, являющиеся регуляторами важнейших жизненных процессов. Г. вырабатываются в организме высокоспециализированными клетками или органами (эндокринными железами, или… …   Генетика. Энциклопедический словарь

  • дефицит глюкозо-6-фосфатдегидрогеназы — glucose 6 phosphate dehydrogenase deficiency, G 6 PD deficiency дефицит глюкозо 6 фосфатдегидрогеназы. Cиндром врожденной недостаточности фермента глюкозо 6 фосфатдегидрогеназы (Г6ФДГ), обусловливающий избыточный, индуцируемый лекарственными… …   Молекулярная биология и генетика. Толковый словарь.

  • гемоглобин Констант-Спринг — hemoglobin Constant Spring гемоглобин Констант Спринг. Клиника нормальная; α цепь состоит не из 141, а из 172 аминокислотных остатков и образуется в результате миссенс мутации <missense mutation>, превращающей стоп кодон ТАА в смысловой… …   Молекулярная биология и генетика. Толковый словарь.

  • растекающаяся мутация — leaky mutation ликовая (растекающаяся) мутация. Форма миссенс мутации <missence mutation>, при которой мутантный фермент обладает сниженной активностью либо снижен уровень его синтеза; Л.м. в регуляторных элементах генов проявляются в… …   Молекулярная биология и генетика. Толковый словарь.

Mutations | Protocol (Translated to Russian)

13.10: Мутации

Обзор

Мутации – это изменения в последовательности ДНК. Эти изменения могут происходить спонтанно или они могут быть вызваны воздействием факторов окружающей среды. Мутации можно охарактеризовать различными способами: изменяют ли они аминокислотную последовательность белка, происходят ли они на небольшой или большой площади ДНК, и встречаются ли они в соматических клетках или зародышевых клетках.

Последствия точечных мутаций на молекулярном уровне

Мутации, происходящие при одном нуклеотиде, называются точечными мутациями. Когда точечные мутации происходят в генах, последствия могут варьироваться в степени тяжести в зависимости от того, что происходит с закодированной аминокислотной последовательностью. Тихая мутация не меняет аминокислотной идентичности и не будет иметь никакого влияния на организм. Мутация миссенса изменяет одну аминокислоту, и последствия могут быть серьезными, если изменение изменяет функцию белка. Нонсенс мутации производит стоп-кодон, который усечения белка, вероятно, что делает его нефункциональным. Мутации рама возникают, когда один или несколько нуклеотидов вставляются или удаляются из последовательности ДНК, кодирующей белок, влияя на все кодоны ниже по течению от места мутации.

Хромосомные изменения являются крупномасштабными мутациями

Самый резкий тип мутации, хромосомное изменение, изменяет физическую структуру хромосомы. Хромосомные изменения могут включать удаление, дублирование или инверсию больших участков ДНК в пределах одной хромосомы, или интеграцию части другой хромосомы. Эти мутации, как правило, гораздо серьезнее, чем точечные мутации, поскольку они охватывают многие гены и регуляторные элементы. Хромосомные изменения могут быть обнаружены путем кариотипирования пораженной клетки.

Наследуются только мутации зародышевой линии

Мутации могут происходить в любой клетке, но только мутации зародышевой линии — те, что присутствуют в яйцеклетках и сперматозоидах — могут передаваться потомству. Например, наследственные заболевания — это подтип генетического заболевания, вызванного вредными мутациями зародышевой линии. Они могут быть аутосомными, обнаруживаясь на хромосомах с первой по 22, или сцепленными с полом, встречаясь на X- или Y-хромосоме. Одним из примеров наследственного заболевания является муковисцидоз (МВ), заболевание, которое в первую очередь поражает легкие. Это вызвано делецией в гене CFTR , который удаляет одну аминокислоту из белка CFTR. МВ — аутосомно-рецессивное заболевание, что означает, что у человека с одной мутированной копией гена и одной нормальной копией заболевание не разовьется; другие заболевания, такие как болезнь Хантингтона, нейродегенеративное заболевание, являются аутосомно-доминантными, что означает, что для развития болезни необходима только одна мутированная копия гена.

Некоторые мутации вызваны факторами окружающей среды

Как соматические мутации—, возникающие вне зародышевой линии, так и мутации зародышевой линии— могут возникать спонтанно во время репликации ДНК, но они также могут быть вызваны воздействием радиации или химических веществ в окружающей среде. Внешние факторы, повреждающие ДНК и вызывающие мутации, называются мутагенами. Один хорошо охарактеризованный мутаген окружающей среды — ультрафиолетовое (УФ) излучение. Ультрафиолетовое излучение несет больше энергии, чем видимый свет, и повреждает ДНК, разрывая связи между парами оснований, в результате чего основания тимина на одной и той же цепи ДНК соединяются друг с другом в характерные димеры тимина. Солнце — естественный источник УФ-излучения. Наиболее опасные длины волн, УФ-С, улавливаются высоко в атмосфере, но УФ-А и УФ-В лучи достигают поверхности Земли. Искусственные источники УФ-излучения включают солярии, которые пропускают в основном УФ-А-лучи с меньшим количеством УФ-В. К счастью, у клеток есть механизмы для восстановления поврежденной ДНК, но иногда повреждение не восстанавливается до деления клеток в быстро делящихся клетках, таких как клетки кожи. Если повреждение ДНК происходит в области генома, которая важна для регулирования роста и деления клеток, это может привести к раку, если его не исправить.

Генные мутации, задачи на генные мутации

Генные мутации, задачи на генные мутации. Генная мутация-изменение нуклеотидной последовательности одного гена.

Типы генных мутаций: 

  1. Замена одного нуклеотида в гене на другой нуклеотид (миссенс мутация). Происходит из-за ошибки ДНК-полимеразы при репликации ДНК.

 Последствия миссенс мутаций:

а) Миссенс мутация приводит к изменению первичной структуры и функции соответствующего белка, если образовавшейся в результате мутации кодон кодирует новую аминокислоту.

До мутации:

ДНК: АТГЦЦАААГГГА

иРНК: УАЦГГУУУЦЦЦУ

первичная стр-ра белка: Тир Гли Фен Про

После мутации:

ДНК: АТГЦЦАААТГГА

иРНК: УАЦГГУУУАЦЦУ

первичная стр-ра белка: Тир Гли Лей Про

В результате мутации произошла замена одной аминокислоты, следовательно, первичная структура и функция белка изменились.

б) Миссенс мутация не приводит к изменению первичной структуры и функции соответствующего белка, если образовавшейся в результате мутации кодон кодирует ту же аминокислоту, что и исходный (из-за свойства вырожденности генетического кода).

До мутации:

ДНК:  АТГЦЦАААГГГА

иРНК: УАЦГГУУУЦЦ

первичная стр-ра белка: Тир Гли Фен Про

После мутации:

ДНК:  АТГЦЦААААГГА

иРНК:  УАЦГГУУУУЦЦУ

первичная стр-ра белка: Тир Гли Фен Про

В результате мутации произошла замена Г на А в составе последовательности ДНК. Однако эта мутация не привела к изменению структуры и функции соответствующего белка, так как новый кодон УУУ кодирует ту же аминокислоту (Фен), что и исходный – УУЦ.

 

  1. Выпадение или вставка одного или нескольких кодонов в составе нуклеотидной последовательности гена. Выпадение одного кодона происходит из-за ошибки ДНК-полимеразы при репликации ДНК и приводит к выпадению одной аминокислоты из первичной структуры белка. Соответственно, такая мутация приводит к изменению структуры и функции соответствующего белка.

До мутации:

ДНК:  АТГЦЦАААГГГА

иРНК:  УАЦГГУУУЦЦЦУ

первичная стр-ра белка: Тир Гли Фен Про

После мутации:

ДНК:  АТГААГГГА

иРНК:  УАЦУУЦЦЦУ

первичная стр-ра белка: Тир Фен Про

 

  1. Вставка или выпадение одного или 2-х нуклеотидов (Мутация со смещением открытой рамки считывания). Происходит из-за ошибки ДНК-полимеразы при репликации ДНК. Данная мутация приводит к изменению всех аминокислот в первичной структуре белка, начиная с точки мутации. Это в большинстве случаев приводит к полному нарушению структуры и функции белка.

До мутации:

ДНК:  АТГЦЦЦАТААГЦ

иРНК: УАЦГГГУАУУЦГ

первичная стр-ра белка: Тир Гли Тир Сер

В результате мутации произошла вставка 1 нуклеотида

После мутации:

ДНК:  АТГГЦЦЦАТААГЦ

иРНК: УАЦЦГГГУАУУЦГ

первичная стр-ра белка: Тир  Арг Вал Фен

 

  1. Появление стоп-кодона в кодирующей части гена (нонсенс мутация). В результате, полипептидная цепь соответствующего белка становится короче, что приводит к значительному изменению первичной структуры и функции белка.

До мутации:

ДНК:  АТГЦЦЦАТААГЦ

иРНК: УАЦГГГУАУУЦГ

первичная стр-ра белка: Тир Гли Тир Сер

Произошла замена Т на Ц в последовательности нуклеотидов соответствующего гена. В результате в кодирующей части мРНК возник стоп-кодон – УАГ, что привело к преждевременной остановке трансляции.

После мутации:

ДНК:  АТГЦЦЦАЦААГЦ

иРНК: УАЦГГГУАГУЦГ

первичная стр-ра белка: Тир Гли

 

Одна из задач ЕГЭ на тему «Генные мутации»

Задача 6

В результате генной мутации в полипептидной цепи соответствующего белка аминокислота Про заменилась на Цис. Последовательность иРНК до мутации: ГЦУУУЦЦЦЦГАЦУЦА. Определите аминокислотный состав молекулы нормального и мутированного белка, а также возможные последовательности нуклеотидов мутированной иРНК. Ответ поясните.

До мутации:

иРНК: ГЦУУУЦЦЦЦГАЦУЦА

белок: Ала Фен Про Асп Сер

Причиной замены третьей аминокислоты Про на Цис являлась генная мутация в нуклеотидной последовательности соответствующего гена, в результате которой произошло изменение триплета в составе мРНК, кодирующего третью аминокислоту. Исходя из свойства вырожденности генетического кода, аминокислота Цис может быть закодирована двумя возможными триплетами – УГУ, УГЦ. Соответственно, в результате мутации в иРНК мог появиться любой из этих триплетов. Вероятнее всего УГЦ, так как при этом должно замениться меньше всего нуклеотидов.

Варианты мутированной последовательности иРНК: ГЦУУУЦУГУГАЦУЦА; ГЦУУУЦУГЦГАЦУЦА

После мутации:

иРНК: ГЦУУУЦУГЦГАЦУЦА

белок: Ала Фен Цис Асп Сер

Ответ: последовательности иРНК с мутацией: ГЦУУУЦУГУГАЦУЦА; ГЦУУУЦУГЦГАЦУЦА.

Первичная структура нормального белка: Ала Фен Про Асп Сер

Первичная структура белка после мутации: Ала Фен Цис Асп Сер

 

 

МАТЕРИАЛЫ КОНГРЕССОВ И КОНФЕРЕНЦИЙ: VII РОССИЙСКАЯ ОНКОЛОГИЧЕСКАЯ КОНФЕРЕНЦИЯ

VII РОССИЙСКАЯ ОНКОЛОГИЧЕСКАЯ КОНФЕРЕНЦИЯ

МУТАЦИИ В ПРТООНКОГЕНЕ RET:
РОЛЬ В ПАТОГЕНЕЗЕ МЕДУЛЛЯРНОГО РАКА ЩИТОВИДНОЙ ЖЕЛЕЗЫ
И ВОЗМОЖНОСТИ ДОКЛИНИЧЕСКОЙ ДИАГНОСТИКИ ЗАБОЛЕВАНИЯ

Ф.А. Амосенко1, В.Ж. Бржезовский2, Л.Н. Любченко2, М.А. Шабанов2, В.М. Козлова2,
Е.И. Трофимов3, Э.В. Ванушко4, В.Н. Калинин1, 5, Р.Ф. Гарькавцева2

1МГНЦ РАМН, Москва,
2ФГБУ «НМИЦ онкологии им. Н.Н. Блохина» Минздрава России, Москва,
3МНИОИ им. П.А. Герцена, Москва
4ЭНЦ РАМН, Москва
5Хирургическая клиника Гамбургского университета, отдел общей хирургии, Гамбург

I. Медуллярный рак щитовидной железы

Медуллярный рак щитовидной железы (МТС — Medullar Thyroid Carcinoma)-нейроэндокринная опухоль, образующаяся из парафолликулярных клеток или С-клеток щитовидной железы, являющихся производными неврального гребня и ответственных за синтез кальцитонина. Это довольно редкое заболевание составляет 5-10% от всех карцином щитовидной железы. МТС может возникать спорадически (примерно в 70-80% случаев) или является главной составной частью наследственного синдрома множественной эндокринной неоплазии типа 2 (MEN2 — Multiple Endocrine Neoplasia type 2).

Особенностью клинического проявления этого ракового синдрома с доминантным типом наследования является фенотипический полиморфизм, с учетом которого различают три хорошо охарактеризованных подтипа: MEN2A, MEN2B и семейный медуллярный рак щитовидной железы (FMTC — Familial MTC). Наследственный МТС присутствует в 95-100% случаев всех MEN2 подтипов. Для MEN2A (80-90% среди MEN2 синдромов) характерно также наличие феохромоцитомы (около 50%) и гиперпаратиреоза (20-30%). Феохромоцитома присутствует примерно у 50% больных с подтипом MEN2B, однако, гиперпаратиреоз в этих случаях встречается редко. Для третьего подтипа MEN2 синдрома-FMTC характерен только наследственный МТС.

Варьирующая экспрессивность и неполная пенетрантность, характерные для MEN2 синдромов, являются причиной значительной межиндивидуальной изменчивости (даже в пределах одного подтипа) как по возрасту начала заболевания, так и по тяжести его проявления, что в настоящее время создает определенные трудности при клинической диагностике С-клеточной гиперплазии и МТС на ранней стадии развития.

II. Протоонкоген RET

Этиологическим фактором заболеваний с наследственными формами МТС, т.е. с синдромами MEN2, практически во всех изученных случаях являются герминальные миссенс-мутации в протоонкогене RET. Ген RET (REarranged during Transfection) кодирует тирозинкиназу рецепторного типа. Он локализован на длинном плече хромосомы 10 (10q11.2) и охватывает около 60 kb геномной ДНК, включает 21 экзон. Известны три изоформы RET белка, образующиеся в результате альтернативного сплайсинга 3`-конца транскрипта: RET9, RET43 и RET51. Подобно другим рецепторным тирозинкиназам молекула RET белка включает большой внеклеточный домен, участвующий в узнавании и связывании его лигандов и корецепторов, трансмембранный домен и внутриклеточный тирозинкиназный домен, участвующий в фосфорилировании активированной тирозинкиназы RET, в стимулировании ее сигнальных путей.

Лигандами для рецептора RET являются 4 близко родственных нейротрофных фактора, относящихся к суперсемейству трансформирующего фактора роста ? (TGF?-Transforming Growth Factor ?). Это нейротрофный фактор глиальных клеток (GDNF — Glial cell line Derived Neurotrophic Factor), ньюртурин, персефин и артемин. GDNF лиганды (GFL) связываются с трансмембранным рецептором RET через их высоко аффинные корецепторы семейства GFR?: GFR?-1-4. Установлено, что GFR?-1 связывается с высоким сродством с GDNF, GFR?-2 — с ньюртурином, GFR?-3 – с артемином, а GFR?-4 – c персифином. В норме все эти комплексы GFL-GFR? приобретают способность взаимодействовать с общим сигнальным рецептором RET, запуская его димеризацию на клеточной поверхности и автофосфорилирование во внутриклеточном домене. Для каждого из членов семейств GDNF и GFR? характерны различные, частично перекрывающиеся паттерны экспрессии, а также разные роли в процессах пролиферации клеток. Это предполагает, что активация тирозинкиназы RET различными комплексами GFL-GFR? является строго регулируемым процессом, а также может быть одним из объяснений большого количества фенотипов, ассоциированных с активацией протеинкиназы RET.

III. Мутации в протоонкогене RET

В отличие от других заболеваний, ассоциированных с RET, наследственный МТС является результатом активации этого гена с помощью миссенс-мутаций. При MEN2A герминальные мутации в гетерозиготном состоянии обнаружены во внеклеточном домене Ret. Они затрагивают 1 из 5 цистеиновых кодонов или участки, окружающие эти кодоны, в богатом цистеином домене RET белка: мутации в кодонах 609, 611, 618, 620 (экзон 10) и 634 (экзон 11) обнаружены более чем у 98% больных. При этом около 87% MEN2A мутаций присутствуют в кодоне 634. Наиболее частая аномалия в этом кодоне (около 50% всех MEN2A мутаций) приводит к замене цистеина на аргинин. В результате каждой из перечисленных выше мутаций цистеиновые остатки, в норме участвующие в образовании внутримолекулярных дисульфидных связей, определяющих четвертичную структуру белка, образуют межмолекулярные связи с другими мутантными молекулами RET, индуцируя тем самым лиганд-независимую гомодимеризацию белка, что, в свою очередь, приводит к перманентной, нерегулируемой активации протеинкиназы RET.

Большую часть MEN2A мутаций обнаруживают также у больных с FMTC: однонуклеотидные замены в 1 из 5 цистеиновых кодонов (609, 611, 618, 620 или 634) в гетерозиготном состоянии присутствуют более чем в 80% семей. Однако, в отличие от MEN2A, герминальные миссенс-мутации при FMTC, во-первых, относительно равномерно распределены среди этих кодонов, а во-вторых, с гораздо меньшей частотой они встречаются в кодонах 609, 611 и 634. В единичных случаях при FMTC обнаружены миссенс-мутации во внутриклеточном тирозинкиназном домене RET в нецистеиновых кодонах: 768 (экзон 13), 804 (экзон 14) и 883 (экзон15). Мутации в тирозинкиназном домене также способны активировать RET независимо от лиганда. Полагают, что они могут изменять субстратную специфичность протеинкиназы RET, или увеличивать способность ее рецептора связывать АТР, что, по-видимому, стимулирует активацию сигнальных путей, приводящих к бесконтрольной пролиферации клеток.

При MEN2B более чем у 95% больных обнаруживают одну и ту же миссенс-мутацию в кодоне 918 (экзон 16), вызывающую замену метионина на треонин, а у 3% — замену А883F (экзон 15). Эти мутации находятся внутри каталитического ядра протеинкиназы RET. Показано, что эти мутации приводят к лиганд-независимой конститутивной активации тирозинкиназы RET, но без димеризации последней. Однако при MEN2B интенсивность сигнала от мутантного рецептора может быть увеличена связыванием лиганда. Мутация М918Т изменяет также субстратную специфичность протеинкиназы RET, что приводит к автофосфорилированию остатков тирозина по новым сайтам, а также к преимущественному фосфорилированию новых белков — цитоплазматических тирозинкиназ c-src и c-abl — отсутствующему в норме. Таким образом, мутации протоонкогена RET, приводящие к перманентной стимуляции его тирозинкиназной активности, являются онкогенными. Они способны вызывать морфологическую трансформацию клеток, культивируемых in vitro, и ответственны за развитие наследственных раковых синдромов MEN2. Кроме того, на животных моделях было показано, что экспрессия трансгена RET MEN2A приводит к развитию у мышей опухолей щитовидной железы, морфологически сходных с МТС человека, а в случае с трансгеном RET MEN2B — к развитию нейроглиальных опухолей мышей, гистологически идентичных ганглионейромам человека.

IV. Корреляция между генотипом и фенотипом

Из изложенного выше прослеживается взаимосвязь специфических RET мутаций с каждым подтипом MEN2; в то же время очевидно частичное перекрывание этих мутаций, особенно для MEN2A и FMTC. Ассоциация между положением и типом мутаций в протоонкогене RET с фенотипом заболевания становится четче при обращении к типам опухолей MEN 2 синдромов. На основании анализа большого количества независимых MEN2 семей были сделаны следующие выводы:

    1) существует ассоциация между герминальными мутациями в кодоне 634 и присутствием в семьях с MEN2A феохромоцитомы и гиперпаратиреоза;

    2) мутация C634R до сих пор не была обнаружена ни в одной из семей с FMTC, что позволяет рассматривать ее в качестве строгого маркера при прогнозировании риска развития феохромоцитомы и гиперпаратиреоза у бессимптомных носителей этой мутации;

    3) и, наоборот, герминальные мутации в кодонах 768, 804 и 891 до сих пор были обнаружены исключительно у больных с FMTC, поэтому их можно рассматривать как маркеры низкого риска развития феохромоцитомы и гиперпаратиреоза;

    4) герминальные мутации в кодонах 918 и 883 характерны исключительно для MEN2B.

Таким образом, эти высокоспецифические аномалии протоонкогена RET можно использовать при уточнении диагноза, при скрининге, прогнозировании, контроле и профилактике MEN2. Объяснение этой корреляции в настоящее время отсутствует. Существуют лишь предположения, что она может быть связана с различными уровнями активации тирозинкиназы RET, индуцируемой разными герминальными мутациями, а также с различной чувствительностью разных тканей к активированному RET с максимальной чувствительностью С-клеток щитовидной железы и с наименьшей чувствительностью околощитовидных желез.

V. RET мутации при спорадических формах МТС и феохромоцитомах

В зависимости от выборок больных, а также от методов молекулярного исследования у 23-70% больных со спорадическим МТС обнаружены соматические мутации в одном из аллелей протоонкогена RET. Как правило, эти аномалии часто возникают в кодирующей области гена RET в дополнение к уже сообщенным мутациям в «горячих» точках. Наиболее распространенной в этой группе больных является замена метионина на треонин в кодоне 918, ассоциированная с MEN2B фенотипом. С гораздо меньшей частотой встречаются мутации в цистеин-богатом домене, а также в экзонах 13-15. Следует отметить, что около 6% форм со спорадическим МТС оказываются случаями de novo MEN2A и FMTC, и около 50% — de novo MEN2B. Существуют данные, свидетельствующие о том, что, в отличие от герминальных, соматические мутации в протоонкогене RET не являются инициирующими, они нужны для прогрессии опухолей. Эти данные, а также обнаружение мутации в кодоне 918 только у небольшой части больных со спорадическим МТС предполагают, что к этому заболеванию могут быть причастны еще неизвестные факторы.

Гораздо реже соматические мутации в протоонкогене RET встречаются у больных со спорадической феохромоцитомой (10-15% случаев), что может быть следствием более низкой чувствительности клеток надпочечников к активации RET. Наиболее распространенной аномалией и в этом случае является мутация в кодоне M918T. Она обнаружена примерно у 50% больных. Есть сообщения и о других соматических миссенс-мутациях в экзонах 10 и 11, а также о делециях в цистеин-богатой области RET, присутствующих в небольших (единичных) количествах феохромоцитом.

VI. Сигнальные пути RET

Активация трансмембранного рецептора RET в норме при связывании с комплексом лиганд-корецептор или вследствие мутаций при наследственном МТС приводит к автофосфорилированию, которое в свою очередь активирует различные сигнальные пути RET, стимулирующие рост, дифференцировку или выживание клеток в зависимости от типа клеток или стадии их развития, на которой произошла индукция RET. Фосфорилированию могут подвергаться 9 из 18 внутриклеточных остатков тирозина, что делает их местами для посадки сигнальных молекул и предполагает множество всевозможных каскадных взаимодействий. Активированная тирозинкиназа RET связывается с Sh3 доменами таких белков, как фосфолипаза С/? (PLC?) (Y1015), Shc (Y1062), src, Crk и Nck. Кроме того, Grb2 взаимодействует с Y1096, характерным только для длинной изоформы RET51. RET также взаимодействует с Grb7 и 10 (Y905). Механизмы активации RET посредством MEN2A и MEN2B мутаций разные, поэтому неудивительно, что для трансформации in vitro в этих подтипах нужны различные остатки тирозина. Так, фосфорилирование Y864 и Y952 является критическим при трансформации, опосредуемой MEN2B мутацией M918T, а фосфорилирование Y905 существенно для трансформации, стимулируемой мутациями MEN2A. Y1015, Y1062 и Y1096 являются универсальными: они необходимы для трансформирующего действия in vitro всех мутаций. Отметим различную способность адапторных белков связываться с Y1062 в составе трех изоформ RET, что объясняется различием их С-концевых участков. В соответствии с этими отличиями RET изоформы обладают различными способностями при индукции трансформации или дифференцировки in vitro, а также отличающейся экспрессией in vivo.

При участии по-разному ассоциированных адапторных белков RET активирует несколько сигнальных путей, среди которых особого внимания заслуживают два, включающие активируемые митогенами протеинкиназы (МАРК) и фосфатидил-инозитол-3-киназу (PI3K). Индуцируемый непосредственно Grb2 (Y1096) или сигнальными адапторами Shc и Grb2 (Y1062) переход белков Ras в активированное состояние приводит к стимулированию MAP-киназных каскадов, которые необходимы для выживания и дифференцировки нейронов. Адапторные белки Grb7 или 10 также причастны к активации Ras-MAPK каскадов. RET активация PI3-киназы, по-видимому, происходит при взаимодействии с Shc, Grb2 и Gab1 (Y1062), которые могут рекрутировать p85, регуляторную субъединицу PI3K. Активированная PI3-киназа влияет на клеточную подвижность, что приводит к образованию ламеллоподий или раффлинг мембран (признаки трансформированного фенотипа), а также к фосфорилированию белков, причастных к образованию фокальных адгезий, включая паксиллин, киназу FAK и Crk-ассоциированный субстрат p130 cas. Кроме того, RET через PI3-киназу стимулирует серин-треониновую протеинкиназу B/АКТ (PKB/AKT), активация которой очень важна для выживания и пролиферации клеток. С другой стороны, показано, что активированная киназа B/AKT предотвращает вступление клеток в апоптоз, и причастна к онкогенному действию RET. Действие MEN2A и MEN2B мутаций приводит к перманентной активации PI3-киназы и адапторных белков ее сигнального пути. Не исключено, что именно опосредованная каскадом PI3K-PKB/AKT защита клеток от апоптоза и их митогенное действие необходимы для проявления онкогенной активности RET при MEN 2 синдромах. Установлено также, что RET активирует сигнальный путь киназы JNK через cdc42/RAC1 малой GTPазы, которая способствует образованию неопластического фенотипа. Еще один сигнальный каскад RET, включающий PLC?, взаимодействующую с Y1015, также необходим для полного проявления онкогенного действия RET.

VI. Диагностика МТС

В настоящее время ранний генетический скрининг герминальных RET мутаций позволяет выявить индивидов из группы риска до появления у них клинических или биохимических симптомов. Прогностическое и диагностическое тестирование облегчается большим количеством случаев обнаружения герминальных RET мутаций (>95%) и наличием «горячих» кодонов. Индивиды из MEN2 семей с идентифицированной мутацией, не являющиеся носителями таковой, не входят в группу риска. Бессимптомным носителям мутаций из таких семей рекомендуют профилактическую тиреоидэктомию в раннем возрасте.

При молекулярной диагностике МТС применяют методы ПЦР, SSCP-анализа, гетеродуплексного анализа, рестрикционного анализа, секвенирование и др.

Используя эти методы, мы исследовали спектр RET мутаций у 19 больных со спорадическим МТС и у 15 больных с наследственными формами МТС. Молекулярная патология, выявленная нами у больных, представлена в таблице 1. В группе больных со спорадической формой МТС при исследовании 5 экзонов (10, 11, 13, 15 и 16) мутации были выявлены и идентифицированы в опухолях 9 больных (47,4%). При этом выявлено 6 типов соматических мутаций, 3 из них — новые. Все они являются миссенс-мутациями и присутствуют в гетерозиготном состоянии, т.е. только в одной из копий гена RET. Наиболее частой мутацией оказалась замена ATG (Мet)>ACG (Thr) в кодоне 918. Она позволила нам идентифицировать 31,6% МТС аллелей. Две новые соматические мутации в кодонах 639 GCA (Ala)>GGA (Gly) и 641 GCT (Ala)>CGT (Arg) обнаружены у одного больного. С помощью аллель-специфической ПЦР и автоматического секвенирования мы показали, что эти мутации находятся на одном аллеле. При скрининге новой мутации в кодоне 922 TCC (Ser)>TTC (Phe) в группе здоровых доноров (обследованы 50 человек) и в группе больных со спорадическим МТС эта мутация не обнаружена. Клиническое значение этих мутаций в настоящее время не известно. У 3 больных мы выявили мутацию de novo MEN2B: замену метионина на треонин в кодоне 918.

В группе индивидов с наследственным МТС (исследовали экзоны 10, 11 и 16) выявлено 4 типа известных миссенс-мутаций: три в кодоне 634 и одна в кодоне 918 (табл. 1). Мутации обнаружены у всех обследованных. На основании этих данных четырем бессимптомным носителям RET мутаций из трех семей с MEN2A (№23, 25, 26 и 27 в таблице) в ФГБУ «НМИЦ онкологии им. Н.Н. Блохина» Минздрава России была проведена тиреоидэктомия.

В результате нашего исследования с целью ранней диагностики и профилактики наследственного МТС в семьях, отягощенных MEN2 синдромами, был разработан подход, который предполагает три этапа мероприятий:

    1) генетический скрининг на выявление и регистрацию российских MEN2 семей;

    2) ДНК-диагностику бессимптомных членов семей с наследственным МТС (группа риска), дающую индивидуальный прогноз, предусматривающий в зависимости от типа RET мутаций профилактическое удаление щитовидной железы;

    3) клинический мониторинг индивидов из группы риска. Все эти действия позволят снизить риск онкологического заболевания. Кроме того, пациентов со спорадическим МТС необходимо проверять на наличие герминальных мутаций в протоонкогене RET, поскольку из данных литературы, а также из наших собственных результатов известно, что примерно для 15% индивидов из этой группы характерно наличие таких миссенс-мутаций.

Таблица 1.

Молекулярная патология пациентов с МТС





































Пациент Источник ДНК Экзон Кодон Замена Сайт рестрик-

ции для эндо-

нуклеазы
нуклеотида амино-кислоты
Спорадические варианты
1 опухоль 16 918 ATG→ACG Met→Thr Fok I
3* опухоль 16 922 TCC→TTC Ser→Phe EcoR I
3 норм. ткань 16 922 EcoR I
6 опухоль 11 634 TGC→CGC Cys→Arg Hha I
6 опухоль 16 918 ATG→ACG Met→Thr Fok I
7 опухоль 11 634 TGC→TAC Cys→Tyr **
7 норм.ткань 11 634 TGC→TAC Cys→Tyr **
8 опухоль 16 918 ATG→ACG Met→Thr Fok I
11 опухоль 16 918 ATG→ACG Met→Thr Fok I
12* опухоль 11 639 GCA→GGA Ala→Gly **
12 норм. ткань 11 639 **
12* опухоль 11 641 GCT→CGT Ala→Arg **
12 норм. ткань 11 641 **
13 опухоль 16 918 ATG→ACG Met→Thr Fok I
13 норм. ткань 16 918 Fok I
16 опухоль 16 918 ATG→ACG Met→Thr Fok I
16 норм. ткань 16 918 ATG→ACG Met→Thr Fok I
Наследственный МТС
20 кровь 16 918 ATG→ACG Met→Thr Fok I
21 кровь 16 918 ATG→ACG Met→Thr Fok I
22 кровь 11 634 TGC→CGC Cys→Arg Hha I
23 кровь 11 634 TGC→CGC Cys→Arg Hha I
24 кровь 11 634 TGC→CGC Cys→Arg Hha I
25 кровь 11 634 TGC→CGC Cys→Arg Hha I
26 кровь 11 634 TGC→CGC Cys→Arg HhaI
27 кровь 11 634 TGC→GGC Cys→Gly **
28 кровь 11 634 TGC→GGC Cys→Gly **
29 кровь 11 634 TGC→TTC Cys→Phe **
30 кровь 11 634 TGC→TTC Cys→Phe **
31 кровь 11 634 TGC→CGC Cys→Arg Hha I
32 кровь 16 918 ATG→ACG Met→Thr Fok I
33 кровь 16 918 ATG→ACG Met→Thr Fok I
34 кровь 16 918 ATG→ACG Met→Thr Fok I

* — новые мутации

** — SSCP-анализ +сиквенс

Словарь терминов

Аллели – (от греч. allelon друг друга, взаимно) различные формы одного и того же гена, расположенные в одинаковых участках (локусах) гомологичных (парных) хромосом, контролирующие один и тот же белок. Все гены соматических клеток, за исключением генов, расположенных в половых хромосомах, представлены двумя аллелями, один из которых унаследован от отца, а другой – от матери. Различия между аллелями обусловлены мутациями.

Аутосомно-доминантный тип наследования – мутантный аллель (вариант) доминирует над нормальным аллелем (вариантом), т.е. проявляется как в гомозиготном, так и в гетерозиготном состоянии; патологическая наследственность прослеживается в родословной «по вертикали»; по крайней мере, один из родителей имеет проявление данной мутации. При этом мутантный ген расположен в аутосоме (неполовой хромосоме) и наследование не сцеплено с полом.

Аутосомно-рецессивный тип наследования – нормальный аллель (вариант) подавляет проявление мутантного аллеля (варианта), т.е. мутация может проявиться, только находясь в гомозиготном состоянии. При этом мутантный ген расположен в аутосоме (неполовой хромосоме) и наследование не сцеплено с полом.

Ген – элементарная единица наследственности, наименьший неделимый элемент наследственного материала, который может быть передан от родителей потомству как целое и который определяет признаки, свойства или физиологическую функцию организма. На молекулярном уровне — это участок молекулы ДНК, кодирующий первичную структуру белков и РНК.


Генетический вариант полиморфизма – в широком смысле аналогичен понятию аллеля; здесь, в узком смысле – одна из двух разновидностей гена, различающихся по одному генетическому полиморфизму. Генетические варианты полиморфизма обычно отличаются аминокислотной последовательностью белкового продукта гена или уровнем экспрессии гена.

Генный полиморфизм, полиморфизм (здесь, в узком смысле) – структурное различие альтернативных вариантов гена (обычно нормального и мутантного). Возникновение вариантов гена обусловлено мутациями. Применительно к понятию «генный полиморфизм» обычно рассматриваются нейтральные мутации, не приводящие к заметным нарушениям функции гена, тогда как «мутациями» обычно называют изменения в гене, приводящие к выраженному нарушению работы гена.


Генотип – (здесь, в узком смысле) сочетание генетических вариантов (аллелей), расположенных на гомологичных хромосомах.

Гетерозиготный – содержащий разные аллели (генетические варианты) в соответствующих локусах гомологичных хромосом.


Гомозиготный – содержащий одинаковые аллели (генетические варианты) в соответствующих локусах гомологичных хромосом.


Гомологичные хромосомы – парные хромосомы из диплоидного набора, одинаковые по форме, размерам и набору генов.


Делеция – утрата в результате мутации сегмента ДНК размером от одного нуклеотида до субхромосомного фрагмента, включающего несколько генов. В случае генных полиморфизмов рассматриваются делеции, ограниченные одним геном.


Диплоидный набор – набор хромосом в соматических клетках организма, который содержит два гомологичных набора хромосом, из которых один передается от одного родителя, а второй — от другого.

Доминантный аллель – аллель, проявляющийся в фенотипе гетерозиготных особей.

Инсерция – вставка сегмента ДНК размерами от одного нуклеотида до субхромосомного фрагмента, включающего несколько генов. В случае генных полиморфизмов рассматриваются инсерции, ограниченные одним геном.


Интрон – область гена, разделяющая экзоны и не несущая информации об аминокислотной последовательности белкового продукта.

Миссенс-мутация — мутация, приводящая к подстановке несоответствующей аминокислоты в полипептидную цепь.

Мультифакториальные заболевания – заболевания, вызываемые взаимодействием множества наследственных и внешних факторов, например, ишемическая болезнь сердца, инфаркт миокарда (ИМ), инсульт, некоторые формы рака, психические заболевания и др.

Мутантный вариант полиморфизма – вариант полиморфизма, возникший вследствие мутации из своего предшественника – нормального варианта.

Мутация – изменение нуклеотидной последовательности ДНК. Чаще всего мутации представляют собой однонуклеотидные замены – миссенс-мутации. Влияние мутации на функцию гена может варьировать от ее полного нарушения до незначительного влияния или отсутствия влияния.

Нормальный вариант полиморфизма – наиболее распространенный в популяции вариант полиморфизма, который является предшественником других вариантов, возникающих вследствие мутаций.

Нуклеотид – структурная единица нуклеиновых кислот. В состав ДНК входят 4 нуклеотида: аденин – А, тимин – Т, гуанин – G, цитозин – С.

Пенетрантность – количественный показатель фенотипической изменчивости проявления гена. Измеряется (обычно в %) отношением числа особей, у которых данный ген проявился в фенотипе, к общему числу особей, в генотипе которых этот ген присутствует в необходимом для его проявления состоянии (гомозиготном – в случае рецессивных генов или гетерозиготном – в случае доминантных генов). Проявление гена у 100% особей с соответствующим генотипом называется полной пенетрантностью, в остальных случаях – неполной пенетрантностью. Неполная пенетрантность свойственна проявлению генов, связанных с мультифакториальными заболеваниями: болезнь развивается только у части лиц, в генотипе которых присутствует аномальный ген; у остальных же наследственное предрасположение к болезни остаётся нереализованным.

Полиморфизм гена – многообразие нуклеотидных последовательностей гена, в том числе его аллельных форм.


Прогностический – понятие, характеризующее заключение о предстоящем развитии и исходе, основанное на специальном исследовании.

Промотор – участок молекулы ДНК, к которому присоединяются молекулы РНК-полимеразы, что сопровождается инициацией транскрипции соответствующих генов; как правило, промотор расположен на операторном конце оперона; каждый ген (или оперон) имеет свой промотор, контролирующий его транскрипцию.

Рецессивный аллель – аллель, не проявляющийся в фенотипе гетерозиготных особей.

Фенотип – особенности строения и жизнедеятельности организма, обусловленные взаимодействием его генотипа с условиями среды.

Хромосома – составной элемент клеточного ядра, являющийся носителем генов. В основе хромосомы лежит линейная молекула ДНК

Экзон – фрагмент гена, кодирующий аминокислотную последовательность белкового продукта данного гена.

Экспрессия гена – перенос генетической информации от ДНК через РНК к полипептидам и белкам в определенных типах клеток организма.

Коннексин 26 (GJB2) (все мутации)

Мутации гена связаны с изменением структуры белка коннексина 26. Ген исследуется для выявления наследственных  несиндромальных форм тугоухости разной степени тяжести, синдрома Фовинкеля (наследственная мутилирующая кератома), кератодермии ладоней и стоп, сочетающейся с глухотой, синдрома KID (Keratitis-ichthyosis-deafness syndrome – кератит, ихтиоз, глухота), синдрома Барта – Памфри (кератодермия, лейконихия, глухота). Анализ гена используется также для определения статуса носителя мутации у супругов при планировании беременности, особенно в кровнородственных браках и в семьях с наличием нейросенсорной тугоухости в родословной.

Метод исследования

Автоматическое секвенирование ДНК.

Какой биоматериал можно использовать для исследования?

Венозную кровь, буккальный (щечный) эпителий.

Как правильно подготовиться к исследованию?

Специальной подготовки не требуется.

Название гена – GJB2

OMIM *121011

Локализация гена на хромосоме – 13q12.11

Функция гена

Ген GJB2 кодирует трансмембранный белок коннексин 26 (Cx26), участвующий в образовании межклеточных контактов в тканях внутреннего уха.

Генетический маркер

Молекулярно-генетическим методом с помощью полимеразной цепной реакции исследуются все участки гена GJB2 в целях обнаружения в них нуклеотидных замен – мутаций, приводящих к заболеванию.

Встречаемость наследственной несиндромальной нейросенсорной тугоухости  1:1000 новорождённых.

Ассоциация маркера с заболеваниями

  • Несиндромальная нейросенсорная тугоухость
  • Синдром Фовинкеля (наследственная мутилирующая кератома)
  • Кератодермия ладоней и стоп, сочетающаяся с глухотой
  • Синдром KID (кератит, ихтиоз, глухота)
  • Синдром Барта – Памфри (кератодермия, лейконихия, глухота)

Общая информация об исследовании

Более 80  % всех случаев наследственных форм нарушения слуха связано с несиндромальной нейросенсорной тугоухостью. Она обусловлена повреждением чувствительных нервных клеток внутреннего уха, слухового нерва и центральных образований слуховой системы. Частой причиной наследственной несиндромальной тугоухости и глухоты является мутационное повреждение генов белков-коннексинов.

Большое значение в развитии тугоухости имеет ген GJB2, который кодирует коннексин 26 (Cx26). Этот трансмембранный белок участвует в образовании межклеточных контактов в тканях внутреннего уха, отвечающих за передачу сигналов между клетками, которые участвуют в восприятии звука.

Основой в развитии патологий слуха при мутациях в гене GJB2 является первичное отсутствие в тканях улитки белка коннексина 26. Поэтому функция органа слуха на клеточном уровне, в зависимости от типа мутации, в разной степени нарушается либо совсем утрачивается.

Рождение ребенка с нарушением слуха можно предупредить, проверив родителей на носительство мутаций в гене GJB2. Если у человека обнаруживается гетерозиготное носительство мутации (один аллель гена поврежден, второй аллель нормальный), то мутация никак не проявляется (носитель здоров). Но учитывая, что заболевание наследуется по аутосомно-рецессивному типу, то в случае, когда в генотипе плода встретятся две мутации гена GJB2, унаследованные от родителей (гетерозиготных носителей мутации), вероятность рождения ребенка с нарушением слуха будет составлять 25 %. Поэтому при обнаружении гетерозиготного носительства мутации у родителя рекомендуется консультация генетика.

Генетический скрининг новорождённых на мутации в гене GJB2 способствует раннему выявлению наследственных патологий слуха и, следовательно, раннему излечению и реабилитации.

В гене GJB2 выявляются как мутации, инактивирующие ген, которые приводят к преждевременному прекращению синтеза белка и имеют значительные, тяжелые последствия на тканевом уровне, приводят к дегенерации и полностью нарушают функцию органа, так и не инактивирующие мутации. Наличие в генотипе двух инактивирующих мутаций соответствует самым тяжелым нарушениям слуха. Наиболее часто встречающейся мутацией является 35delG (делеция одного нуклеотида гуанина (G) в позиции 35 последовательности ДНК гена GJB2), отвечающая за половину всех случаев врождённой и ранней нейросенсорной тугоухости в европейской популяции. Благодаря проведенным исследованиям известно, что в ряде регионов нашей страны каждые 2 человека из 100 являются носителями мутации 35delG, поэтому вероятность рождения ребенка от носителей измененного гена очень высока.

Для гомозигот по мутации 35delG гена GJB2 характерна врождённая тяжелая тугоухость, начинающаяся проявляться с рождения до первого, реже второго года жизни. Чуть менее тяжело она воздействует на пациентов с генотипом 35delG/не 35delG (гетерозиготы по мутации 35delG в сочетании с гетерозиготностью по любой другой мутации гена GJB2). Носители двух не 35delG-мутаций имеют еще менее выраженное проявление заболевания. Гомозиготность по мутации V37I или комбинация гетерозиготности по мутации 35delG с L90P, V37I, или IVS1+1G-A мутациями ассоциирована с тугоухостью средней, легкой степени тяжести.

В европейской популяции наряду с 35delG часто встречаются мутации 313del14 (делеция 14 пар оснований в позиции 312-326) и 333-334delAA (делеция двух нуклеотидов АА в позиции 333-334), также приводящие к потере слуха.

Второй вид мутаций – не инактивирующие ген миссенс мутации, приводящие к замене одной аминокислоты в последовательности белка, что отражается на его функции. При таких мутациях структура коннексиновых каналов может быть сформирована правильно, но они оказываются функционально неполноценными (или изменяется их проницаемость). В результате чего наблюдаются менее выраженные нарушения слуха.

Мутации в гене GJB2 также ассоциированы с различными синдромами. При синдроме Фовинкеля (Vohwinkel) (наследственной мутилирующей кератоме) идентифицируется миссенс-мутация D66H, которая проявляется в замене аспарагиновой кислоты в позиции 66 аминокислотной последовательности белка Сх26 на триптофан. Кератодермии – это группа болезней, характеризующаяся избыточным ороговением кожи преимущественно в области ладоней и подошв. Синдром Фовинкеля представляет собой форму наследственной диффузной кератодермии, сопровождающейся образованием фиброзных перетяжек, приводящих к ампутации пальцев, и, как правило, сочетается с потерей слуха.

Синдром Барта-Памфри (Bart-Pumphrey) – комплекс врождённых аномалий: фиброзные узелки на разгибательных поверхностях межфаланговых суставов пальцев рук и ног, лейкопатия ногтей (лейконихия) и глухота. Синдром характеризуется гетерозиготностью по мутации N54K гена GJB2 (замена аспарагина на лизин в аминокислотной последовательности белка коннексина 26).

У пациентов с кератодермией ладоней и стоп, сочетающейся с глухотой, идентифицирована мутация G59A (замена аминокислоты глицина на аланин в позиции 59 аминокислотной последовательности белка Cx26).

При синдроме KID (Keratitis-ichthyosis-deafness syndrome), который характеризуется врождённым ихтиозом, васкулярным кератитом и нейросенсорной глухотой, обнаруживается мутация D50N (замена аспарагиновой кислоты на аспарагин в позиции 50 аминокислотной последовательности белка Cx26).

Поиск мутаций в гене GJB2 следует проводить для подтверждения диагноза «врождённая несиндромальная тугоухость», а также при менее тяжелых формах тугоухости и при поздней манифестации заболевания для выявления его генетической составляющей. При планировании беременности, если в семье среди родственников есть (или были) случаи изолированного нарушения слуха с рождения (или с детства), необходимо пройти генетическое исследование на носительство мутации гена GJB2 для расчета риска рождения больного врождённой тугоухостью ребенка.

Интерпретация результатов

Оценка генотипа:


Скачать пример результата

Генетический маркер входит в исследование: 

Литература

  • Cryns, K., Orzan, E., Murgia, A., Huygen, P. L. M., Moreno, F., del Castillo, I., Parker Chamberlin, G., Azaiez, H., Prasad, S., Cucci, R. A., Leonardi, E., Snoeckx, R. L., Govaerts, P. J., Van de Heyning, P. H., Van de Heyning, C. M., Smith, R. J. H., Van Camp, G. A genotype-phenotype correlation for GJB2 (connexin 26) deafness. J. Med. Genet. 41: 147-154, 2004. [PMID: 14985372]
  • Seeman, P., Malikova, M., Raskova, D., Bendova, O., Groh, D., Kubalkova, M., Sakmaryova, I., Seemanova, E., Kabelka, Z. Spectrum and frequencies of mutations in GJB2 (Cx26) gene among 156 Czech patients with pre-lingual deafness. Clin. Genet. 66: 152-157, 2004. [PMID: 15253766]
  • Maestrini, E., Korge, B. P., Ocana-Sierra, J., Calzolari, E., Cambiaghi, S., Scudder, P. M., Hovnanian, A., Monaco, A. P., Munro, C. S. A missense mutation in connexin26, D66H, causes mutilating keratoderma with sensorineural deafness (Vohwinkel’s syndrome) in three unrelated families. Hum. Molec. Genet. 8: 1237-1243, 1999. [PMID: 10369869]
  • Heathcote, K., Syrris, P., Carter, N. D., Patton, M. A. A connexin 26 mutation causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis (MIM 148350). J. Med. Genet. 37: 50-51, 2000. [PMID: 10633135]

 

 

Cтруктурные изменения рецепторов факторов роста фибробластов в процессе канцерогенеза у человека

МИХАЙЛЕНКО и др.

18. Михайленко Д.С., Немцова М.В. (2016) Точковые со

матические мутации в развитии рака мочевого пузыря:

ключевые события канцерогенеза, диагностические

маркеры и мишени для терапии, Урология, 1, 100–105.

19. Knowles, M.A., and Hurst, C.D. (2015) Molecular biology

of bladder cancer: new insights into pathogenesis and clini

cal diversity, Nat. Rev. Cancer, 15, 25–41.

20. Del Piccolo, N., Placone, J., and Hristova, K. (2015)

Effect of thanatophoric dysplasia type I mutations on

FGFR3 dimerization, Biophys. J., 108, 272–278.

21. Di Martino, E., Kelly, G., Roulson, J.A., and Knowles, M.A.

(2015) Alterations of cellcell and cellmatrix adhesion in

urothelial cells: an oncogenic mechanism for mutant

FGFR3, Mol. Cancer Res., 13, 138–148.

22. Rivera, B., Gayden, T., CarrotZhang, J., Nadaf, J.,

Boshari, T., Faury, D., Zeinieh, M., Blanc, R., Burk, D.L.,

Fahiminiya, S., Bareke, E., Schuller, U., Monoranu, C.M.,

Strater, R., Kerl, K., Niederstadt, T., Kurlemann, G.,

Ellezam, B., Michalak, Z., and Thom, M., et al. (2016)

Germline and somatic FGFR1 abnormalities in dysembry

oplastic neuroepithelial tumors, Acta Neuropathol., 131,

847–863.

23. Gallo, L.H., Nelson, K.N., Meyer, A.N., and Donoghue, D.J.

(2015) Functions of fibroblast growth factor receptors in

cancer defined by novel translocations and mutations,

Cytokine Growth Factor Rev., 26, 425–449.

24. Hallinan, N., Finn, S., Cuffe, S., Rafee, S., Byrne, K., and

Gately, K. (2016) Targeting the fibroblast growth factor

receptor family in cancer, Cancer Treat. Rev., 46, 51–62.

25. Babina, I.S., and Turner, N.C. (2017) Advances and chal

lenges in targeting FGFR signaling in cancer, Nat. Rev.

Cancer, 17, 318–332.

26. Tanner, Y., and Grose, R.P. (2016) Dysregulating FGF sig

nalling in neoplastic disorders, Semin. Cell Dev. Biol., 53,

126–135.

27. Weinstein, J.N., Akbani, R., Broom, B.M., Wang, W.,

Verhaak, R.G., McConkey, D., Lerner, S., Morgan, M.,

Creighton, C.J., Smith, C., Cherniack, A.D., Kim, J.,

Sekhar, P.C., Noble, M.S., AlAhmadie, H.A., Reuter, V.E.,

Rosenberg, J.E., Bajorin, D.F., Bochner, B.H., and

Solit, D.B., et al. (2014) Comprehensive molecular char

acterization of urothelial bladder carcinoma, Nature, 507,

315–322.

28. Guo, G., Sun, X., Chen, C., Wu, S., Huang, P., Li, Z.,

Dean, M., Huang, Y., Jia, W., Zhou, Q., Tang, A., Yang, Z.,

Li, X., Song, P., Zhao, X., Ye, R., Zhang, S., Lin, Z., Qi, M.,

Wan, S., and Xie, L., et al. (2013) Wholegenome and

wholeexome sequencing of bladder cancer identifies fre

quent alterations in genes involved in sister chromatid

cohesion and segregation, Nat. Genet., 45, 1459–1463.

29. Nakanishi, Y., Akiyama, N., Tsukaguchi, T., Fujii, T.,

Satoh, Y., Ishii, N., and Aoki, M. (2015) Mechanism of

oncogenic signal activation by the novel fusion kinase

FGFR3BAIAP2L1, Mol. Cancer Ther., 14, 704–712.

30. Katoh, M. (2016) FGFR inhibitors: effects on cancer cells,

tumor microenvironment and wholebody homeostasis

(review), Int. J. Mol. Med., 38, 3–15.

31. Arai, Y., Totoki, Y., Hosoda, F., Shirota, T., Hama, N.,

Nakamura, H., Ojima, H., Furuta, K., Shimada, K.,

Okusaka, T., Kosuge, T., and Shibata, T. (2014) Fibroblast

growth factor receptor 2 tyrosine kinase fusions define a

unique molecular subtype of cholangiocarcinoma,

Hepatology, 5, 1427–1434.

32. Fischbach, A., Rogler, A., Erber, R., Stoehr, R., Poulsom, R.,

Heidenreich, A., Schneevoigt, B.S., Hauke, S., Hart

mann, A., Knuechel, R., Veeck, J., and Gaisa, N.T. (2015)

Fibroblast growth factor receptor (FGFR) gene amplifica

tions are rare events in bladder cancer, Histopathology, 66,

639–649.

33. Ross, J.S., Wang, K., AlRohil, R.N., Nazeer, T., Sheehan, C.E.,

Otto, G.A., He. J., Palmer, G., Yelensky, R., Lipson, D.,

Ali, S., Balasubramanian, S., Curran, J.A., Garcia, L.,

Mahoney, K., Downing, S.R., Hawryluk, M., Miller, V.A.,

and Stephens, P.J. (2013) Advanced urothelial carcinoma:

next generation sequencing reveals diverse genomic alter

ations and targets of therapy, Mod. Pathol., 27, 271–280.

34. Cheng, T., Roth, B., Choi, W., Black, P.C., Dinney, C.,

and McConkey, D.J. (2013) Fibroblast growth factor

receptors1 and 3 play distinct roles in the regulation of

bladder cancer growth and metastasis: implications for

therapeutic targeting, PLoS One, 8, e57284.

35. Andre, F., Bachelot, T., Campone, M., Dalenc, F., Perez

Garcia, J.M., Hurvitz, S.A., Turner, N., Rugo, H., Smith, J.W.,

Deudon, S., Shi, M., Zhang, Y., Kay, A., Porta, D.G.,

Yovine, A., and Baselga, J. (2013) Targeting FGFR with

dovitinib (TKI258): preclinical and clinical data in breast

cancer, Clin. Cancer Res., 19, 3693–3702.

36. Kim, S., Dubrovska, A., Salamone, R.J., Walker, J.R.,

Grandinetti, K.B., Bonamy, G.M., Orth, A.P., Elliott, J.,

Porta, D.G., GarciaEcheverria, C., and Reddy, V.A.

(2013) FGFR2 promotes breast tumorigenicity through

maintenance of breast tumorinitiating cells, PLoS One, 8,

e51671.

37. Andre, F., and Cortes, J. (2015) Rationale for targeting

fibroblast growth factor receptor signaling in breast cancer,

Breast Cancer Res. Treat., 150, 1–8.

38. Neuzillet, Y., Van Rhijn, B.W., Prigoda, N.L., Bapat, B.,

Liu, L., Bostrom, P.J., Fleshner, N.E., Gallie, B.L., Zlotta, A.R.,

Jewett, M.A., and van der Kwast, T.H. (2014) FGFR3

mutations, but not FGFR3 expression and FGFR3 copy

number variations, are associated with favourable nonmuscle

invasive bladder cancer, Virchows Arch., 465, 207–213.

39. Guancial, E.A., Werner, L., Bellmunt, J., Bamias, A.,

Choueiri, T.K., Ross, R., Schutz, F.A., Park, R.S., Brien, R.J.,

Hirsch, M.S., Barletta, J.A., Berman, D.M., Lis, R., Loda, M.,

Stack, E.C., Garraway, L.A., Riester, M., Michor, F.,

Kantoff, P.W., and Rosenberg, J.E. (2014) FGFR3 expres

sion in primary and metastatic urothelial carcinoma of the

bladder, Cancer Med., 3, 835–844.

40. Parker, B.C., Annala, M.J., Cogdell, D.E., Granberg, K.J.,

Sun, Y., Ji, P., Li, X., Gumin, J., Zheng, H., Hu, L., Yli

Harja, O., Haapasalo, H., Visakorpi, T., Liu, X., Liu, C.G.,

Sawaya, R., Fuller, G.N., Chen, K., Lang, F.F., Nykter, M.,

and Zhang, W. (2013) The tumorigenic FGFR3TACC3

gene fusion escapes miR99a regulation in glioblastoma,

J. Clin. Invest., 123, 855–865.

41. Blick, C., Ramachandran, A., Wigfield, S., McCormick, R.,

Jubb, A., Buffa, F.M., Turley, H., Knowles, M.A.,

Cranston, D., Catto, J., and Harris, A.L. (2013) Hypoxia

regulates FGFR3 expression via HIF1alpha and miR100

and contributes to cell survival in nonmuscle invasive

bladder cancer, Br. J. Cancer, 109, 50–59.

42. Sfakianos, J.P., Cha, E.K., Iyer, G., Scott, S.N., Zabor, E.C.,

Shah, R.H., Ren, Q., Bagrodia, A., Kim, P.H., Hakimi, A.A.,

Ostrovnaya, I., Ramirez, R., Hanrahan, A.J., Desai, N.B.,

Sun, A., Pinciroli, P., Rosenberg, J.E., Dalbagni, G.,

Schultz, N., Bajorin, D.F., Reuter, V.E., Berger, M.F.,

Bochner, B.H., AlAhmadie, H.A., Solit, D.B., and

Coleman, J.A. (2015) Genomic characterization of upper

tract urothelial carcinoma, Eur. Urol., 68, 970–977.

43. Spiegelberg, C., Giedl, J., Gaisa, N.T., Rogler, A., Riener, M.O.,

Filbeck, T., Burger, M., Ruemmele, P., Hartmann, A., and

Stoehr, R. (2014) Frequency of activating mutations in

FGFR2 exon 7 in bladder tumors from patients with early

onset and regularonset disease, Int. J. Clin. Exp. Pathol., 7,

1708–1713.

44. Bertz, S., Abee, C., SchwarzFurlan, S., Alfer, J., Hof

stadter, F., Stoehr, R., Hartmann, A., and Gaumann, A.K.

БИОХИМИЯ том 83 вып. 8 2018

1186

Какие типы вариантов гена возможны ?: MedlinePlus Genetics

Последовательность ДНК гена можно изменить несколькими способами. Варианты генов (также известные как мутации) могут по-разному влиять на здоровье в зависимости от того, где они возникают и изменяют ли они функцию основных белков. Типы вариантов включают следующие:

Замена

Вариант этого типа заменяет один строительный блок ДНК (нуклеотид) другим. Варианты замены можно дополнительно классифицировать по эффекту, который они оказывают на продукцию белка из измененного гена.

Миссенс

Миссенс вариант — это тип
замены, при которой изменение нуклеотида приводит к замене одного строительного блока белка (аминокислоты) другим в белке, полученном из гена. Замена аминокислоты может изменить функцию белка.

Ерунда

Бессмысленный вариант — это еще один вид подмены. Однако вместо того, чтобы вызвать изменение одной аминокислоты, измененная последовательность ДНК приводит к стоп-сигналу, который преждевременно сигнализирует клетке о прекращении создания белка.Этот тип варианта приводит к укороченному белку, который может функционировать неправильно, быть нефункциональным или разрушаться.

Вставка

Вставка изменяет последовательность ДНК, добавляя к гену один или несколько нуклеотидов. В результате белок, полученный из гена, может не функционировать должным образом.

Удаление

Делеция изменяет последовательность ДНК, удаляя по крайней мере один нуклеотид в гене. Небольшие делеции удаляют один или несколько нуклеотидов в гене, в то время как более крупные делеции могут удалять весь ген или несколько соседних генов.Удаленная ДНК может изменить функцию затронутого белка или белков.

Удаление-вставка

Этот вариант возникает, когда делеция и вставка происходят одновременно в одном и том же месте гена. В варианте с делецией-вставкой по меньшей мере один нуклеотид удален и по меньшей мере один нуклеотид вставлен. Однако изменение должно быть достаточно сложным, чтобы отличаться от простой замены. Полученный белок может не функционировать должным образом. Вариант с делецией-вставкой (делины) также может быть известен как вариант с вставкой-удалением (indel).

Дублирование

Дупликация происходит, когда участок из одного или нескольких нуклеотидов в гене копируется и повторяется рядом с исходной последовательностью ДНК. Этот тип варианта может изменить функцию белка, полученного из гена.

инверсия

Инверсия изменяет более одного нуклеотида в гене путем замены исходной последовательности той же последовательностью в обратном порядке.

Сдвиг рамы

Рамка считывания состоит из групп по три нуклеотида, каждая из которых
код для одной аминокислоты.А
Вариант смещения рамки считывания возникает, когда происходит добавление или потеря нуклеотидов, которые сдвигают группировку и изменяют код для всех последующих аминокислот. Получающийся в результате белок обычно нефункциональный. Вставки, удаления и дублирования могут быть вариантами со сдвигом кадра.

Повторить раскрытие

Некоторые участки ДНК содержат короткие последовательности нуклеотидов, которые повторяются несколько раз подряд. Например, тринуклеотидный повтор состоит из последовательностей из трех нуклеотидов, а тетрануклеотидный повтор состоит из последовательностей из четырех нуклеотидов.А
повторная экспансия — это вариант, который увеличивает количество повторений короткой последовательности ДНК. Этот тип варианта может привести к неправильному функционированию полученного белка.

Несмысленные, бессмысленные и сдвиговые мутации: генетическое руководство

Информация, которую несет генетический код, предоставляет набор «инструкций» для «построения» и «поддержания» живого организма. Полезной аналогией может быть сравнение генетического кода с алфавитом.

В алфавите можно комбинировать разные буквы для получения полезных и значимых слов — но только , если буквы сложены «правильно».То же самое и с ДНК. Определенные нуклеотиды (основные единицы ДНК), будь то аденин (A), тимин (T), цитозин (C) или гуанин (G), могут быть организованы определенным образом с образованием определенного гена, который, в свою очередь, кодирует конкретный белок.

Но иногда биология не придерживается «плана-плана» при организации букв, и происходят генетические мутации. Генетическая мутация — это постоянное изменение нуклеотидной последовательности гена. Чаще всего такие генетические мутации выгодны — они делают возможной эволюцию и порождают новые желательные черты у организмов.

Однако генетические мутации также могут быть проблематичными, если они приводят к заболеванию. У людей генетические нарушения часто ограничивают жизнь и их невероятно сложно лечить.

Не все мутации влияют на функцию полученного белка. Если вы хотите сформировать фундаментальное понимание геномики как в отношении здоровья, так и болезней, важно уметь различать разные типы генетических мутаций, которые могут произойти. Здесь мы рассмотрим некоторые мутации, с которыми можно встретиться, и их влияние на геном.

Примечание: Если вы немного заблудились и хотите подвести итоги, ознакомьтесь с другими нашими статьями, в которых рассматриваются некоторые из основных принципов геномики.

Что такое миссенс-мутация?

Миссенс-мутация возникает, когда есть ошибка в коде ДНК и одна пары оснований ДНК заменяется, например, A заменяется на C.

Это единственное изменение означает, что ДНК теперь кодирует другую аминокислота, известная как замена. Иногда изменение аминокислоты вообще не влияет на получающуюся функцию белка.В некоторых случаях изменение аминокислоты на самом деле усиливает функцию белка , но в других случаях оно может в конечном итоге сделать белок «неисправным».

Визуальное изображение миссенс-мутации.

Что такое бессмысленная мутация?

Подобно миссенс-мутации, бессмысленная мутация также включает одно изменение пары оснований ДНК. Однако в случае бессмысленной мутации это единственное изменение приводит к выработке стоп-кодона, тем самым преждевременно прекращая синтез белка.Результат? Укороченный белок, который может функционировать , но также не может.

Визуальное изображение бессмысленной мутации.

Что такое инсерционная мутация?

Инсерционная мутация включает добавление одной ( или более ) пар нуклеотидных оснований в последовательность ДНК. Инсерционные мутации могут различаться по размеру: от вставки только одной пары оснований в последовательность ДНК до вставки участка хромосомы в другую хромосому.Конечным результатом является потенциально неисправный белок. Визуальное изображение вставочной мутации.

Что такое делеционная мутация?

Как видно из названия, делеционная мутация происходит, когда часть ДНК удаляется из последовательности. Размер удаляемой ДНК может варьироваться по длине, от одной пары оснований до целого гена или нескольких последовательных генов. Удаление ДНК может снова поставить под угрозу функцию кодируемого белка. Визуальное изображение делеционной мутации.

Что такое мутация сдвига рамки считывания?

Мутация сдвига рамки считывания возникает, когда вышеупомянутые «добавляющие» или «делеционные» мутации приводят к изменению рамки считывания гена, которая включает группы из трех оснований, кодирующих аминокислоту. Изменение рамки считывания изменяет группировку оснований и впоследствии изменяет кодируемые аминокислоты. Часто кодируемый белок нефункционален.

Визуальное изображение мутации сдвига рамки считывания.

Что такое дупликационная мутация?

В случае дупликационной мутации фрагмент ДНК (ненормально) копируется. Это может происходить один или несколько раз и, следовательно, может повлиять на функциональность кодируемого белка. Визуальное изображение дупликационной мутации.

Сводная таблица мутаций

Мутация Описание
Missense Ошибка в коде ДНК, одна из пар оснований ДНК изменена Нонсенс Единичное изменение в коде ДНК дает стоп-кодон, преждевременно прекращает синтез белка
Вставка Добавление одной (или нескольких) пар нуклеотидных оснований в последовательность ДНК
Делеция Часть ДНК удаляется из последовательности
Сдвиг рамки Добавление или удаление мутации приводит к изменению рамки считывания гена
Дупликация ДНК ненормально копируется
обзор

Мутации кальциевых каналов при гипокалиемическом периодическом параличе

Миссенс-мутации по остаткам аргинина в сегментах датчика напряжения S4 Са V 1.1 приходится примерно 60% случаев семейной HypoPP (40,49). Канал Ca 2+ скелетных мышц L-типа представляет собой гетеропентамер с основной порообразующей субъединицей α 1 , Ca V 1.1 и четырьмя вспомогательными субъединицами, β, γ, α 2 и δ. Мутации только субъединицы α 1 Ca V 1.1 были идентифицированы в семейном HypoPP. Напротив, мутации Ca V 1.1 также описаны в отношении предрасположенности к злокачественной гипертермии.

Как и в случае с другими формами периодического паралича, провоцирующим событием для острого приступа в Ca V 1.1 — HypoPP является деполяризация остатка V , которая инактивирует каналы Na + и делает волокно невосприимчивым (4). Механизм, с помощью которого вызванные деполяризацией эпизоды паралича в HypoPP могут быть причинно связаны с миссенс-мутациями в Ca V 1.1, оставался загадкой более 10 лет. Канал Ca 2+ L-типа в скелетных мышцах функционирует в первую очередь как датчик напряжения, который связывает деполяризацию TT с открытием рецептора рианодина и высвобождение Ca 2+ из SR.Канал не играет известной роли в стабилизации покоя V , и в биопсийных волокнах пациентов с HypoPP не было обнаружено никаких дефектов связи возбуждения и сокращения. Понимание патомеханизма HypoPP для мутаций Ca V 1.1 было по аналогии с дефектами, вызванными мутациями в гомологичных областях сегментов S4 в Na V 1.4 (39,41). Было высказано предположение, что ток утечки стробирующей поры, подобный тому, который измеряется в мутантных каналах HypoPP — Na V 1.4, продуцируется аргининовыми мутациями в S4 Ca V 1.1. Этот аномальный входящий ток в состоянии покоя V может вызвать восприимчивость к парадоксальной деполяризации с гипокалиемией в Ca V 1.1-HypoPP. Экспериментальное подтверждение пока невозможно, поскольку мембранная экспрессия Ca V 1.1 в гетерологичных системах экспрессии недостаточна. Гипотеза получила подтверждение в результате наблюдений, что (i) мутации аргинина, спроектированные в сегменты S4 других каналов (например, канал Shaker K), приводят к стробированию поровых токов, (ii) пять из шести известных мутаций HypoPP в Ca V 1 .1 представляют собой миссенс-мутации аргининов в S4, причем выбросом является валин для глутамата в соседнем сегменте S3, который в принципе может поддерживать ток закрывающейся поры, и (iii) шесть из девяти аргининовых мутаций в S4 Na V 1.4. были испытаны экспериментально, и все шесть производят токи затворных пор; тогда как преобразование S4 аргинина в цистеин в Na V 1.4, связанное с PMC, не вызывает ток закрывающейся поры (50).

Мутация и восстановление ДНК

Мутация и восстановление ДНК

Мутация ДНК и
Ремонт

Мутация, которая может
возникают во время репликации и / или рекомбинации, это постоянное изменение
нуклеотидная последовательность ДНК.Поврежденная ДНК может быть мутирована либо путем замены, либо
удаление или вставка пар оснований. Мутации по большей части безвредны
кроме случаев, когда они приводят к гибели клеток или образованию опухолей. Из-за смертельного
потенциал мутаций ДНК клетки развили механизмы для восстановления поврежденных
ДНК.

Типы мутаций

Существует три типа мутаций ДНК: замены оснований, делеции.
и прошивки.

1. Замена базы

Одиночная база Замены
называются точечными мутациями, вспомним точечную мутацию Glu ——> Val, которая
вызывает серповидно-клеточную анемию. Точечные мутации — самый распространенный тип мутаций.
и есть два типа.

Переход : это происходит
когда пурин замещен другим пурином или когда пиримидин замещен
с другим пиримидином.

Трансверсия : когда пурин
замещает пиримидин или пиримидин заменяет пурин.

Точечные мутации, встречающиеся в ДНК
последовательности, кодирующие белки, либо молчащие, либо бессмысленные, либо бессмысленные.

Бесшумный : при замене
встречается в третьей позиции кодона, есть большая вероятность, что синоним
кодон будет сгенерирован.Таким образом, аминокислотная последовательность, кодируемая геном, имеет вид
не изменен, и мутация молчит.

Отсутствие : при замене базового
приводит к генерации кодона, который определяет другую аминокислоту и
следовательно, приводит к другой полипептидной последовательности. В зависимости от типа амино
кислотная замена миссенс-мутация может быть консервативной или неконсервативной.
Например, если структура и свойства замещенной аминокислоты являются
очень похожа на исходную аминокислоту, мутация считается консервативной
и, скорее всего, мало повлияет на структуру результирующих белков.
/ функция.Если замена приводит к аминокислоте с очень другой структурой
и свойства, мутация неконсервативна и, вероятно, будет вредной
(плохо) для структуры / функции результирующих белков (т. е. серповидной клетки
точечная мутация).

Нонсенс : При подстановке базы
приводит к стоп-кодону, в конечном итоге усекающему перевод и, скорее всего, ведущему
к нефункциональному белку.

2.Исключения

Удаление, приводящее к сдвигу кадра,
результат, когда одна или несколько пар оснований теряются из ДНК (см. рисунок выше).
Если одна или две базы удаляются, трансляционный фрейм изменяется, в результате чего
в искаженном сообщении и нефункциональном продукте. Удаление трех и более
основания оставляют рамку считывания нетронутой. Результат удаления одного или нескольких кодонов
в белке отсутствует одна или несколько аминокислот. Это может быть вредно или нет.

3. Вставки

Прошивка дополнительной базы
пары могут привести к сдвигу кадра в зависимости от того, кратно ли трем
вставлены пары оснований. Комбинации вставок и удалений, приводящие к
также возможны различные исходы.

Причины мутаций

Ошибки репликации ДНК

В очень и очень редких случаях ДНК
полимераза будет включать некомплементарное основание в дочернюю цепь.Во время следующего раунда репликации неверно инкорпорированная база приведет к
мутация. Однако это случается очень редко, поскольку экзонуклеаза выполняет функцию корректора.
механизм распознавания несовпадающих пар оснований и их удаления.

Ошибки рекомбинации ДНК

ДНК часто перестраивается
процесс, называемый рекомбинацией, протекает через множество механизмов. Изредка
ДНК теряется во время репликации, что приводит к мутации.

Химическое повреждение ДНК

Многие химические мутагены, некоторые экзогенные,
некоторые искусственные, некоторые из окружающей среды способны повредить ДНК. Многие химиотерапевтические
лекарства и препараты интеркалирующих агентов действуют, повреждая ДНК.

Излучение

Гамма-лучи, рентгеновские лучи, даже УФ-свет
может взаимодействовать с соединениями в клетке, генерируя свободные радикалы, которые вызывают
химическое повреждение ДНК.

Восстановление ДНК

Поврежденная ДНК может быть восстановлена ​​несколькими
разные механизмы.

Устранение несоответствия

Иногда ДНК-полимераза включает
неправильный нуклеотид во время синтеза цепи и система редактирования от 3 ‘до 5’,
экзонуклеаза, не может исправить это. Эти несоответствия, а также одиночные базовые вставки
и удаления исправляются с помощью механизма исправления несоответствия. Исправление несоответствия
полагается на вторичный сигнал в ДНК, чтобы различать родительские
цепь и дочерняя цепь, содержащая ошибку репликации.Клетки человека
обладает системой восстановления несоответствия, аналогичной системе E. coli, которая описана
здесь. Метилирование последовательности GATC происходит на обеих цепях через некоторое время после
Репликация ДНК. Поскольку репликация ДНК полуконсервативна, новая дочь
цепь остается неметилированной в течение очень короткого периода времени после репликации.
Это различие позволяет системе исправления несоответствий определить, какая цепь
содержит ошибку. Белок, MutS распознает и связывает несовпадающее основание.
пара.

Другой белок, MutL, затем связывается
к MutS, а частично метилированная последовательность GATC распознается и связывается
эндонуклеаза, MutH. Комплекс MutL / MutS затем связывается с MutH, который разрезает
неметилированная цепь ДНК на сайте GATC. ДНК-геликаза, MutU раскручивает
Нить ДНК в направлении несовпадения и экзонуклеаза разрушает
прядь. Затем ДНК-полимераза заполняет разрыв, а лигаза закрывает его. Дефекты
гены репарации несоответствия, обнаруженные у людей, по-видимому, связаны с
развитие наследственного колоректального рака.

Эксцизионное восстановление нуклеотидов
(NER)

NER в клетках человека начинается с
образование комплекса белков XPA, XPF, ERCC1, HSSB при поражении на
ДНК. Фактор транскрипции TFIIH, содержащий несколько белков, затем связывается
к комплексу в АТФ-зависимой реакции и делает разрез. Результирующий
Затем 29-нуклеотидный сегмент поврежденной ДНК разматывается, разрыв заполняется (ДНК
полимераза) и ника (лигаза).

Прямой ремонт поврежденной ДНК

Иногда повреждение базы может быть
непосредственно восстанавливается специализированными ферментами без удаления нуклеотида.

Восстановление рекомбинации

Этот механизм позволяет ячейке
повторить повреждение и исправить его позже.

Регламент контроля повреждений

У млекопитающих регулируется репарация ДНК.
клетки с помощью сенсорного механизма, который обнаруживает повреждение ДНК и активирует белок
называется p53.p53 — фактор регуляции транскрипции, который контролирует экспрессию
некоторых генных продуктов, влияющих на клеточный цикл, репликацию ДНК и репарацию ДНК.
Вот некоторые из функций p53, которые только сейчас выясняются: стимуляция.
экспрессии генов, кодирующих p21 и Gaad45. Потеря функции p53 может
быть вредным, около 50% всех раковых заболеваний человека имеют мутированный ген p53.

Белок p21 связывает и инактивирует
киназа клеточного деления (CDK), которая приводит к остановке клеточного цикла.p21 также связывает
и инактивирует PCNA, что приводит к инактивации репликационных вилок. В
Комплекс PCNA / Gaad45 участвует в эксцизионной репарации поврежденной ДНК.

Некоторые примеры болезней, возникающих в результате
от дефектов в механизмах репарации ДНК.

Ксеродерма
пигментный

Кокейна
синдром

Наследственный
неполипозный колоректальный рак

© Д-р Ноэль
Штурм 2019


Заявление об ограничении ответственности: Взгляды и мнения, выраженные на неофициальных страницах штата Калифорния
Университет, преподаватели, сотрудники или студенты университета Домингес Хиллс являются строго такими же
авторы страницы.Содержание этих страниц не проверялось или
одобрен Калифорнийским государственным университетом, Домингес-Хиллз.

Анализ показывает роль миссенс-мутаций в аутизме | Спектр

Ошибка копирования: Многие миссенс-мутации, которые изменяют одну аминокислоту в белке, безвредны.

© iStock.com / Aysunbk

Анализируя тысячи последовательностей, исследователи сосредоточили внимание на крохотных участках генома, которые, по их словам, могут иметь решающее значение для определения риска аутизма.Они представили неопубликованные результаты в среду на ежегодном собрании Американского общества генетиков человека в Балтиморе в 2015 году.

Анализ позволит исследователям отсеять тысячи миссенс-мутаций — тех, которые изменяют одну аминокислоту в белке — у людей с аутизмом.

Миссенс-мутации часто безвредны или имеют незначительные эффекты. Как группа, обнаруженные до сих пор миссенс-мутации лишь незначительно чаще встречаются у людей с аутизмом, чем у контрольной группы. Чтобы найти факторы риска аутизма, генетики обычно вместо этого сосредотачиваются на мутациях «потери функции», которые разрушают белок.

В новой работе ученые определили области, составляющие до 14 процентов экзома — 1 процент генома, который кодирует белки. Они обнаружили, что у людей с аутизмом в три раза больше шансов получить миссенс-мутацию в этих регионах. За пределами этих изысканных регионов эта разница исчезает.

«Впервые мы можем сосредоточиться на небольшом подмножестве бессмысленных вариантов, которые имеют высокую вероятность релевантности», — говорит ведущий исследователь Марк Дейли, доцент медицины Массачусетской больницы общего профиля.

Исследователи могут слишком быстро предположить, что мутация связана с аутизмом, потому что она de novo , то есть присутствует у человека с аутизмом, но не у его или ее родителей. Но не все эти мутации будут факторами риска, говорит Томас Буржерон, профессор генетики Института Пастера в Париже.

«Все, что может помочь определить, является ли ген патогенным, будет очень полезно», — говорит он. «Мы должны очень внимательно относиться к генам, на которые мы смотрим,« haute couture »и стараться понять, где находятся их консервативные части.”

Охотничьи экзоны:

Новая работа следует из исследования, проведенного в прошлом году, в котором использовались данные примерно 6000 последовательностей от людей без аутизма для оценки вероятности случайной мутации любого одного гена.

При расчете учитывается исходная скорость мутации определенного трио нуклеотидов — например, AGA в ATA — в некодирующих областях генома. Он также учитывает длину гена, поскольку длинные гены случайным образом накапливают больше мутаций, чем короткие.

Дэйли и его коллеги затем искали мутации de novo с потерей функции в более чем 1000 семей, в которых есть один ребенок с аутизмом, но здоровые родители, братья и сестры. Они обнаружили 1003 гена, несущих больше этих мутаций, чем ожидалось, у людей с аутизмом и меньше, чем ожидалось, у 6000 контрольных групп 1 .

Новая работа делает шаг вперед, разбивая гены на их кодирующие белок фрагменты или экзоны. Точное расположение миссенс-мутации в гене может существенно повлиять на то, является ли мутация доброкачественной или вредной.

Исследователи смогли погрузиться в этот анализ глубже, чем когда-либо прежде, благодаря выпуску в прошлом году почти 61 000 экзомов из общей популяции, крупнейшего из когда-либо существовавших наборов таких последовательностей, Консорциумом агрегации экзомов (EXAC).

«Мы ожидаем, что в EXAC будет так много миссенс-мутаций, что мы сможем начать изучать более тонкие закономерности», — говорит Кейтлин Самоча, аспирантка лаборатории Дейли, которая представила результаты.

Экзоны :

Исследователи применили свой расчет к последовательностям EXAC и обнаружили почти 6000 генов, несущих меньше миссенс-мутаций, чем можно было бы ожидать случайно.Примерно в четверти этих генов миссенс-мутации распределены неравномерно, при этом некоторые субрегионы особенно «ограничены» в содержании миссенс-мутаций.

Например, один ген имеет только половину ожидаемого количества вариаций в целом. Но при более тщательном анализе они обнаружили, что два экзона гена несут 144 мутации по сравнению с ожидаемыми 158 мутациями, тогда как два других экзона содержат только 44 мутации по сравнению с ожидаемыми 233.

Эти ограниченные области вместе составляют до 14 процентов экзома.Они, как правило, богаты вредными мутациями. Например, вариант миссенс, включенный в ClinVar — совокупность всех вариантов, обнаруженных у людей с каким-либо расстройством, — примерно в 30 раз чаще попадает в одну из этих областей, чем где-либо еще в экзоме.

Чтобы изучить роль этих областей в расстройствах, исследователи рассмотрели отдельный набор последовательностей от 5622 человек с аутизмом, задержкой развития, умственной отсталостью или эпилепсией и 2078 человек из контрольной группы.

Они обнаружили, что любая мутация, которая чаще встречается у людей с умственной отсталостью или задержкой развития, чем у людей контрольной группы, попадает в одну из ограниченных областей.Они увидели ту же тенденцию, но в меньшей степени, у людей с аутизмом или эпилепсией.

Следующим шагом, говорит Дейли, будет составление списка миссенс-мутаций, которые попадают в эти области у людей с аутизмом. Список может указывать на новых кандидатов аутизма, которые не появятся в результате исследований мутаций с потерей функции. «Мы хотели бы закончить эту работу, фактически идентифицировав впервые гены, специально обогащенные миссенс-вариацией», — говорит Дейли. «Я думаю, что самое интересное в том, что сейчас у нас есть возможность действительно их найти.”

Редкие повторы :

Огромный размер набора данных EXAC также помогает уточнить понимание исследователями de novo мутаций . Примерно одна треть мутаций de novo , обнаруженных у людей с аутизмом, также присутствует в EXAC.

Это подмножество мутаций de novo также не чаще встречается у людей с аутизмом, чем у их здоровых братьев и сестер. Джек Космицки, аспирант лаборатории Дейли, представил эти неопубликованные результаты на плакате в среду.

Наблюдения показывают, что этот набор мутаций не является вредным и поэтому не был выделен из генома в результате эволюции, — говорит Брайан О’Роак, доцент кафедры молекулярной и медицинской генетики Орегонского университета здоровья и науки в Портленде. О’Роак не участвует в этом исследовании, но обнаружил аналогичную тенденцию в своих данных. О’Роак говорит, что некоторые сайты в геноме также могут быть гипермутабельными и, следовательно, с большей вероятностью будут подвергаться мутациям со временем.

Подобные открытия помогают уточнить, на чем в геноме исследователи должны сосредоточить свои усилия, — говорит Самоча.«Это другой способ сказать, что если вы видите это у другого человека [у которого нет аутизма], это не может быть так важно для аутизма».

Для получения дополнительных отчетов с Ежегодного собрания Американского общества генетиков человека в 2015 г. щелкните здесь.

Влияние мутаций на функцию белка: бессмысленные, бессмысленные и тихие мутации — видео и стенограмма урока

Мутации и центральная догма

Всегда помните об исходной идее, основанной на центральной догме.Центральная догма гласит, что ДНК создает РНК, а РНК создает белок. К этому моменту вы, вероятно, знаете, что код в ДНК определяет код в мРНК, а код в мРНК определяет последовательность аминокислот. Аминокислотные цепи являются основой структуры белка. Итак, если что-то пойдет не так с ДНК, то и мРНК тоже будет неправильной. Если мРНК неверна, то аминокислотная цепь будет неправильной. И это вызовет проблемы с белком. Давайте посмотрим, как различные мутации могут повлиять на гипотетический организм.

Наш организм назовем розовекрылой пони. Это пони, у него большие розовые крылья, и он умеет летать. Перья на его крыльях сделаны из белкового кератина. Но это особый вид кератина, который придает пони волшебную способность летать. Назовем его «магикератин».

Магикератин — это белок, состоящий из одного полипептида, одной цепи из четырех различных аминокислот. Первая аминокислота — метионин, вторая — пролин, третья — серин и последняя — валин.Они просто расположены в алфавитном порядке. Эти четыре аминокислоты должны быть правильно построены путем генетической трансляции. В противном случае магикератин пони не будет синтезирован должным образом. Пони с розовыми крыльями может даже потерять способность летать!

Теперь мы знаем, какие аминокислоты нам понадобятся. Но как их получить? Их нужно транслировать из кода мРНК. Генетический код магикератина — AUG CCA UCA GUU UGA. UGA — стоп-кодон. Этот код является версией мРНК гена магикератина.Но изначально мРНК произошла из ДНК. Чтобы найти исходный код ДНК, мы должны использовать комплементарные пары оснований. Убедитесь, что вы ввели букву T вместо U, поскольку мы переходим от РНК к ДНК. Таким образом, исходный код ДНК был бы TAC GGT AGT CAA ACT. Это первоначальный ген магикератина. Теперь у нас есть цепь ДНК, и теперь мы можем опробовать наши собственные точечные мутации!

Нить ДНК для магикератина

Ошибочные, бессмысленные и тихие мутации

Мы собираемся протестировать серию замен оснований.Сначала мы возьмем здесь второй G и заменим его на T. Это новый код ДНК, поэтому он даст немного другой код мРНК. Из нашей таблицы кодонов мы знаем, что коды AUG для метионина, коды CAA для глутамина, коды UCA для серина и коды GUU для валина. И снова UGA — стоп-кодон. Что ж, это близко к нашему полипептиду магикератина. Но там, где второй аминокислотой должен был быть пролин, вместо него мы получили глютамин. Итак, наш белок немного не в порядке, как и перья у нашего розовокрылого пони.О, нет! Наша пони изменилась! Он все еще может летать, но все его крылья заметны. У него могут быть проблемы с привлечением партнера. Это пример миссенс-мутации . Миссенс-мутация — это точечная мутация, при которой кодон изменяется на другую аминокислоту. Обычно это изменяет полипептид и, следовательно, может изменить функцию всего белка. Мы называем это миссенс-мутацией, потому что она приводит к неправильной трансляции белка из исходного гена. Наш пони неправильно получил пятнистые крылья, когда он должен был получить простые розовые крылья.

Миссенс-мутации приводят к получению другой аминокислоты и могут изменить функцию белка.

Давайте начнем сначала и попробуем другую замену основания. Мы заменим эту букву G буквой C. Полученная мРНК будет изменена на одну букву, так что же будет в результате полипептид? Коды AUG для метионина, коды CCA для пролина и коды UGA для… подождите, это стоп-кодон!

Замена G на C приводит к стоп-кодону

Итак, мы даже не можем продолжать строительство.Мы должны остановиться, и теперь магикератин вообще не будет производиться. Вы знаете что это значит? Нашему розовекрылому пони придется избавиться от перьев! Этот тип мутации называется нонсенс-мутацией . Это точечная мутация, которая превращает один кодон в стоп-кодон. Бессмысленные мутации всегда приводят к преждевременному прекращению полипептида. Другими словами, цепь останавливается, и белок никогда не завершается. У нашего пони нет перьев, и он никогда не сможет летать.

Бессмысленные мутации приводят к тому, что белок не дорабатывается

Теперь мы начнем с третьего типа подстановки оснований.Давайте заменим последнюю букву «А» на букву «Т». Просто взглянув на схему, вы можете угадать, на какую из четырех аминокислот повлияет это изменение? Правильно, четвертый. Итак, мы получаем цепь мРНК, которая кодирует метионин, пролин, серин и валин. Держать на секунду; аминокислота не изменилась! Почему в конце мы все же получили валин? О, даже несмотря на то, что наш кодон изменился, он все еще указывал на валин. Видеть? Код GUU и GUA для валина. Точечная мутация, которая не оказывает общего влияния на функцию белка, называется молчащей мутацией .Иногда молчащая мутация приводит к такой же точной последовательности аминокислот. Вот что здесь произошло. В других случаях при тихой мутации происходит изменение аминокислоты, но это не влияет на общую функцию белка. В случае с нашим пони магикератин вообще не изменился бы при таком типе мутации. У него все еще были бы простые розовые крылья, и он все еще мог бы летать.

Тихие мутации не влияют на общую функцию белка.

Мутации в реальном мире

Использование пони с розовыми крыльями было интересным способом узнать о последствиях точечных мутаций.Но в реальной жизни точечные мутации часто не так уж и интересны. Они могут вызывать нарушения здоровья, потому что в конечном итоге меняют работу важных белков. Серповидно-клеточная анемия — одно из заболеваний, вызываемых миссенс-мутацией. Мутация происходит в гене гемоглобина. Гемоглобин — это белок, который помогает нам переносить кислород в кровоток. Это также влияет на форму наших красных кровяных телец, которые должны быть круглыми, чтобы плавно перемещаться по кровеносным сосудам. Если у кого-то есть миссенс-мутация в гене гемоглобина, его красные кровяные тельца будут иметь форму серпа и не смогут хорошо перемещаться по сосудам.В результате у этого человека будут проблемы с циркуляцией кислорода по всему телу. У них разовьется анемия, поэтому им поставлен диагноз серповидноклеточная анемия.

Одно заболевание, вызванное бессмысленной мутацией, — мышечная дистрофия Дюшенна, также называемая МДД. Пациенты с МДД страдают тяжелой мышечной слабостью, которая со временем ухудшается. У них есть бессмысленная мутация в гене дистрофина, который кодирует белок дистрофин. Дистрофин — это структурный белок, который помогает формировать нашу мышечную ткань.Когда у кого-то есть бессмысленная мутация в гене дистрофина, его мышцы не могут развиваться правильно. Пациенты с мышечной дистрофией имеют проблемы с ходьбой и другими важными двигательными навыками.

Мышечная дистрофия Дюшенна вызвана бессмысленной мутацией

Резюме урока

Точечные мутации могут вызвать серьезные изменения в организме, если они изменят способ работы белка. Мутация в ДНК изменяет мРНК, которая, в свою очередь, может изменить аминокислотную цепь.Замена основания может иметь три различных эффекта на белок организма. Это может вызвать миссенс-мутацию , которая переключает одну аминокислоту в цепи на другую. Это может вызвать нонсенс-мутацию , которая приводит к более короткой цепи из-за раннего стоп-кодона. И замена основания также может вызвать молчащую мутацию , при которой функция белка вообще не изменяется. Замены оснований ответственны за такие расстройства, как серповидно-клеточная анемия, вызванная миссенс-мутацией, и мышечная дистрофия Дюшенна, вызванная бессмысленной мутацией.

Результаты обучения

По завершении этого урока вы сможете:

  • Определять и проиллюстрировать бессмысленные, бессмысленные и скрытые мутации
  • Приведите примеры нарушений, вызванных замещением оснований

Нонсенс и миссенс мутация митохондриального гена ND6 способствует миграции клеток и инвазии в аденокарциному легкого человека | BMC Cancer

Образцы аденокарциномы легкого

В это исследование было включено 87 пациентов с первичной аденокарциномой легкого, перенесших пульмонэктомию.Образцы опухолей и парные образцы нормальной легочной ткани, взятые из места, удаленного от ракового поражения, были получены от согласившихся пациентов, как одобрено Комитетом по медицинской этике больницы Чанхай и больницы общего профиля Фучжоу, и все пациенты дали письменное согласие на использование образцов ткани. Ни один из пациентов до операции не получал лучевую или химиотерапию. Клинические и патологические данные, включая возраст, пол, классификацию патологии, стадию опухоли и метастазы в лимфатические узлы, были получены из медицинских записей.

Клеточная культура

Клеточная линия аденокарциномы легкого человека A549 была приобретена в Шанхайском институте биохимии и клеточной биологии (Шанхай, Китай). Клетки поддерживали в RPMI1640 (Invitrogen) с добавлением 10% фетальной бычьей сыворотки (Invitrogen), 100 Ед / мл пенициллина и 100 мкг / мл стрептомицина в увлажненной атмосфере, содержащей 5% CO 2 , при 37 ° C.

Образцы аденокарциномы легкого механически диссоциировали и затем переваривали в среде, содержащей 150 мкг / мл коллагеназы типа IV, 2 мкг / мл ДНКазы типа I и 10 мкг / мл гиалуронидазы типа V (Sigma) в течение 2 часов при 37 ° C.Полученную суспензию клеток фильтровали через нейлоновую сетку 38 мкм, собирали отдельные клетки и затем высевали в колбы 25 см 2 . После слияния клетки после отделения подвергали субкультивированию путем воздействия 0,25% трипсина в течение 2 минут при 37 ° C. Клетки ресуспендировали в свежей среде RPMI 1640 с 10% фетальной бычьей сывороткой в ​​увлажненной атмосфере, содержащей 5% CO 2 , при 37 ° C.

Секвенирование митохондриального гена ND6

Полную клеточную ДНК образцов ткани экстрагировали с использованием наборов геномной ДНК QIAamp (Qiagen).Образец ДНК хранили при -20 ° C до использования. Митохондриальный ген ND6 амплифицировали с помощью ПЦР (смысл: ggcataattaaactttacttc; антисмысл: catatcattggtcgtggttgtag) из экстрагированной ДНК и затем подвергали прямому секвенированию. Условия ПЦР были установлены при 94 ° C в течение 2 минут с последующими 30 циклами амплификации при 94 ° C в течение 15 секунд, 58 ° C в течение 15 секунд и 68 ° C в течение 40 секунд, а окончательное удлинение при 68 ° C в течение 6 мин. Продукты ПЦР подвергали электрофорезу в 1,5% агарозном геле для разделения полос ДНК и визуализировали с помощью ультрафиолетового освещения после окрашивания бромидом этидия.Затем из геля вырезали интересующую полосу ДНК и подвергали прямому секвенированию. Результаты сравнивали попарно со ссылкой на базу данных митохондриального генома человека (http://www.mitomap.org/MITOMAP).

Конструирование цитоплазматического гибрида

Цитоплазматические гибриды конструировали, как описано ранее [19]. Вкратце, сублиния клеток A549 без митохондрий (клетки A549 ρ0, ядерный донор) была сконструирована обработкой 100 нг / мл бромистого этидия (EB). Полное истощение мтДНК было подтверждено анализом ПЦР.Культивируемые клетки первичной аденокарциномы легких (с мутациями гена ND6 в качестве донора мтДНК и без них) получали путем их предварительной обработки цитохалазином B (10 мкг / мл) при 37 ° C в течение 20 минут и центрифугированием при 9000 × g при 37 ° C в течение 10 минут. мин. Полученные цитопласты сливали с клетками ρ0 полиэтиленгликолем.

Анализ активности НАДН-дегидрогеназы

Клетки в лог-фазе роста собирали, и активность митохондриальной НАДН-дегидрогеназы определяли с помощью набора для анализа НАДН (Abcam).Вкратце, НАДН и цитохром с (окисленная форма) использовали в качестве субстратов для оценки активности НАДН-дегидрогеназы, а восстановление цитохрома с контролировали при 550 нм.

Анализ продукции АФК

Генерация АФК была обнаружена с помощью митохондриального супероксидного индикатора MitoSOX-RED (Invitrogen). Клетки инкубировали с 5 мкМ MitoSOX-RED в течение 10 мин при 37 ° C в бессывороточной среде DMEM, дважды промывали фосфатно-солевым буфером (PBS), а затем немедленно анализировали с помощью проточного цитометра FACScan (Becton Dickinson, Mountain View, CA , СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ).Клетки, инкубированные с MitoSOX-RED и показавшие красную флуоресценцию, были определены как ROS-положительные клетки.

Анализ заживления ран

Клетки аденокарциномы легкого высевали на 6-луночные планшеты с плотностью 5 × 10 5 клеток / лунку. После того, как клетки достигли субконфлюэнтности, однослойные клетки были ранены путем соскабливания клеток и затем выращены в среде в течение 72 часов. Расстояние миграции клеток контролировали и отображали под микроскопом. Расстояния миграции клеток рассчитывали путем вычитания расстояния между краями поражения через 48 часов из расстояния, измеренного через 0 часов.Относительное расстояние миграции клеток измеряется расстоянием миграции клеток / расстоянием, измеренным в 0 часов.

Transwell assay

Миграцию и инвазию клеток определяли с помощью transwell (Costar) с размером пор 0,8 мкм. 5 × 10 3 клеток высевали в бессывороточную среду в верхней камере (нормальная камера для анализа миграции и камера, покрытая матригелем для анализа инвазии). Нижняя камера была заполнена средой, содержащей 10% FBS. После инкубации в течение 8 часов при 37 ° C клетки в верхней камере осторожно удаляли ватным тампоном, а клетки, которые прошли на обратную сторону мембраны, фиксировали в метаноле, окрашивали Гимза и подсчитывали.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *