Мкб стоматит: Код диагноза K12 — Стоматит и родственные поражения

Содержание

Афтозный стоматит — лечение и профилактика в Москве

Афтозный стоматит — это поражение слизистой оболочки ротовой полости воспалительного генеза. Обязательным признаком является появление язвочек, так называемых афт. Патологический процесс сопровождается неприятными симптомами, при прогрессировании заболевания прием пищи становится затруднительным.

Заболевание часто встречается у детей и лиц со сниженным иммунитетом. При отсутствии должного лечения приобретает хроническую форму. Она имеет рецидивирующее течение, возобновление симптомов обычно случается в периоды падения иммунитета.

Афтозный стоматит согласно МКБ-10 (международной классификации болезней) имеет код К 12.0 и относится к группе “рецидивирующие афты полости рта”. Это не напрасно, при отсутствии комплексного лечения, направленного не только на устранение местных проявлений, но и укрепление защитных механизмов, заболевание часто возникает повторно.

Причины заболевания

Афтозный стоматит у детей и взрослых вызван разными причинами:

  • травмами слизистой;
  • наследственностью;
  • хроническими заболеваниями;
  • гиповитаминозом;
  • сопутствующими заболеваниями полости рта;
  • инфекционными болезнями;
  • аллергией.

Самая частая причина — повреждения слизистой оболочки. Это происходит при употреблении жесткой пищи, при ношении брекетов или протезов, неаккуратном уходе за зубами и деснами. Травмы часто имеют место у детей, поскольку они могут засовывать в рот посторонние предметы, которые не только повреждают эпителий, но и являются источником инфекции.

Наследственный фактор играет роль при хроническом стоматите. Исследования показали, что в большинстве случаев у лиц, с хроническим заболеванием родственники также страдали этой патологией.

Многие соматические заболевания приводят к угнетению защитных сил организма, что в свою очередь увеличивает процент заболеваемости афтозным стоматитом.

Дефицит витаминов и микроэлементов в рационе отрицательно сказывается на состоянии слизистых Они истончаются, теряют защитную функцию. Если в организм поступает недостаточно витаминов С, В, А, Е, железа, цинка, селена, риск заболеть стоматитом существенно возрастает.

Очаг инфекции в ротовой полости — фактор риска. Самым распространенным источником инфекции являются кариозные зубы. Даже незначительная травма слизистой сразу приведет к стоматиту.

Инфекционные заболевания снижают иммунитет, а при некоторых патологиях формируется хронический очаг инфекции. Эти факторы увеличивают риск заболеть афтозным стоматитом.

Заболевание иногда имеет аллергический характер. Установлено, что у больных с реакциями гиперчувствительность может наблюдаться подобное поражение.

Заболевание обусловлено множеством факторов, поэтому лечение должно быть комплексным.

Симптомы стоматита

Проявления афтозного стоматита у взрослых и детей зависят от формы и стадии. В любом случае отмечаются болевые ощущения во рту различной интенсивности и присутствует дефект слизистой.

Фибринозная форма сопровождается расстройством микроциркуляции в эпителии во рту. На слизистой образуются язвочки, выстланные фибринозным налетом. Они локализуются преимущественно на внутренней части губ и на языке. Такая форма часто встречается в детском возрасте. Заболевание склонно к рецидивированию. Падение иммунитета, стресс, травмы слизистой ротовой полости могут спровоцировать повторное появление афт.

Некротическая форма характерна для лиц с тяжелыми соматическими заболеваниями, патологией крови и дефектами иммунитета. Для такого стоматита характерен некроз слизистой. Язвы практически безболезненные, глубокие, их заживление длиться до месяца.

Для грандулярного стоматита характерно появление афт в области выхода протоков слюнных желез. Это вызывает нарушение их функции. Болевой синдром при этой форме выражен, а процесс восстановления слизистой длится до трех недель.

Рубцующийся стоматит типичен для людей молодого возраста и обусловлен наследственными факторами. Поражения глубокие, до 1,5 см в диаметре. В процесс вовлекаются протоки слюнных желез. Заживление язв длительное и может протекать в течение 2-3 месяцев, на слизистой всегда остаются рубцовые изменения.

Наиболее тяжелая клиническая форма афтозного стоматита — деформирующая. В этом случае поражение слизистой наиболее глубокое, после заживления образуются выраженные деформации и микростомы.

Проявления афтозного стоматита могут быть разными, поэтому пациент далеко не всегда может оценить свое состояние и поставить правильный диагноз. Рассмотрев фото этого заболевания, вы убедитесь, что его проявления разнообразны. Самолечение может оказаться неэффективным и привести к прогрессированию болезни. Любые дефекты слизистой ротовой полости, болезненность во время приема пищи являются поводами для немедленного визита в стоматологическую клинику. В пользу стоматита говорят такие симптомы, как вялость, гипертермия, жжение во рту, изменение вкусового восприятия. Только стоматолог может установить причину нарушений и назначить эффективную терапию.

Лечение афтозного стоматита

Грамотное лечение способен назначить только квалифицированный специалист, так как выбор тактики зависит от стадии и формы заболевания.

Перед началом лечения необходимо установить, что послужило причиной заболевания и устранить вредные факторы. Это будет способствовать быстрому выздоровлению. Мероприятия, направленные на укрепление иммунитета, имеют решающее значение и позволяют организму быстрее справиться с проблемой. Прием поливитаминов и иммуномодуляторов поможет ускорить процесс выздоровления и избежать рецидивов.

При афтозном стоматите необходима тщательная ревизия ротовой полости. Если есть кариес, зубные отложения, нужна срочная санация. У пациентов, которые носят коронки, съемные протезы, брекеты, эти конструкции могут травмировать слизистую. Если это имеет место, необходима коррекция ортопедических и ортодонтических конструкций.

Местное лечение заключается в использовании антисептиков. Широко используются такие лекарства, как хлоргексидин, стоматидин, перекись водорода, фурацилин. Они позволяют предотвратить распространение инфекции и ведут к постепенной гибели возбудителя. При осложненных случаях, присоединении вторичной инфекции назначаются антибиотики.

Симптоматическая терапия назначается индивидуально и зависит от состояния пациента. При сильно выраженном болевом синдроме назначаются обезболивающие препараты, при отечности слизистой — антигистаминные, при повышении температуры — антипиретические средства.

Следует помнить, что стоматит является заразным заболеванием, поэтому ребенок с таким диагнозом не допускается в детский коллектив, а взрослому необходимо выделить индивидуальную посуду.

Комплексное лечение афтозного стоматита позволяет в минимальные сроки устранить неприятные симптомы, предотвратить осложнения заболевания и способствует быстрому заживлению дефектов слизистой.

Профилактика

Основная мера профилактики афтозного стоматита — соблюдение гигиенических требований. Ежедневная чистка зубов, полоскание рта после еды позволят избавиться от остатков пищи, которые являются благоприятной средой для развития бактерий. При очистке промежутков между зубами следует действовать осторожно, чтобы не повредить слизистую. Выбирайте зубную щетку, которая не травмирует десна.

Детей следует отучать облизывать руки и грызть различные предметы. Также следует ограничить контакт с малышами, у которых появились проявления стоматита.

Полноценный рацион, насыщенный витаминами и микроэлементами, поможет сохранить здоровье слизистой полости рта. Помните, что твердая пища, кислое, шоколад, острое, кофе, а также никотин раздражают слизистую, что создает благоприятную среду для внедрения инфекции.

Причиной возникновения афтозного стоматита может оказаться неправильный выбор зубной пасты. Если в ее составе есть лаурилсульфат натрия, лучше заменить средство для гигиены ротовой полости. Это вещество сушит слизистую, снижая ее защитные свойства.

Регулярно посещайте стоматолога, при малейших признаках кариеса проводите санацию ротовой полости. Кариозный зуб является очагом инфекции, поэтому воспаление слизистой может возникнуть в любой момент.

При протезировании зубов следите, чтобы конструкция не давила или не царапала слизистую. Если такая проблема есть, сразу сообщите об этому доктору, который проведет коррекцию. В месте раздражения слизистой стоматит появляется довольно часто. То же самое касается пациентов, которые проходят ортодонтическое лечение.

Афтозный стоматит — заболевание, вызывающее неприятные симптомы. Препятствует нормальному приему пищи и склонно прогрессировать и рецидивировать. Уделяйте должное внимание профилактическим мероприятиям, чтобы избежать этой проблемы. Если первые симптомы все же появились — обратитесь в стоматологическую клинику.

МКБ-10. K12 Стоматит и родственные поражения

Классификация пункта

Рубрика: Международная классификация болезней МКБ-10
Класс: XI. K00-K93. Болезни органов пищеварения
Блок: K00-K14. Болезни полости рта, слюнных желез и челюстей
Пункт: K12. Стоматит и родственные поражения

Описание пункта

Исключено: гангренозный стоматит (A69.0)
гингивостоматит, вызванный вирусом герпеса [herpes simplex] (B00. 2)
нома (A69.0)
распадающаяся язва рта (A69.0)
хейлит (K13.0)

Состав пункта

K12.0 Рецидивирующие афты полости рта
K12.1 Другие формы стоматита
K12.2 Флегмона и абсцесс полости рта

Лекарственные средства

Абисил

Аквазан

Ампровизоль

Анти-Ангин Формула

Бадана корневища брикет круглый

Бетадине

Биовиталь Гель для детей (Киндер Биовиталь)

Биорал

Вокара

Галавит

Гексадрепс

Гексализ

Гексорал табс

Гипозоль

Грамицидин С

Граммидин

Граммидин нео

Граммидин с анестетиком нео

Дезоксинат

Деринат

Доктор Тайсс Анги Септ

Доктор Тайсс Шалфей

Доналгин

Доритрицин

Дрилл

Йокс

Календулы настойка

Календулы цветков брикет круглый

Клиндамицин

Колдрекс ЛариПлюс

Лактобактерин

Ларипронт

Лингезин

Мирамистин

Нимулид

Новосепт Форте

Облепиховое масло

Оригинальный большой бальзам Биттнера

Оспексин

Пефлоксацин-АКОС

Пипракс

Пиралвекс

Повидон-йод

Пропосол

Ромазулан

Сангвиритрин линимент 1%

Себидин

Септолете Д

Септолете Нео

Септолете плюс

Солкосерил дентальная адгезивная паста

Стоматофит

Стрепсилс

Стрепсилс с Витамином C

Стрепсилс с ментолом и эвкалиптом

Суприма-ЛОР

Тантум Верде

ТераФлю ЛАР

Тимактида таблетки 0,00025 г

Трансамча

Тыквеол масло для приема внутрь

Фалиминт

Фарингосепт

Фелексин

Фервекс от боли в горле

Флогэнзим

Фурацилин

Фурацилина таблетки для наружного употребления 0,02 г

Хиконцил

Холисал

Ципринол

Ципробид

Ципрофлоксацина гидрохлорида таблетки, покрытые оболочкой, 0,25 г

Эрмицед

Эхинацея композитум СН

Действующие вещества

Амбазон

Ацетиламинонитропропоксибензол

Бензидамин

Биклотимол

Деквалиния хлорид

Диклонин

Карбеноксолон

Мочевины пероксид

Фуразидин

Холина салицилат

Ориентировочные сроки временной нетрудоспособности при наиболее распространенных заболеваниях и травмах (в соответствии с МКБ-10)

Ориентировочные сроки временной нетрудоспособности при наиболее распространенных заболеваниях и травмах (в соответствии с МКБ-10)

УТВЕРЖДЕНЫ
первым заместителем
министра здравоохранения
Российской Федерации
А. И.Вялковым
18.08.2000
от 21 августа 2000 года N 2510/9362-34

УТВЕРЖДЕНЫ
заместителем председателя
Фонда социального страхования
Российской Федерации В.В.Линником
18.08.2000
от 21 августа 2000 года N 02-08/10-1977П

Рекомендации для руководителей лечебно-профилактических учреждений и лечащих врачей, специалистов — врачей исполнительных органов Фонда социального страхования Российской Федерации

Экспертиза временной нетрудоспособности проводится в соответствии с «Инструкцией о порядке выдачи документов, удостоверяющих временную нетрудоспособность граждан», утвержденной приказом Министерства здравоохранения и медицинской промышленности РФ и Фонда социального страхования РФ от 19.10.94 N 206/21 с изменениями и дополнениями, внесенными приказом Минздравмедпрома России и Постановлением Фонда социального страхования РФ от 25.06.96 N 267/66; приказом Министерства здравоохранения и медицинской промышленности РФ от 13. 01.95 N 5 «О мерах по совершенствованию экспертизы временной нетрудоспособности», а также разъяснениями Минздрава России и Фонда социального страхования РФ от 14.11.96 N 2510/5084-96-27 «Некоторые вопросы экспертизы временной нетрудоспособности граждан»; от 17.02.97 N 2510/1041-97/051/26-97 о порядке выдачи листков нетрудоспособности и выплате пособия по государственному социальному страхованию при медицинской стерилизации; от 24.06.98 N 2510/5034-96-27 «О признании недействительным (незаконным) пункта 5.2.6 вышеуказанной Инструкции»; от 28.08.98 N 2510/7924-98-32/02-08/07-1711П «О порядке замены документов, подтверждающих временную нетрудоспособность граждан стран СНГ, работающих на территории Российской Федерации»; от 18.08.99 N 5608-АО/2510/9049-99-32/02-08/07-1960П «О порядке выдачи и оформления листков нетрудоспособности при направлении граждан на медико-социальную экспертизу»; от 02.11.98 N 2510/9681-98-32/02-08/07-2176П «О решении Верховного Суда РФ»; от 05.01.2000 N 2510/40-32/02-08/10-17П о порядке выдачи, продления, оформления и оплаты листков нетрудоспособности по уходу за больным членом семьи, здоровым ребенком, или ребенком-инвалидом в случае осуществления ухода попеременно разными членами семьи».

Экспертиза временной нетрудоспособности — вид медицинской экспертизы, основной целью которой является оценка состояния здоровья пациента с точки зрения возможности осуществления им профессиональной деятельности, определение степени и сроков временной утраты нетрудоспособности и, в ряде случаев — прогноза дальнейшей трудовой деятельности.

Длительность временной нетрудоспособности зависит от характера течения заболевания, социальных условий, профессиональных требований и т.д.

Ориентировочные сроки временной нетрудоспособности — продолжительность освобождения больных от работы, которая необходима для проведения диагностических, лечебных и реабилитационных мероприятий с целью компенсации нарушенных функций организма и создания возможности возврата к трудовой деятельности или, при неблагоприятном трудовом и клиническом прогнозе, направления на медико-социальную экспертизу для рассмотрения вопроса о признании лица инвалидом.

Ориентировочные сроки временной утраты трудоспособности носят рекомендательный характер. Однако значительное увеличение или сокращение ориентировочных сроков временной нетрудоспособности (на 30 и более процентов) должно служить поводом для проведения экспертизы временной нетрудоспособности заведующим отделением, клинико-экспертной комиссией (КЭК) с оценкой объемов, качества и эффективности медицинской помощи, применения современных медицинских технологий, своевременности привлечения к лечебному процессу других специалистов или медицинских учреждений с целью определения объективных или субъективных факторов и принятия адекватных мер.

В настоящих рекомендациях представлены ориентировочные сроки временной нетрудоспособности при некоторых инфекционных и паразитарных заболеваниях (класс I), (класс II), болезнях крови, кроветворных органов и отдельных нарушениях, вовлекающих иммунный механизм (класс III), болезнях эндокринной системы, расстройствах питания и нарушениях обмена веществ (класс IV), психических расстройствах и расстройствах поведения (класс V), болезнях нервной системы (класс VI), болезнях глаза и его придаточного аппарата (класс VII), болезнях уха и сосцевидного отростка (класс VIII), болезнях системы кровообращения (класс IX), болезнях органов дыхания (класс X), болезнях органов пищеварения (класс XI), болезнях кожи и подкожной клетчатки (класс XII), болезнях костно-мышечной системы и соединительной ткани (класс XIII), болезнях мочеполовой системы (класс XIV), при травмах, отравлениях и некоторых других последствиях воздействия внешних причин (класс XIX).

Каждая нозологическая форма болезни имеет два кода: один соответствует «Международной статистической классификации болезней и проблем, связанных со здоровьем» десятого пересмотра (МКБ-10), второй — номеру строки статистической формы N 16-ВН «Сведения о причинах временной нетрудоспособности», утвержденной постановлением Госкомстата России от 29.06.99 N 49.

При многих нозологических формах ориентировочные сроки временной нетрудоспособности даны с учетом особенностей клинического течения болезни, степени или стадии заболевания, вида лечения (консервативное или оперативное). Ориентировочные сроки при травмах и отравлениях определены с учетом уровня и локации травмы, ее характера и тяжести.

Рекомендации предназначены для лечащих врачей, осуществляющих экспертизу нетрудоспособности, заведующих отделениями стационаров и поликлиник, заместителей руководителей лечебно-профилактических учреждений и главных внештатных специалистов по клинико-экспертной работе, клинико-экспертных комиссий, руководителей органов и учреждений здравоохранения, специалистов исполнительных органов Фонда социального страхования Российской Федерации.

Таблица 1. Ориентировочные сроки временной нетрудоспособности при некоторых инфекционных и паразитарных болезнях (класс I по МКБ-10)

Таблица 1

Код по МКБ-10

Номер строки по форме N 16-ВН

Наименование болезни по МКБ-10

Особенности клинического течения болезни, вида лечения и пр.

Ориентировочные сроки ВН (в днях)

1

2

3

4

5

А00-А09

Кишечные инфекции

А00

03, 04

Холера

Обезвоживание I-II степени

9-11

Обезвоживание III-IV степени

15-20

А01. 0

03, 04

Брюшной тиф

35-45

А01.1

03, 04

Паратиф А

30-40

А01.2

03, 04

Паратиф В

30-40

А01.3

03, 04

Паратиф С

30-40

А02.0

03, 04

Сальмонеллезный энтерит

10-20

А03.

03, 04

Шигеллез

10-20

А04.4

03, 04

Энтерит, вызванный Escherichia coli

5-15

А05.0

03, 04

Стафилококковое пищевое отравление

5-10

А05.1

03, 04

Ботулизм

30-60

А05.2

03, 04

Пищевое отравление, вызванное клостридиями

8-15

А06. 0

03, 04

Острая амебная дизентерия

14-20

А08.4

03, 04

Вирусный энтерит, гастроэнтерит

7-12

А15-А19

Туберкулез

А15.0

Туберкулез легких, подтвержденный бактериоскопически с наличием или отсутствием роста культуры

А15.0

05, 06

Туберкулез легких очагоговый

Фаза инфильтрации

Фаза распада

4-5 мес.

5-6 мес.

А15.0

05, 06

Туберкулез легких инфильтративный

Фаза инфильтрации, ограниченный процесс в пределах 1-2 сегментов

4-6 мес.

Фаза распада

6-8 мес.

А15.0

05, 06

Туберкулез легких инфильтративный

Распространенный процесс

10-12 мес.

А15.0

05, 06

Казеозная пневмония

Распространенный процесс

10-12 мес. , МСЭ

А15.0

05, 06

Туберкулома легких

Фаза инфильтрации:

Очаги единичные мелких и средних размеров

4-6 мес.

Очаги крупные

8-10 мес.

А15.0

05, 06

Туберкулома легких

Фаза распада

8-10 мес.

Оперативное вмешательство по поводу туберкуломы

4-10 мес.

А15.0

05, 06

Туберкулез легких кавернозный

Ограниченный односторонний

6-8 мес.

Распространенный двусторонний

8-12 мес., МСЭ

А15.0

05, 06

Туберкулез легких фиброзно-кавернозный

8-12 мес.

А15.0

05, 06

Туберкулез легких цирротический

Ограниченный односторонний

4-6 мес.

Распространенный двусторонний

8-10 мес.

А15.4

Туберкулез внутригрудных лимфатических узлов, подтвержденный бактериологически и гистологически (исключая первичный)

А15.4

05, 06

Туберкулез внутригрудных лимфатических узлов

Фаза инфильтрации

6-8 мес.

БОЛЕЗНИ ПОЛОСТИ РТА, СЛЮННЫХ ЖЕЛЕЗ И ЧЕЛЮСТЕЙ (K00-K14) «МЕЖДУНАРОДНАЯ КЛАССИФИКАЦИЯ БОЛЕЗНЕЙ (МКБ-10)» (утв. Приказом Минздрава РФ от 27.05.97 N 170) (Часть I)

K00 Нарушения развития и прорезывания зубов
Исключено: ретенированные и импактные зубы (K01. -)
K00.0 Адентия
K00.1 Сверхкомплектные зубы
K00.2 Аномалии размеров и формы зубов
Исключено: бугорковая аномалия Карабелли, рассматриваемая как вариант нормы и не подлежащая кодированию
K00.3 Крапчатые зубы
Исключено: отложения [наросты] на зубах (K03.6)
K00.4 Нарушения формирования зубов
Исключено:
крапчатые зубы (K00.3)
резцы Гетчинсона и моляры в виде тутовых ягод при врожденном сифилисе (A50.5)
K00.5 Наследственные нарушения структуры зуба, не классифицированные в других рубриках
K00.6 Нарушения прорезывания зубов
K00. 7 Синдром прорезывания зубов
K00.8 Другие нарушения развития зубов
K00.9 Нарушение развития зубов неуточненное
K01 Ретенированные и импактные зубы
Исключено: ретенированные и импактные зубы с неправильным положением их или соседних зубов (K07.3)
K01.0 Ретенированные зубы
K01.1 Импактные зубы
K02 Кариес зубов
K02.0 Кариес эмали
K02.1 Кариес дентина
K02.2 Кариес цемента
K02.3 Приостановившийся кариес зубов
K02.4 Одонтоклазия
K02. 8 Другой кариес зубов
K02.9 Кариес зубов неуточненный
K03 Другие болезни твердых тканей зубов
Исключено:
бруксизм (F45.8)
кариес зубов (K02.-)
скрежетание зубами БДУ (F45.8)
K03.0 Повышенное стирание зубов
K03.1 Сошлифовывание зубов
K03.2 Эрозия зубов
K03.3 Патологическая резорбция зубов
K03.4 Гиперцементоз
K03.5 Анкилоз зубов
K03.6 Отложения [наросты] на зубах
K03.7 Изменение цвета твердых тканей зубов после прорезывания
Исключено: отложения [наросты] на зубах (K03. 6)
K03.8 Другие уточненные болезни твердых тканей зубов
K03.9 Болезнь твердых тканей зубов неуточненная
K04 Болезни пульпы и периапикальных тканей
K04.0 Пульпит
K04.1 Некроз пульпы
K04.2 Дегенерация пульпы
K04.3 Неправильное формирование твердых тканей в пульпе
K04.4 Острый апикальный периодонтит пульпарного происхождения
K04.5 Хронический апикальный периодонтит
K04.6 Периапикальный абсцесс с полостью
K04.7 Периапикальный абсцесс без полости
K04.8 Корневая киста
Исключено: боковая киста периодонтальная (K09. 0)
K04.9 Другие и неуточненные болезни пульпы и периапикальных тканей
K05 Гингивит и болезни пародонта
K05.0 Острый гингивит
Исключено:
гингивостоматит, вызванный вирусом простого герпеса [herpes simplex] (B00.2)
острый некротизирующий язвенный гингивит (A69.1)
K05.1 Хронический гингивит
K05.2 Острый пародонтит
Исключено:
острый апикальный периодонтит (K04.4)
периапикальный абсцесс (K04.7)
— с полостью (K04.6)
K05.3 Хронический пародонтит
K05. 4 Пародонтоз
K05.5 Другие болезни пародонта
K05.6 Болезнь пародонта неуточненная
K06 Другие изменения десны и беззубого альвеолярного края
Исключено:
атрофия беззубого альвеолярного края (K08.2)
гингивит:
— БДУ (K05.1)
— острый (K05.0)
— хронический (K05.1)
K06.0 Рецессия десны
K06.1 Гипертрофия десны
K06.2 Поражения десны и беззубого альвеолярного края, обусловленные травмой
K06.8 Другие уточненные изменения десны и беззубого альвеолярного края
K06. 9 Изменение десны и беззубого альвеолярного края неуточненное
K07 Челюстно-лицевые аномалии [включая аномалии прикуса]
Исключено:
атрофия и гипертрофия половины лица (Q67.4)
односторонняя мыщелковая гиперплазия или гипоплазия (K10.8)
K07.0 Основные аномалии размеров челюстей
Исключено:
акромегалия (E22.0)
синдром Робина (Q87.0)
K07.1 Аномалии челюстно-черепных соотношений
K07.2 Аномалии соотношений зубных дуг
K07.3 Аномалии положения зубов
Исключено: ретенированные и импактные зубы с нормальным положением (K01. -)
K07.4 Аномалия прикуса неуточненная
K07.5 Челюстно-лицевые аномалии функционального происхождения
Исключено:
бруксизм (F45.8)
скрежетание зубами БДУ (F45.8)
K07.6 Болезни височно-нижнечелюстного сустава
Исключено:
височно-нижнечелюстного сустава:
— вывих (SO3.0) }
— растяжение (S03.4) } текущий случай
K07.8 Другие челюстно-лицевые аномалии
K07.9 Челюстно-лицевая аномалия неуточненная
K08 Другие изменения зубов и их опорного аппарата
K08. 0 Эксфолиация зубов вследствие системных нарушений
K08.1 Потеря зубов вследствие несчастного случая, удаления или локальной периодонтальной болезни
K08.2 Атрофия беззубого альвеолярного края
K08.3 Задержка зубного корня [ретенционный корень]
K08.8 Другие уточненные изменения зубов и их опорного аппарата
K08.9 Изменение зубов и их опорного аппарата неуточненное
K09 Кисты области рта, не классифицированные в других рубриках
Включено: поражения с гистологическими особенностями аневризматической кисты и другого фиброзно-костного поражения
Исключено: корневая киста (K04.8)
K09.0 Кисты, образовавшиеся в процессе формирования зубов
K09. 1 Ростовые (неодонтогенные) кисты области рта
K09.2 Другие кисты челюстей
Исключено:
киста Стафне (K10.0)
скрытая костная киста челюсти (K10.0)
K09.8 Другие уточненные кисты области рта, не классифицированные в других рубриках
K09.9 Киста области рта неуточненная
K10 Другие болезни челюстей
K10.0 Нарушения развития челюстей
K10.1 Гигантоклеточная гранулема центральная
Исключено: периферическая гигантоклеточная гранулема (K06.8)
K10.2 Воспалительные заболевания челюстей
K10. 3 Альвеолит челюстей
K10.8 Другие уточненные болезни челюстей
K10.9 Болезнь челюсти неуточненная
K11 Болезнь слюнных желез
K11.0 Атрофия слюнной железы
K11.1 Гипертрофия слюнной железы
K11.2 Сиаладенит
Исключено:
увеопаротитная лихорадка Хирфорда (D86.8)
эпидемический паротит (B26.-)
K11.3 Абсцесс слюнной железы
K11.4 Свищ слюнной железы
Исключено: врожденный свищ слюнной железы (Q38.4)
K11.5 Сиалолитиаз
K11. 6 Мукоцеле слюнной железы
K11.7 Нарушения секреции слюнных желез
Исключено: сухость полости рта БДУ (R68.2)
K11.8 Другие болезни слюнных желез
Исключено: синдром сухости [болезнь Шегрена] (M35.0)
K11.9 Болезнь слюнной железы неуточненная
K12 Стоматит и родственные поражения
Исключено:
гангренозный стоматит (A69.0)
гингивостоматит, вызванный вирусом герпеса [herpes simplex] (B00.2)
нома (A69.0)
распадающаяся язва рта (A69.0)
хейлит (K13.0)
K12. 0 Рецидивирующие афты полости рта
K12.1 Другие формы стоматита
K12.2 Флегмона и абсцесс полости рта
Исключено: абсцесс:
— периапикальный (K04.6-K04.7)
— периодонтальный (K05.2)
— перитонзиллярный (J36)
— слюнной железы (K11.3)
— языка (K14.0)
K13 Другие болезни губ и слизистой оболочки полости рта
Включено: изменения эпителия языка
Исключено:
болезни языка (K14.-)
кисты области рта (K09.-)
некоторые изменения десны и беззубого альвеолярного края (K05-K06)
стоматит и родственные поражения (K12. -)
K13.0 Болезни губ
Исключено:
арибофлавиноз (E53.0)
трещина спайки губ (заеда) вследствие:
— кандидоза (B37.8)
— недостаточности рибофлавина (E53.0)
хейлит, связанный с излучением (L55-L59)
K13.1 Прикусывание щеки и губ
K13.2 Лейкоплакия и другие изменения эпителия полости рта, включая язык
Исключено: волосатая лейкоплакия (K13.3)
K13.3 Волосатая лейкоплакия
K13.4 Гранулема и гранулемоподобные поражения слизистой оболочки полости рта
K13.5 Подслизистый фиброз полости рта
K13. 6 Гиперплазия слизистой оболочки полости рта вследствие раздражения
Исключено: гиперплазия беззубого альвеолярного края вследствие раздражения (denture hyperplasia) (K06.2)
K13.7 Другие и неуточненные поражения слизистой оболочки полости рта
K14 Болезни языка
Исключено:
волосатая лейкоплакия (K13.3)
лейкедема }
лейкоплакия } языка
очаговая эпителиальная гиперплазия } (K13.2)
эритроплакия }
макроглоссия (врожденная) (Q38.2)
подслизистый фиброз языка (K13.5)
K14.0 Глоссит
Исключено: атрофический глоссит (K14. 4)
K14.1 «Географический» язык
K14.2 Срединный ромбовидный глоссит
K14.3 Гипертрофия сосочков языка
K14.4 Атрофия сосочков языка
K14.5 Складчатый язык
Исключено: расщепленный язык врожденный (Q38.3)
K14.6 Глоссодиния
K14.8 Другие болезни языка
K14.9 Болезнь языка неуточненная

Международная классификация стоматологических болезней / Стоматологическая клиника «Дантист», г. Первоуральск. Лечение зубов, удаление зубов, восстановление, протезирование, имплантология

Международная  классификация стоматологических болезней

               на основе МКБ -10

 

Некоторые инфекционные и паразитарные болезни

В00. 10 — простой герпес лица

В00.11 — простой герпес губы

В00.2Х — герпетический  гингивостоматит .

В02.20 — постгерпетическая невралгия тройничного нерва

В02.21 постгерпетическая невралгия других черепных нервов

В02.8Х — проявление в полости рта  опоясывающего  лишая

В07  — вирусные бородавки

В07.Х0 — простая бородавка полости рта

В07.Х1 — остроконечная кондилома полости рта

В08 .3Х — эритема инфекционная (пятая болезнь) проявления в полости рта

В08.4Х — энтеровирусный везикулярный  стоматит

В08.5 — герпетическая ангина

В20 — ВИЧ

В20.0Х — болезнь, вызванная ВИЧ  с проявлениями микобактериальной инфекции, проявления в полости рта

В20.1Х – болезнь, вызванная ВИЧ  с проявлениями других бактериальных инфекций, проявления в полости рта

В20.2Х — болезнь, вызванная ВИЧ  с проявлениями цитомеговирусного заболевания, проявления в полости рта

В20.3Х — болезнь, вызванная ВИЧ  с проявлениями  других вирусных  инфекций, проявления в полости рта.

В20.4Х — болезнь, вызванная ВИЧ с проявлениями кандидоза, проявления в полости рта

В37.00 — острый псевдомембранозный  кандидозный  стоматит

В37.01 — острый эритематозный (атрофический) кандидозный стоматит

В37.02 — хронический гиперпластический кандидозный стоматит (кандидозная лейкоплакия, множественный тип хронического гиперпластического кандидозного стоматита)

В37.03 — хронический эритематозный (атрофический) кандидозный стоматит (стоматит  под съемным  зубным протезом, вызванный кандидозной инфекцией)

В37.04 — кожно-слизистый  кандидоз

В37.05 — кандидозная гранулема  полости рта

В37.06 — ангулярный хейлит

В37.08 — другие уточненные  проявления в полости рта

В37.09 — проявления в полости рта неуточненные (кандидозный стоматит БДУ молочница БДУ)

В75.VХ — трихинеллез проявления в полости рта

 

Новообразования

С00 — злокачественное новообразование губы

С 43. 0 — злокачественное новообразование кожи губы меланома

С44.0 — злокачественное новообразование кожи губы

С00.0Х — злокачественное новообразование наружной поверхности  красной каймы верхней губы

С00.1Х — злокачественное новообразование наружной поверхности  красной каймы нижней губы

С01 — злокачественное новообразование основания языка  (верхней поверхности  основания языка  задней трети  языка)

С02  — злокачественное новообразование других и неуточненных частей языка

С03 — злокачественное новообразование десны (слизистой  оболочки  альвеолярного отростка  десны)

С04 — злокачественное новообразование дна полости рта

С05 — злокачественное новообразование неба

С06.0 — злокачественное новообразование слизистой оболочки  щеки

С06.1 — злокачественное новообразование  преддверия рта

С06.2 — злокачественное новообразование ретромолярной области

С07 — злокачественное новообразование околоушной  слюнной железы

С08 — злокачественное новообразование других и неуточненных больших слюнных желез

С31 — злокачественное новообразование придаточных пазух

С41. 1 — злокачественное новообразование нижней челюсти

С41.10 — саркома

С41.11 — злокачественная  одонтогенная опухоль

Новообразования  in situ

D00 — карцинома in situ полости рта

D00.00 — слизистой оболочки и красной каймы губы

D00.01 — слизистой оболочки щеки

D00.02 — десны и альвеолярного гребня при адентии

D00.03 — неба

D00.04 — дна полости рта

Доброкачественные новообразования

D10.0 — доброкачественное образование губы

D10.1 — доброкачественное образование языка

D10.2 — дна полости рта

D10.30 — слизистой оболочки щеки

D10.31 — слизистой оболочки щеки по линии смыкания

D10.32 — щечной борозды

D10.33 — десны и альвеолярного гребня при адентии врожденный эпулис

К06.82 — фиброзный эпулис

К06.81 — гигантоклеточная периферическая гранулема

О26.8 – гранулема, связанная с беременностью

D10. 34 — твердого неба соединения (границы) твердого и мягкого неба

D10.35 — мягкого неба

D10.37 — ретромолярной области

D10.38 — верхнечелюстного бугра

Доброкачественное образование  больших слюнных желез

D11.0 — околоушной слюнной железы

D11.70 — поднижнечелюстной железы

D11.71 — подъязычной железы

D11.9 — большой слюнной железы неуточненное

К10. 88 — экзостоз челюсти

К10.80 — херувизм

К10.83 — фиброзная дисплазия  челюсти

К10.1 — гигантоклеточная  гранулема

К10.00 — торусы челюсти

D16.4 — костей и черепа

D16.5 — нижней челюсти костной части

D17.0 — доброкачественное новообразование жировой ткани кожи и подкожной клетчатки головы, лица и шеи

D18.0Х — гемангиома   любой локализации проявления в полости рта

D18.1Х — лимфангиома проявления в полости рта

D22. — меланоформный невус

Е14.ХХ — сахарный диабет  проявления в полости рта

Болезни нервной системы

G40. VX — эпилепсия проявления полости  рта

G50 — поражение тройничного нерва

G50.0 — невралгия тройничного нерва (болезненный тик)

G50.1 — атипичная лицевая боль

G50.8 — другие поражения тройничного нерва

G50.9 — поражения тройничного нерва неуточненные

G51- поражение лицевого нерва

G52.1Х — языкоглоточная невралгия

G52 — поражения подъязычного нерва

Болезни системы кровообращения

I78.0 — наследственная  геморрагическая  телеангиэктазия

I86.0 —  варикозное  расширение подъязычных вен

I88 — неспецифический  лимфаденит

Болезни органов  дыхания

J01 — острый синусит

J01.0 — острый верхнечелюстной синусит

J01.1 — острый фронтальный синусит

J03  — острый тонзиллит

J10 — грипп

J32 — хронический синусит

J32.0 — хронический верхнечелюстной синусит

J35.0 — хронический тонзиллит

J36 — перитонзилярный абсцесс.

Болезни органов пищеварения

К00 — нарушения развития и прорезывания зубов

К00.0 — адентия

К00.00 — частичная адентия (гиподентия) (олигодентия)

К00.01 — полная адентия

К00.09 — адентия неуточненная

К00.1 — сверхкомплектные  зубы

К00.10 — областей резца и клыка мезиодентия (срединный зуб)

К00.11 — области премоляров

К00.12. — области моляров дистомолярный зуб, четвертый моляр, парамолярный  зуб

К00.19 — сверхкомплектные зубы  неуточненные

К00.2 — аномалии размеров и формы зубов

К00.20 — макродентия

К00.21 — микродентия

К00.22. — сращение

К00.23 — слияние (синодентия) и раздвоение (шизодентия)

К00.24 — выпячивание зубов (добавочные окклюзионные бугорки)

К00.25 — инвагинированный зуб (зуб в зубе) (дилатированная одонтома)

К00.26 — премоляризация

К00.27 — аномальные бугорки и эмалевые жемчужины (адамантома)

К00. 28 — бычий зуб (тауродонтизм)

К00.29 — другие и неуточненные аномалии размеров и формы зубов

К00.3 — крапчатые  зубы

К00.30 — эндемическая (флюорозная) крапчатость эмали (флюороз зубов)

К00.31 — неэндемическая  крапчатость  эмали (нефлюорозное  потемнение эмали )

К00.39 — крапчатые зубы неуточненные

К00.4 — нарушение  формирования зубов

К00.40 — гипоплазия эмали

К00. 41 — перинатальная гипоплазия эмали

К00.42 — неонатальная гипоплазия эмали

К00.43 — аплазия и гипоплазия цемента

К00.44. — дилацеразия (трещины эмали )

К00.45 — одонтодисплазия (региональная одонтодисплазия)

К00.46 — зуб Тернера

К00.48 — другие уточненные нарушения  формирования зубов

К00.49 — нарушения формирования зубов  неуточненные

К00.5 — наследственные нарушения  структуры  зуба, не классифицированные в других рубриках

К00.50 — незавершенный амелогенез

К00. 51 — незавершенный дентиногенез

К00.52 — незавершенный  одонтогенез

К00.58 — другие наследственные нарушения структуры зуба (дисплазия дентина, раковидные зубы)

К00 59 — наследственные нарушения структуры зуба  неуточненные

К00.6 — нарушения  прорезывания  зубов

К00.60 — натальные (прорезавшие к моменту рождения) зубы

К00.61 — неонатальные (у новорожденного, прорезавшиеся  преждевременно) зубы

К00.62 — преждевременное прорезывание (раннее прорезывание)

К00.63 — задержка (персистентная) смены первичных (временных) зубов

К00.64 — позднее прорезывание

К00.65 — преждевременное  выпадение  первичных (временных) зубов

К00.68 — другие уточненные  нарушения  прорезывания зубов

К00.69 — нарушение прорезывания зубов неуточненные

К00.7 — синдром прорезывания зубов

К00.8 — другие нарушения  развития зубов

К00.80 — изменение цвета зубов в процессе формирования  вследствие несовместимости  групп крови

К00. 81 — изменение цвета зубов в процессе формирования  вследствие врожденного  порока  билиарной системы

К00.82 — изменение цвета зубов в процессе  формирования  вследствие порфирии

К00.83 — изменение цвета зубов  в процессе формирования  вследствие применения  тетрациклина

К00.88 — другие уточненные нарушения  развития зубов

К00.9 — нарушение развития зубов  неуточненные

К01 — ретенированные и импактные зубы

К07.3-  ретенированные и импактные зубы  с неправильным  положением их или соседних зубов

К01.0 — ретенированные зубы (изменивший свое положение  при прорезывании без  препятствия  со стороны соседнего зуба)

К01.1 — импактные зубы (изменивший свое положение при прорезывании из-за препятствия  со стороны соседнего зуба)

К01.10 — резец верхней челюсти

К01.11 — резец  нижней челюсти

К01.12 — клык верхней челюсти

К01.13 — клык нижней челюсти

К01.14 — премоляр  верхней челюсти

К01 15. — моляр верхней челюсти

К01.17 — моляр  нижней  челюсти

К01.18 —  сверхкомплектный зуб

К01.19 — импактный зуб неуточненный

К02 — кариес зубов

К02.0 — кариес эмали  стадия белого (мелового) пятна (начальный кариес)

К02.1 — кариес  дентина

К02.2 — кариес цемента

К02.3 — приостановившийся кариес  зубов

К02.4 — одонтоклазия  детская меланодентия, меланодонтоклазия

К02.8 — другой уточненный кариес зубов

К02.9 — кариес зубов неуточненный

К03 — другие болезни твердых тканей зубов

F45.8 — бруксизм

К03.0 — повышенное стирание зубов

К03.00 — окклюзионное

К03.01 — апроксимальное

К03.08  — другое уточненное стирание зубов

К03.09 — стирание зубов неуточненное

К03.1 — сошлифовывание (абразивный  износ) зубов

К03.10 — вызванное зубным порошком (клиновидный дефект БДУ)

К03.11 — привычное

К03. 12 — профессиональное

К03.13 — традиционное (ритуальное)

К03.18 – другое уточненное сошлифовывание зубов

К03.19 – сошлифовывание зубов неуточненное

К03.2 — эрозия зубов

К03.20 — профессиональная

К03.21 — обусловленная персистирующей  регургитацией  или рвотой

К03.22 — обусловленная диетой

К03.23 — обусловленная лекарственными средствами и медикаментами

К03.24 — идиопатическая

К03.28 — другая уточненная  эрозия  зубов

К03.29 — эрозия зубов  неуточненная

К03.3 — патологическая резорбция зубов

К03.30 — внешняя (наружная)

К03.31 — внутренняя (внутренняя гранулема) (розовое пятно)

К03.39 — патологическая  резорбция  зубов неуточненная

К03.4 — гиперцементоз

К03.5 — анкилоз  зубов

К03.6 — отложения  (наросты) на зубах

К03.60 — пигментированый налет  (черный, зеленый, оранжевый)

К03.61 — обусловленные привычкой  употреблять  табак

К03. 61 — обусловленные привычкой жевать  бетель

К03.63 — другие  обширные  мягкие отложения (белые отложения)

К03.64 — наддесневой  зубной камень

К03.65 — поддесневой  зубной камень

К03.66 — зубной налет

К03.68 — другие уточненные отложения на зубах

К03.69 — отложения на зубах неуточненные

К03.7 — изменения цвета  твердых  тканей  зубов после  прорезывания  

К03.70 — обусловленные наличием  металлов и металлических соединений

К03.71 — обусловлены кровоточивостью пульпы

К03.72  — обусловлены  привычкой жевать бетель

К03.78 — другие уточненные  изменения  цвета

К03.79 — изменения цвета неуточненные

К03.8 — другие  уточненные  болезни твердых  тканей зубов

К03.80 —  чувствительный дентин

К03.81 — изменение эмали, обусловленные  облучением

К03.88 — другие уточненные болезни  твердых тканей  зубов

К03.9 — болезнь  твердых тканей  зубов  неуточненная

К04  — болезни пульпы и  периапикальных тканей

К04. 0 — пульпит

К04.00 — начальный (гиперемия)

К04.01 — острый

К04.02 — гнойный (пульпарный  абсцесс)

К04.03 — хронический

К04.04 — хронический язвенный

К04.05 — хронический гиперпластический(пульпарный  полип)

К04.08 — другой уточненный  пульпит

К04.09 — пульпит неуточненный

К04.1 — некроз  пульпы (гангрена пульпы)

К04.2 — дегенерация пульпы  дентикли, пульпарные  кальцификации, пульпарные  камни

К04.3 — неправильное формирование твердых тканей в пульпе

К04.4 острый  апикальный   периодонтит  пульпарного  происхождения 

К04.5 хронический  апикальный  периодонтит (апикальная  гранулема)

К04.6 периапикальный абсцесс со свищем  (дентальный абсцесс, дентоальвеолярный абсцесс, периодонтальный  абсцесс  пульпарного  происхождения)

К04.60 — имеющий сообщение (свищ) с верхнечелюстной  пазухой

К04.61 — имеющий  сообщение (свищ) с носовой полостью

К04. 62 — имеющий  сообщение (свищ) с полостью рта

К04.63 — имеющий сообщение (свищ) с кожей

К04.69 — периапикальный абсцесс со свищем  неуточненный

К04.7 — периапикальный  абсцесс без свища (дентальный абсцесс, дентоальвеолярный абсцесс, периодонтальный  абсцесс  пульпарного  происхождения)

К04.8 — корневая киста (апикальная (периодонтальная), периапикальная)

К04.80 — апикальная и боковая

К04.81 — остаточная

К04.82 — воспалительная  парадентальная

К09.04 — образовавшаяся  в процессе формирования  зубов  боковая  киста  периодонтальная

К04.89 — корневая киста  неуточненная

К04.9 — другие неуточненные болезни  пульпы и периапикальных  тканей

К05 — гингивит и болезни пародонта  

К05.0 — острый гингивит

К05.22 — острый перикоронит

А69.10 — острый  нектротический  язвенный  гингивит (фузоспирохетозный гингивит, гингивит Венсана)

К05.00 — острый  стрептококковый  гингивостоматит

К05. 08 — другой уточненный  острый  гингивит

К05.09 — острый гингивит  неуточненный

К05.1 хронический гингивит

К05.10 — простой  маргинальный

К05.11 — гиперпластический

К05.12 — язвенный

К05.13 — десквамативный

К05.18 — другой уточненный  хронический  гингивит

К05.19 — хронический гингивит  неуточненный

К05.2 — острый  парадонтит

К05.20 — парадонтальный абсцесс (периодонтальный абсцесс) десневого происхождения без свища

К05.21 — периодонтальный  абсцесс  (пародонтальный  абсцесс) десневого происхождения  со  свищем

К05.28 — другой  уточненный  острый пародонтит

К05.29 — острый  пародонтит неуточненный

К05.3 — хронический  пародонтит

К05.30 — локализованный

К05.31 — генерализованный

К05.32 — хронический  перикоронит

К05.33 — утолщенный  фолликул (гипертрофия  сосочка)

К05.38 — другой уточненный  хронический  пародонтит

К05. 39 — хронический  пародонтит неуточненный

К05.4 — пародонтоз

К05.5 — другие болезни пародонта

К06 — другие изменения  десны и беззубого альвеолярного  края

К08.2 — атрофия беззубого  альвеолярного края

К06.0 — рецессия десны (включены  постинфекционная, послеоперационная)

К06.00 — локальная

К06.01 — генерализованная

К06.09 — рецессия десны  неуточненная

К06.1 — гипертрофия  десны

К06.10 — фиброматоз десны

К06.18 — другая уточненная  гипертрофия  десны

К06.19 — гипертрофия десны неуточненная

К06.2 — поражения десны и беззубого альвеолярного края, обусловленные травмой

К06.20 — обусловленные травматической окклюзией

К06.21 — обусловленные чисткой зубов щеткой

К06.22 — фрикционный (функциональный) кератоз

К06.23 — гиперплазия  вследствие  раздражения  (гиперплазия связанная с ношением  съемного протеза)

К06. 28 — другие  уточненные  поражения  десны  и беззубого  альвеолярного  края , обуслословленные  травмой

К06.29 — неуточненные поражения  десны  и беззубого альвеолярного  края, обусловленные травмой

К06.8 — другие  уточненные  изменения  десны и беззубого альвеолярного  края

К06.80 — киста  десны взрослых

К06.81 — гигантоклеточная периферическая  гранулема (гигантоклеточный эпулис)

К06 82 — фиброзный эпулис

К06.83 — пиогенная  гранулема

К06.84 — атрофия  гребня  частичная

К06.88 — другие изменения

К06.9 — изменения десны и беззубого альвеолярного  края  неуточненные

К07 — челюстно-лицевые  аномалии (включая аномалии прикуса )

К07.0 — основные  аномалии  размеров  челюстей

Е22.0 — акромегалия

К10.81 — односторонняя мыщелковая гиперплазия

К10.82 — односторонняя мыщелковая  гипоплазия

К07.00 — макрогнатия верхней челюсти

К07.01 — макрогнатия  нижней челюсти

К07. 02 — макрогнатия обеих  челюстей

К07.03 — микрогнатия  верхней челюсти  (гипоплазия  верхней челюсти)

К07.04 — микрогнатия нижней челюсти (гипоплазия  н/ч)

К07 08 — другие уточненные аномалии размеров  челюстей

К07.09 — аномалии размеров челюстей  неуточненные

К07.1 — аномалии челюстно-черепных соотношений

К07.10 — ассиметрии

К07.11 — прогнатия н/ч

К07.12 — прогнатия в/ч

К07.13 — ретрогнатия н/ч

К07.14 — ретрогнатия  в/ч

К07.18 — другие уточненные аномалии челюстно-черепных соотношений

К07.19 — аномалии челюстно-черепных соотношений неуточненная

К07.2 — аномалии соотношения зубных  дуг

К07.20 — дистальный прикус

К07.21 — мезиальный прикус

К07.22 — чрезмерно глубокий  горизонтальный прикус (горизонтальное перекрытие)

К07.23 — чрезмерно глубокий  вертикальный прикус (вертикальное  перекрытие)

К07.24 — открытый  прикус

К07. 25 — перекрестный прикус (передний, задний)

К07.26 — смещение зубных дуг  от средней  линии

К07.27 — заднеязычный  прикус  нижних зубов

К07.28 — другие уточненные  аномалии соотношений зубных дуг

К07.29 — аномалии соотношений зубных дуг неуточненные

К07.3 — аномалии положения зубов

К07.30 — скученность (черепицеобразное перекрытие)

К07.31 — смещение

К07.32 — поворот

К07.33 — нарушение межзубных промежутков (диастема)

К07.34 — транспозиция

К07.35 — ретенированные или импактные зубы с неправильным  положением  их или соседних зубов

К07.38 — другие уточненные аномалии положения зубов

К07.39 — аномалии положения зубов неуточненные

К07.4 — аномалии прикуса  неуточненные

К07.5 —  челюстно – лицевые аномалии функционального  происхождения

К07 50 — неправильное смыкание челюстей

К07.51 — нарушение прикуса  вследствие нарушения глотания

К07. 54 — нарушение прикуса  вследствие ротового дыхания

К07.55 — нарушение прикуса  вследствие сосания языка, губ или пальца

К07.58 — другие уточненные  челюстно-лицевые аномалии функционального  происхождения

К07.59 —  челюстно – лицевая аномалия  функционального происхождения  неуточненная

К07.6 — болезни ВЧНС

К07.60 — синдром болевой  дисфункции ВНЧС (синдром Костена)

К07.61 — «щелкающая» челюсть

К07.62 — рецидивирующий  вывих и подвывих  ВНЧС

К07.63 — боль в ВНЧС  не квалифицированная в других рубриках

К07.64 — тугоподвижность ВНЧС не квалифицированная в других рубриках

К07.65 — остеофит ВНЧС

К07.68 — другие уточненные болезни

К07.69 — болезнь ВНЧС неуточненная

К08 — другие  изменения  зубов и их опорного аппарата

К08.1 — потеря  зубов  вследствие несчастного  случая, удаления  или  локализованного пародонтита

S03.2 — вывих зуба

К08. 2 — атрофия  беззубого альвеолярного  края

К08.3 — оставшийся  корень зуба

К08.8 — другие  уточненные  изменения  зубов и их  опорного  аппарата

К08.80 — зубная  боль БДУ

К08.81 — неправильная  форма альвеолярного отростка

К08.82-  гипертрофия  альвеолярного   края БДУ

К08.88 — другие изменения

К08.9 — изменения  зубов и их опорного  аппарата неуточненное

К09 — кисты области рта, не классифицированные  в других  рубриках 

К04.8 — корневая киста

К11.6 — мукоцеле слюнной  железы

К09.00 —  киста при прорезывании зубов

К09.01- киста десны

К09.02 —  роговая (первичная) киста

К09.03 —  фолликулярная (одонтогенная) киста

К09.04 — боковая  периодонтальная  киста

К09.08 —  другие уточненные одонтогенные кисты, образовавшиеся в процессе  формирования  зубов

К09.09 — одонтогенная киста, образовавшаяся  в процессе  формирования зубов  неуточненная

К09. 1 — ростовые (неодонтогенные ) кисты  области рта

К09.10 — глобуломаксиллярная  (верхнечелюстной пазухи) киста

К09.11 — средненебная киста

К09.12 — носонебная  (резцового канала ) киста

К09.13 — небная сосочковая  киста

К09.18 — другие уточненные  ростовые кисты области рта

К09.19 — ростовая киста  области  рта неуточненная

К09.2 — другие кисты  челюстей

К09.20 — аневризматическая костная  киста

К09.21 — единая костная (травматическая, геморрагическая) киста

К09.22 — зпителиальные  кисты  челюсти, не  индентифицированные как одонтогенные  или неодонтогенные

К09.28 другие  уточненные  кисты челюсти

К09.29 киста челюсти  неуточненная

К10 — другие болезни челюстей

К10.0 — нарушения развития челюстей

К10.00 — торус нижней  челюсти

К10.01 — торус  твердого неба

К10.02 — скрытая  костная  киста

К10.08 — другие уточненные  нарушения  развития  челюстей

К10. 09 — нарушения  развития челюстей  неуточненные

К10.1 — гигантоклеточная  гранулема  центральная

К10.2 — воспалительные  заболевания  челюстей

К10.20 — остеит челюсти

К10.3 — альвеолит  челюстей  альвеолярный  остеит ,сухая лунка

К10.21 — остеомиелит  челюсти

К10.22 — периостит челюсти

К10.23 — хронический  периостит  челюсти

К10.24 — неонатальный  остеомиелит   верхней челюсти

К10.25 — секвестр

К10.26 — радиационный  остеонекроз

К10.28 — другие  уточненные  воспалительные  заболевания  челюстей

К10.29 — воспалительное заболевание  челюстей  неуточненное

К10.8 — другие уточненные  болезни челюстей

К10.80 — херувизм

К10.81 — односторонняя гиперплазия  мыщелкового  отростка н/ч

К10.82 — односторонняя  гипоплазия  мыщелкового отростка н/ч

К10.83 — фиброзная  дисплазия  челюсти

К10.88 — другие уточненные болезни челюстей , экзостоз   челюсти

К11 — болезни слюнных желез

К11. 0 — атрофия  слюнной железы

К11.1 — гипертрофия слюнной железы

К11.2 — сиалоадеит

К11.3 — абсцесс слюнной железы

К11.4 — свищ слюнной железы

К11.5 — сиалолитиаз , камни в слюнном протоке

К11.6 — мукоцеле слюнной железы ,ранула

К11.60 — слизистая  ретенционная киста

К11.61 — слизистая киста  с экссудатом

К11.69 — мккоцеле слюнной железы неуточненное

К11.7 — нарушение секреции слюнных желез

К11.70 — гипосекреция

М35.0 — синдром Шегрена

К11.71 — ксеростомия

К11.72 — гиперсекреция (птиализм)

К11.78 — другие уточненные нарушения  секреции слюнных желез

К11.79 — нарушение секреции слюнных желез  неуточненные

К11.8 — другие болезни слюнных желез

К11.80 — доброкачественное  лимфоэпителиальное поражение  слюнной железы

К11.81- болезнь Микулича

К11.82 — стеноз (сужение) слюнного  протока

К11 83 — сиалэктазия

К11. 84 — сиалоз

К11.85 — некротизирующая  сиалометаплазия

К12 — стоматит и родственные  поражения

А69.0 — острый гангренозный

L23.0 — аллергический

В37.0 — кандидозный

К12.14 — контактный

В34.1 — вызванный  вирусом  Коксаки

Т36-Т50 — медикоментозный

В37.0 — микотический

К13.24 — никотиновый

В08.4 — везикулярный с экзантемой

К05.00 — стрептококковый  гингивостоматит

К12.0 — рецидивирующие афты  полости рта

К12.00 — резидивирующие  (малые) афты, афтозный стоматит, язвенное  поражение, афты Микулича, малые афты, рецидивирующие афтозные язвы.

К12.01 — рецидивирующий слизисто-некротический  периаденит, рубцующийся афтозный  стоматит, большие афты, афты Саттона

К12.02 — герпетиформный стоматит (герпетиформная  сыпь)

К12.03 — афты  Бернара

К12.04 — травматическое изъязвления

К12.08 — другие уточненные  рецидивирующие  афты  полости  рта

К12. 09 — рецидивирующие  афты  полости  рта неуточненные

К12.1 — другие формы  стоматита

К12.10 — стоматит  артефициальный

К12.11 — географический  стоматит

К14.1 — географический  язык

К12.12 — стоматит, связанный  с ношением  зубного протеза

В37.03 — кандидозный  стоматит, связанный с ношением  зубного протеза

К12.04 — травматическое  изъязвление, связанное  с ношением зубного протеза

К12.13 — папиллярная  гиперплазия неба

К12.14 —  контактный  стоматит, стоматит  «ватного валика»

К12.18 — другие  уточненные  формы  стоматита

К12.19 — стоматит  неуточненный

К12.2 — флегмона и абсцесс области рта

К04.6-К04.7 —  периапикальный  абсцесс

К05.21 — периодонтальный абсцесс

J36 — перитонзилярный абсцесс

К11.3 — абсцесс слюнной железы

К14.00 — абсцесс языка

К13 — другие болезни губ и слизистой  оболочки  полости рта
К13. 0 — болезни губ

L56.8Х — актинический хейлит

Е53.0 — арибофлавиноз

К13.00 — ангулярный  хейлит, трещина спайки губ (заеда)

В37.0 — заеда вследствие кандидоза

Е53.0 — заеда в следствии недостаточности рибофлавина

К13.01 — хейлит гранулярный  апостематозный

К13.02 — хейлит эксфолиативный

К13 03 — хейлит БДУ

К13.04 — хейлодиния

К13.08 — другие уточненные  болезни губ

К13.09 — болезнь губ неуточненная

К13.1 — прикусывание щеки и губ

К13.2 — лейкоплакия и другие изменения  эпителия  полости рта , включая язык

В37.02 — кандидозная лейкоплакия

В07.Х2 — очаговая эпителиальная  гиперплазия

К06.22 — фрикционный кератоз

К13.3 — волосатая лейкоплакия

К13.20 — лейкоплакия  идиопатическая

К12.21 – лейкоплакия, связанная с употреблением  табака

К13.24 — никотиновый лейкокератоз неба

К13.24 — небо курильщика

К13. 22 — эритроплакия

К13.23 — лейкодема

К13.28 — другие изменения  эпителия

К13.29 — неуточненные  изменения эпителия

К13.4 — гранулема и гранулемоподобные поражения сопр

К13.40 — пиогенная гранулема

К13.41 — эозинофильная  гранулема  СОПР

D76.00 — эозинофильная гранулема  кости

К13.42 — веррукозная ксантома

К13.5 — подслизистый фиброз  полости рта

К13.6 — гиперплазия СОПР  вследствие   раздражения

К06.23 — гиперплазия, связанная с ношением  съемного  протеза

К13.7 — другие  и неуточненные поражения СОПР

К13.70 — избыточная меланиновая пигментация, меланоплакия, меланоз  курильщика

К13.71 — свищ полости рта

Т81.8 — ороантральный  свищ

К13.72 — добровольная  татуировка

К13.73 — очаговый муциноз полости  рта

К13.78 — другие уточненные  поражения  СОПР ,белая линия

К13.79 — поражения СОПР неуточненные

К14 — болезни языка

К14. 0 — глоссит

К14.42 — атрофический  глоссит

К14.00 — абсцесс языка

К14.01 — травматическое  изъязвление  языка

К14.08  — другие уточненные глосситы

К14.09 —  глоссит неуточненный

К14.1 — географический язык, эксфолиативный  глоссит

К14.2 — срединный  ромбовидный  глоссит

К14.3 — гипертрофия сосочков  языка

К14.30 — обложенный язык

К14.31 — «волосатый» язык

К14.38 — волосатый язык  вследствие приема  антибиотиков

К14.32 — гипертрофия листовидных  сосочков

К14.38 — другая уточненная  гипертрофия сосочков языка

К14.39 — гипертрофия сосочков неуточненная

К14.4 — атрофия сосочков языка

К14.40 — вызванная  привычками очищать язык

К14.41 — вызванная системными нарушениями

К14.48 — другая уточненная атрофия  сосочков языка

К14.49 — атрофия  сосочков языка  неуточненная

К14.5 — складчатый, морщинистый, бороздчатый, расщепленный язык

К14. 6 — глоссодиния

К14.60 — глоссопироз (жжение в языке)

К14.61 — глоссодиния (боль в языке)

R43 — нарушение вкусовой чувствительности

К14.68 — другая  уточненная  глоссодиния

К14.8 — глоссодиния неуточненная

К14.8 — другие болезни языка

К14.80 — зубчатый язык (язык с отпечатками зубов)

К14.81 — гипертрофия языка

К14.82 — атрофия языка

К14.88 — другие уточненные болезни языка

К14.9 — болезнь языка неуточненная

К50 — болезнь Крона (региональный энтерит) проявления в полости рта

L02 — абсцесс кожи, фурункул и карбункул

L03 — флегмона

К12.2Х — флегмона  рта

L03.2 — флегмона лица

L04 — острый лимфаденит

I88.1 — хронический лимфаденит

L08 — другие местные инфекции кожи и подкожной клетчатки

L08.0 — пиодермия

L10 — пузырчатка

L10.0Х — пузырчатка обыкновенная, проявления в полости рта

L10.1 — пузырчатка вегетирующая

L10. 2 — пузырчатка листовидная

L10.5 — пузырчатка вызванная лекарственными средствами

L12 — пемфигоид

L13 — другие буллезные изменения

L23 — аллергический контактный дерматит

L40 — псориаз

L40.0 — псориаз обыкновенный

L42 — питириаз розовый

L43 — лишай красный плоский

L43.1 — лишай красный плоский буллезный

L43.8 — другой красный плоский лишай

L43.80 — проявления КПЛ папулезные в полости рта

L43.81 — проявления КПЛ ретикулярные в полости рта

L43.82 — проявления КПЛ атрофические и эрозивные в полости рта

L43.83 — проявления КПЛ (типичные бляшки) в полости рта

L43.88 — проявления КПЛ уточненные в полости рта

L43.89 — проявления КПЛ неуточненные в полости рта

L51 — эритема многоформная

L51.0 — небуллезная эритема многоформная

L51.1 — буллезная эритема многоформная

L51.9 — эритема многоформная неуточненная

L71 — розацеа

L80 — витилиго

L81 — другие нарушения пигментации

L82 — себорейный кератоз

L83 — акантоз негроидный

L90 — атрофические поражения кожи

L91. 0 — келоидный рубец

L92.2 — гранулема лица (эозинофильная гранулема кожи)

L92.3 — гранулема кожи и подкожной клетчатки, вызванная инородным телом

L93 — красная волчанка

L93.0 — дискоидная красная волчанка

L94.0 — локализованная склеродермия

L98.0 — пиогенная  гранулема

Инфекционные артропатии

М00 — пиогенный артрит

М02 — реактивные артропатии

М00.3Х — болезнь Рейтера ВНЧС

Воспалительные полиартропатии

М05 — серопозитивный ревматоидный  артрит

М08 — юношеский (ювенальный) артрит

М12.5Х — травматическая артропатия ВНЧС

М13 — другие артриты

М13.9 — артрит неуточненный

Артрозы

М15 — полиартроз

М19.0Х — первичный артроз ВНЧС

М35.0Х — синдром сухости (синдром Шегрена) проявление в полости рта

М79.1 — миалгия

М79.2 Х — невралгия и неврит неуточненные головы и шеи

М79. 5 — остаточное инородное тело  в мягких тканях

М80.VХ — остеопороз с патологическим переломом челюстей

М84.0Х — плохое срастание перелома головы и шеи

М84.1Х — несрастание  перелома (псевдоартроз) головы и шеи

М84.2 Х — замедленное сращение  перелома головы и шеи

М88 — болезнь  Педжета

О26.8 — другие уточненные состояния, связанные с беременностью

О26.80 — гингивит, связанный с беременностью

О26.81 — гранулема, связанная с беременностью

О26.88 — другие  уточненные проявления  в полости рта

О26.89 — проявления в полости рта неуточненные

Врожденные аномалии

Q85.0 — нейрофиброматоз

Q35- Q37-  расщелина губы и неба

Q75 — врожденные аномалии скуловых и  лицевых костей

Q18.4 — макростомия

Q18.5 — микростомия

Q18.6 — макрохейлия

Q18.7 — микрохейлия

Q21.3Х — тетрада Фалло проявления в полости рта

Q38.31 — раздвоение языка

Q38. 32 — врожденная спайка языка

Q38.33 — врожденная фиссура языка

Q38.34 — врожденная гипертрофия языка

Q38.35 — микроглоссия

Q38.36 — гипоплазия языка

Q38.40 — отсутствие слюнной железы или протока

Q38.42 — врожденный свищ слюнной железы

Q38.51 — высокое небо

Q90 — синдром Дауна

 

R06.5 — дыхание через рот (храп)

R19.6 — неприятный запах изо рта (зловонное дыхание)

R20.0 — анестезия кожи

R20.1 —  гипестезия кожи

R20.2 — парастезия кожи

R20.3 — гиперестезия

R23.0Х — цианоз проявления в полости рта

R23.2 — гиперемия (чрезмерное покраснение)

R23.3 — спонтанные экхимозы (перехии)

R43 — нарушения обоняния и вкусовой чувствительности

R43.2 — парагевзии

R47.0 — дисфазия и афазия

Травма

S00 — поверхностная травма головы

S00.0 — поверхностная травма волосистой  части головы

S00.1 — ушиб века и подглазничной области (синяк в области глаза)

S00. 2 — другие поверхностные травмы века и окологлазничной области

S00.3 — поверхностная травма носа

S00.4 — поверхностная травма уха

S00.50 — поверхностная травма внутренней поверхности щеки

S00. 51 — поверхностная травма других областей рта (включая  язык)

S00.52 — поверхностная травма губы

S00.59 — поверхностная травма губы и полости рта неуточненная

S00.7 — множественные поверхностные травмы головы

S01 — открытая рана головы

S01.0 — открытая рана волосистой части головы

S01.1 — открытая рана века и окологлазничной области

S01.2 — открытая рана носа

S01.3 — открытая рана уха

S01.4 — открытая рана щеки и височно-нижнечелюстной области

S01.5 — открытая рана зубы и полости рта

S02.0 — перелом свода черепа

S02.1 — перелом основания черепа

S02.2 — перелом костей носа

S02.3 — перелом дна глазницы

S02.40 — перелом альвеолярного отростка верхней челюсти

S02. 41 — перелом скуловой кости (дуги)

S02.42 — перелом верхней челюсти

S02.47 — множественные переломы скуловой кости и верхней челюсти

S02.5 — перелом зуба

S02.50 — перлом только эмали зуба (откол эмали)

S02.51 — перелом коронки зуба без повреждения пульпы

S02.52 — перелом коронки зуба без повреждения пульпы

S02.53 — перелом корня зуба

S02.54 — перелом коронки и корня зуба

S02.57 — множественные переломы зубов

S02.59 — перелом зуба неуточненный

S02.6 — перелом нижней челюсти

S02.60 — перелом альвеолярного отростка

S02.61 — перелом тела нижней челюсти

S02.62 — перелом мыщелкового отростка

S02 63 — перелом венечного отростка

S02.64 — перелом ветви

S02.65 — перелом симфиза

S02.66 — перелом угла

S02.67 — множественные переломы нижней челюсти

S02.69 — перелом нижней челюсти неуточненной локализации

S02.7 — множественные переломы костей черепа и лицевых костей

S02. 9 — перелом неуточненной части костей черепа и лицевых костей

S03 — вывих, растяжение и перенапряжение суставов с связок головы

S03.0 — вывих челюсти

S03.1 — вывих хрящевой перегородки носа

S03.2 — вывих зуба

S03.20 — люксация зуба

S03.21 — интрузия или экструзия зуба

S03.22 — вывих зуба (экзартикуляция)

S03.4 — растяжение и перенапряжение сустава (связок ) челюсти

S04 — травма черепных нервов

S04.3 — травма тройничного нерва

S04.5 — травма лицевого нерва

S04.8 — травма других черепных нервов

S04.9 — травма черепного нерва неуточненного

S07.0 — размозжение лица

S09.1 — травма мышц и сухожилий головы

S10 — поверхностная травма шеи

S11 — открытая травма шеи

Т18.0 — инородное тело во рту

Т20 — термические  и химические  ожоги головы и шеи

Т28.0 — термический ожог рта  и глотки

Т28.5 — химический ожог рта и глотки

Т33 — поверхностное отморожение

Т41 — отравление анестезирующими средствами

Т49. 7 — отравление стоматологическими препаратами, применяемые  местно

Т51 — токсическое действие алкоголя

Т57.0 — токсическое действие  мышьяка  и его соединений

Т78.3 — ангионевротический отек (гигантская крапивница, отек Квинке)

Т78.4 — аллергия  неуточненная

Т88 — шок вызванный  анестезией

Т81.0 — кровотечение и гематома, осложняющие процедуру, неквалифицированную

Т81.2 — случайный  прокол или  разрыв при  выполнении процедуры (случайная перфорация)

Т81.3 — расхождение краев  операционной раны,

Т81.4 – инфекция, связанная  с процедурой, не классифицированная в других рубриках

Т81.8 — процедуры эмфизема (подкожная) вследствие  процедуры

Т84.7 — инфекция и воспалительная реакция обусловленные внутренними ортопедическими протезными устройствами, имплантатами трансплантатами

Y60 — случайный порез, укол.перфорация или кровотечение при выполнении хирургической и терапевтической процедур

Y60. 0 — при проведении хирургической операции

Y61 — случайное оставление инородного тела в организме при выполнении хирургической и терапевтической процедур

Y61.0 — при проведении хирургической операции

 

Оценка гигиенического состояния полости рта при стоматите зубных рядов с помощью цитологического метода Текст научной статьи по специальности «Клиническая медицина»

Таким образом, через 2 года наблюдения 3 больных имели легкую интермиттирующую форму, 2 — легкую персистирующую, 4 — средней тяжести персисти-рующую, 2 — тяжелую форму астмы.

Двухлетнее динамическое диспансерное наблюдение пациентов с астмой позволило обосновать следующую комплексную оценку эффективности ан-тирефлюксного лечения: хороший результат зафиксирован у 6, удовлетворительный — у 5 пациентов с астмой. Неудовлетворительных результатов не отмечено.

Обобщая представленные результаты, можно заключить, что оперативное антирефлюксное лечение у исследованных пациентов оказало выраженное положительное воздействие на течение астмы, которое заключается в уменьшении количества дневных и ночных приступов, снижении потребности в проти-воастматических медикаментах, улучшении функциональных показателей дыхания и уровня контроля над данным заболеванием.

ЛИТЕРАТУРА

1. Богданов Д. Ю., Матвеев Н. Л., Мацак В. А. Исследование эффективности лапароскопических фундопликаций при хирургическом лечении ГЭРБ // Эндоскопич. хирургия. — 2008. — Т. 14. № 3. — С. 27-34.

2. Бурков С. Г., Арутюнов Т. А. Бронхолегочная и орофарин-геальная патология и ГЭРБ // Клинич. перспективы гастроэнтерологии, гепатологии. — 2007. — № 1. — С. 35-41.

3. Иванова О. В., Исаков В. А., Морозов С. В., Федулов Д. С., Цодикова О. М. Внепищеводные проявления гастроэзофагеаль-ной рефлюксной болезни // Русский медицинский журнал. Бол. органов пищевар. — 2004. — № 2. — С. 15-21.

4. Ивашкин В. Т., Шептулин А. А. Диагностика и лечение гас-троэзофагеальной рефлюксной болезни: Пособие для врачей. -М., 2005. — 30 с.

5. Луцевич О. Э., Галлямов Э. А., Преснов К. С., ГвоздикВ. В., Макушин А. А. Выбор способа эндохирургических антирефлюк-сных вмешательств при гастроэзофагеальной рефлюксной болезни // Альманах Института хирургии им. А. В. Вишневского. -2012. — Т. 7. № 1. — С. 117-118.

6. Маев И. В., Юренев Г. Л., Бурков С. Г. Внепищеводные проявления ГЭРБ // Терапевт. архив. — 2007. — Т. 79. № 3. — С. 57-66.

7. Палеев Н. Р., Исаков В. А. и соавт. ГЭРБ и патология органов дыхания: доказательства взаимосвязи и нерешенные проблемы // Вестн. Рос. академии мед. наук. — 2005. — № 6. -С. 3-7.

8. Пучков К. В., Филимонов В. Б. Грыжи пищеводного отверстия диафрагмы. — М.: «Медпрактика-М», 2003. — 171 с.

9. Рощина Т. В. Супраэзофагеальные проявления ГЭРБ // Клинич. перспективы гастроэнтерологии, гепатологии. — 2003. -№ 1. — С. 27-30.

10. Циммерман Я. С., Вологжанина Л. Г. Гастроэзофагеаль-ная рефлюксная болезнь: патогенез, клиника, диагностика и лечение // Клиническая медицина. — 2005. — № 9. — С. 16-24.

11. Черноусов А. Ф, Шестаков A. Л., Тамазян Г. С. Рефлюкс-эзофагит. — М.: ИЗДАТ, 1999.

12. Fass R., Achem S. R., Harding S., Mittal R. K. Review article: supra-oesophageal manifestations of gastro-oesophageal reflux disease and the role of night-time gastro-oesophageal reflux // Aliment pharmacol ther. — 2004. — № 20 (suppl. 9). — Р. 26-38.

13. Gislason T., Janson C., Vermeire P. Respiratory symptoms and nocturnal gastroesophageal reflux: a population-based study of young adults in three European countries // Chest. — 2002. -№ 121 (1). — Р. 158-163. doi:10. 1378/chest. 121.1.158.

14. Malagelada J. R. Review article: supraoesophageal manifestations of gastroesophageal reflux disease // Aliment. pharmacol. ther. — 2004. — Vol. 19, suppl. 1 — P. 43-48.

15. Parsons J. P., Mastronade J. G. Gastroesophageal reflux disease and asthma // Cur. opin. pulm. med. — 2010. — № 16. — Р. 60-63.

Поступила 27.01.2014

Э. А. ДЯГТЯРЬ1, А. Г. СИРАК2, И. М. БЫКОВ1, Л. В. АКОПОВА1

оценка гигиенического состояния полости рта при стоматите зубных рядов с помощью цитологического метода

Кафедра фундаментальной и клинической биохимии ГБОУ ВПО КубГМУ Минздрава России,

Россия, 355063, г. Краснодар, ул. Седина, 4;

2кафедра стоматологии ГБОУ ВПО СтГМУ Минздрава России, Россия, 355017, г. Ставрополь, ул. Мира, 310; тел. (8652) 350551. E-mail: [email protected]

Исследование посвящено изучению роли нарушений в гигиене полости рта и плохом уходе за зубными протезами в формировании патологического процесса в области протезного ложа. Всего обследовано 178 пациентов, постоянно пользующихся съемными зубными протезами, которым был поставлен диагноз «стоматит зубного ряда». С помощью цитологического метода установлено, что при клинических признаках стоматита зубных рядов в цитограммах отпечатков отмечались нарастание дистрофических изменений клеток плоского эпителия, пласты полуразрушенных лимфоидных элементов, резко возрастает число сегментоядерных нейтрофилов и мононуклеаров до 60-70 в поле зрения. Наличие в цитограммах клеток плоского эпителия, контаминированных микроорганизмами, служит диагностическим признаком плохой гигиены полости рта и указывает на высокий риск развития воспалительных процессов в зоне протезного ложа. Установлено, что цитологический метод позволяет достаточно точно оценить гигиеническое состояние полости рта в области протезного ложа, что имеет важное диагностическое значение для определения тактики проведения лечебно-профилактических мероприятий при стоматите зубных рядов.

Ключевые слова: стоматит зубных рядов, гигиена полости рта, цитологический метод.

E. A. DEAGTAR1, A. G. SIRAK2, I. M. BYKOV, L. V. AKOPOVA1

DETERMiNATiON OF THE LEVEL OF ORAL HYGiENE AT STOMATiTiS DENTiTiON CYTOLOGiCAL

Department of fundamental and clinical biochemistry Kuban state medical university, Russian ministry of health,

Russia, 355063, Krasnodar, Sedina str., 4;

2department of dentistry Stavropol state medical university Ministry of health of Russia, Russia, 355017, Stavropol, World str., 310; tel. (8652) 350551. E-mail: [email protected]

Study investigates the role of violations in oral hygiene and poor care of dentures in the formation of pathological process in the field of prosthetic bed. Just examined 178 patients using of removable dentures, who were diagnosed with «stomatitis dentition». Cytological found that when clinical signs stomatitis dentitions in cytograms of prints noted growth of dystrophic changes in the cells of the squamous epithelium, marked layers of dilapidated lymphoid elements, sharply increasing number of segmentonuclear neutrophils and mononuclei to 60-70 in the field of view. The presence in cytograms of cells epithelium, contaminated with microorganisms is a diagnostic sign of poor oral hygiene and indicates of inflammatory processes in the area of prosthetic bed. it is established that cytological method allows to adequately assess the state of hygiene of the oral cavity in the field of prosthetic bed, which is of great diagnostic value for defining the tactics of treatment-and-prophylactic measures at stomatitis dentition.

Key words: stomatitis dentition, oral hygiene, cytological method.

Введение

Стоматит зубного ряда (К12.1 по МКБ-10) относится к группе наиболее часто встречающихся патологий слизистой оболочки полости рта воспалительного характера, обусловленной наличием у пациента зубного протеза. Большое значение в возникновении стоматита зубного ряда (СЗР) имеют состояние здоровья пациента, уровень гигиены полости рта, соблюдение правил ухода за зубными протезами (ЗП).

Характер течения патологического процесса СЗР у больных, пользующихся съемными протезами, — острый или хронический (ремиссия, обострение), форма клинических проявлений может изменяться от эрозив-но-язвенной до язвенно-некротической и гиперпластической (А. К. Иорданишвили, 1988, 2005, 2013). Основные причины возникновения СЗР обусловлены в большей степени местными факторами, исходящими непосредственно от базиса съемного протеза и материала, из которого он изготовлен. Это механические, термические, токсико-аллергические раздражители слизистой оболочки полости рта, проявляющие свое воздействие на фоне нарушений микробиоценоза и иммунологической резистентности ротовой полости, что в совокупности и определяет патогенетический механизм развития данной патологии [1, 3, 5]. Во многом реакция слизистой оболочки на съемный зубной протез зависит от индивидуальных свойств протезного ложа [11, 16].

Ряд исследователей отмечают наиболее важную роль в формировании патологического процесса в области протезного ложа нарушений в гигиене полости рта и плохого ухода за зубными протезами [9, 13, 15].

Основными клиническими проявлениями СЗР являются катаральное воспаление, эрозии или изъязвления, пролежни и, как следствие, прогрессирующие расстройства гемоциркуляции и трофические нарушения в слизистой оболочке протезного ложа и прилежащих участках полости рта [3, 11]. На биохимическом уровне в тканях полости рта наблюдаются усиление свободно-радикального окисления липидов [2, 6], изменение активности ферментов ротовой жидкости [3, 12]. Хроническое воспаление и деструктивные изме-

нения в тканях протезного ложа оказывают неблагоприятное воздействие на весь организм в целом [4, 8], низкий уровень гигиены полости рта приводит к активизации патогенной микрофлоры полости рта и усилению ее патологического воздействия на степень тяжести и течение воспалительного процесса тканей протезного ложа [7, 11, 14]. Данный этиопатологи-ческий комплекс приводит к серьезным нарушениям процесса адаптации к съемным зубным протезам, их неудовлетворительной фиксации и стабилизации и, как правило, полному отказу пациента от съемного протеза.

Поиск новых способов и средств профилактики и лечения СЗР, повышающих уровень гигиены полости рта и способствующих скорейшей адаптации протезного ложа пациента к съемному протезу, безусловно, является своевременным и необходимым научным исследованием.

Все вышеизложенное определяет целесообразность и актуальность исследования, направленного на поиск и разработку новых способов определения уровня гигиены протезного ложа при стоматите зубных рядов для профилактики и лечения данного заболевания.

Цель исследования — оценить возможность определения уровня гигиены протезного ложа при стоматите зубных рядов с использованием цитологического метода для повышения эффективности лечебно-профилактических мероприятий.

Материалы и методы исследования

В исследовании приняло участие 178 пациентов, постоянно пользующихся съемными зубными протезами, которым был поставлен диагноз «стоматит зубного ряда». В зависимости от уровня гигиены полости рта все больные были разделены на 4 группы: 1 контрольную и 3 основные. Контрольную группу составили пациенты, срок функционирования ортопедических конструкций у которых составлял от 1 до 3 месяцев, 1-ю, 2-ю и 3-ю группы — пациенты со сроком функционирования ортопедических конструкций до 1 года, от 1 до 3 лет и свыше 3 лет соответственно. При первичном клиническом обследовании, после опроса больного, сбора анамнеза,

объективного обследования мягких и твердых тканей полости рта (ПР) и протезного ложа (ПЛ), рентгенологического исследования проводили забор клинического материала (отпечатков с десны в области ПЛ). Подсчет клеточных элементов проводили под микроскопом при увеличении х1000 (иммерсия) с помощью окуляров х100 и объектива х10.

Забор цитологического материала проводили с помощью мишени — клиновидного фрагмента резинки-ластика с размером в узкой части не более 1 мм. Мишени хранились в чашках Петри, залитых 50%-ным раствором этилового спирта. Перед изготовлением отпечатков мишень высушивали струей из воздушного пистолета, затем легким прижатием к исследуемому участку забирали цитологический материал и переносили его в виде отпечатков на обезжиренное предметное стекло. На предметное стекло наносили следующую информацию: Ф.И.О. пациента; зубную формулу; разметку на квадранты, промаркированные в соответствии с областью забора материала. При взятии материала одна сторона мишени прикладывалась к поверхности протезного ложа, а другая — к поверхности протеза. Пациентам было рекомендовано чистить зубы не менее чем за 3-4 часа до назначенного исследования. Отпечатки брали с язычной поверхности из области прилегания слизистой оболочки к протезу. Стекло высушивали на воздухе, фиксировали и окрашивали по методике Романовского-Гимзы.

Для оценки состояния гигиены полости рта использовался цитологический показатель гигиены (А. С. Григорьян с соавт., 2004), модифицированный нами для оценки наличия и количественной характеристики зубного налета в цитограммах при микроскопическом исследовании отпечатков с протезного ложа. Наличие зубного налета и микроорганизмов в одном поле расценивалось как 1 балл, отсутствие -0 баллов. Сам индекс определялся как частное от деления суммы баллов на количество обследованных. Значения цитологического показателя гигиены протезного ложа (ЦПГПЛ) от 0 до 1 свидетельствовали о хорошей гигиене, от 1 до 2 — удовлетворительной и свыше 2 — неудовлетворительной.

Подсчет клеточных элементов проводили при увеличении х1000, иммерсия. Цитологическое исследование отпечатков с области протезного ложа и зубных протезов проводили через 1, 2 и 3 месяца. На каждом этапе определяли цитологический показатель гигиены протезного ложа.

Определение у пациентов уровня гигиены проводили с помощью упрощенного индекса зубного налета Approximal Plaque-Index (API) (D. E. Lange, H. Chr. Plagmann et al., 1977) и индекса зубного налёта (PI) по Турески (S. Turesky, 1970). Статистическая значимость полученных результатов (p) вычислялась с использованием критерия Стьюдента (t) и его интерпретация -на основании стандартной таблицы критических зна-

Таблица 1

Динамика количества сегментоядерных нейтрофилов в зоне ПЛ в разные сроки функционирования ортопедических конструкций (M±m)

Группы исследования Сроки наблюдения

Исходные значения Через 1 месяц Через 2 месяца Через 3 месяца

15,93±1,63 15,03±1,69 12,37±1,69

Дх±0,66 Дх±1,14 Дх±2,49

Контрольная 17,27±2б87 t =0,41 t =0,67 t =1,47

p1>0,05 p2>0,05 p3>0,05

2,93±0,13 2,73±0,09 2,13±0,08

Дх±0,2 Дх±0,22 Дх±0,39

1-я группа 3,33±0,23

t =1,51 t =2,43 t = 4,93

p1>0,05 p2<0,05 p3<0,001

12,03±0,74 10,89±0,55 7,1±0,41

Дх±0,42 Дх±0,97 Дх±2,42

2-я группа 12,67±0,85

t =0,57 t =1,76 t = 5,90

p1>0,05 p2>0,05 p3<0,001

3-я группа 34,43±2,32 32,02±2,27 Дх±1,69 t =0,74 p1>0,05 26,51±1,52 Дх±4,34 t =2,86 p2<0,01 21,69±1,38 Дх±6,51 t = 4,72 p3<0,001

Примечание: t — критерий Стьюдента при сравнении с исходными значениями; р1 — показатель вероятности ошибки при сравнении с показателями через 1 месяц; р2 — показатель вероятности ошибки при сравнении с показателями через 2 месяца; р3 — показатель вероятности ошибки при сравнении с показателями через 3 месяца; Ах — доверительный интервал.

чений коэффициента Стьюдента. Для определения силы и направления корреляционной связи применяли метод ранговой корреляции Спирмена. Достоверными считались различия между группами при p<0,05. Обработку полученных данных проводили на персональном компьютере «Pentium 4» с программным обеспечением «Microsoft».

Результаты исследования

Исходные значения ЦПГПЛ контрольной группы составили 2,56±0,07, что соответствовало показателю неудовлетворительной гигиены полости рта. Исходные значения ЦПГПЛ в 1-й группе (срок функционирования ортопедических конструкций до 12 месяцев) указали на удовлетворительную гигиену полости рта, значение составило 1,88±0,04 балла, неудовлетвори-

тельная гигиена полости рта во 2-й группе (срок функционирования ортопедических конструкций 1-3 года) и 3-й группе (срок функционирования ортопедических конструкций более 3-5 лет) составила в среднем 2,36±0,04 и 3,05±0,04 балла соответственно. Критерии уровня гигиены полости рта по значениям ЦПГПЛ совпадали с критериями уровня гигиены по значениям гигиенических индексов.

В ходе цитологического исследования был произведен подсчет сегментоядерных нейтрофилов. При первичном исследовании в контрольной группе среднее число лейкоцитов в поле зрения было 17,27±2,78, в 1-й группе среднее число лейкоцитов было в диапазоне от 2,8±0,14 до 4,13±0,29, во 2-й группе — от 11,33±1,14 до 12,80±1,12, в 3-й группе — от 30,83±4,84 до 34,43±2,3 (табл. 1).

Таблица 2

Матрица корреляции показателей гигиенических индексов и среднего количества лейкоцитов в цитограммах отпечатков протезного ложа

Группы Изучаемые показатели Коэффициент ранговой корреляции Спирмена, rs

Среднее количество лейкоцитов

Контрольная группа API 0,764; p<0,01

PI 0,866; p<0,01

1-я группа api 0,83; p<0,01

pi 0,815; p<0,01

2-я группа API 0,962; p<0,01

PI 0,938; p<0,01

3-я группа API 0,899; p<0,01

PI 0,914; p<0,01

Рис. 1. Цитограмма. Протезное ложе без клинических признаков воспаления. Клетка поверхностного слоя многослойного плоского неорогове-вающего эпителия, ороговевшие клетки, незначительное количество сегментоядерных нейтрофилов. Окраска по Романовскому-Гимзе. Иммерсия. Увеличение х400

Рис. 2. Цитограмма. Протезное ложе с клиническими признаками воспаления. Незавершенный фагоцитоз с большим количеством сегментоядерных нейтрофилов. Окраска по Романовскому-Гимзе. Иммерсия. Увеличение х400

Рис. 3. Цитограмма. Протезное ложе с клиническими признаками воспаления. Entamoeba gingivalis, контаминирование цитоплазмы эпителиальной клетки микроорганизмами. Окраска по Романовскому-Гимзе. Иммерсия. Увеличение х400

Для выявления взаимосвязи между гигиеническим состоянием ортопедических конструкций и количеством лейкоцитов был проведен корреляционный анализ, результаты которого приведены в таблице 2.

Сильная положительная корреляция наблюдалась между показателями гигиенических индексов и количеством лейкоцитов во всех исследуемых группах, из чего следует, что количество лейкоцитов четко взаимосвязано с гигиеническим состоянием ПЛ и всей полости рта.

Анализ цитологического исследования выявил, что в норме основными клетками цитограмм отпечатков с ПЛ являются: базальные клетки, плоскоэпителиальные клетки поверхностных слоев многослойного плоского

неороговевающего эпителия, плоскоэпителиальные клетки глубоких слоев эпителия слизистой оболочки полости рта, ядросодержащие клетки поверхностного слоя эпителия, чешуйки (ороговевшие клетки, лишенные ядра). Также в норме присутствуют в небольшом количестве сегментоядерные нейтрофилы и моноциты. При хорошей гигиене полости рта и ЗП отмечаются от 0 до 5 сегментоядерных нейтрофилов в поле зрения, одиночные лимфоциты, незначительное количество смешанной флоры.

При удовлетворительной гигиене полости рта в ци-тограммах отпечатков отмечаются присутствие зубного налета и микробное контаминирование цитоплазмы эпителиальных клеток в виде мельчайших базофиль-

Рис. 4. Цитограмма. Протезное ложе с клиническими признаками стоматита (эрозивно-язвенные поражения слизистой оболочки). Эпителиальная клетка, пласт полуразрушенных лимфоидных элементов. Окраска по Романовскому-Гимзе. Иммерсия. Увеличение х400

Рис. 5. Цитограмма. Протезное ложе с клиническими признаками стоматита (эрозивно-язвенные поражения слизистой оболочки). В зоне видимости — мононуклеары, entamoeba gingivalis, сегментоядерные нейтрофилы, элементы гриба Candida. Окраска по Романовскому-Гимзе. Иммерсия. Увеличение х400

ных частиц. Нарастает количество сегментоядерных нейтрофилов и моноцитов (рис. 1). В цитограммах отмечается от 5 до 15 сегментоядерных нейтрофилов в поле зрения. При неудовлетворительной гигиене полости рта в цитограммах отпечатков появляются фа-гирующие клетки (сегментоядерные нейтрофилы или моноциты) (рис. 2).

В большом количестве появляются элементы гриба Candida, клубни лучистых грибов Actinomycetales — образуют мицелий — нитевидные переплетающиеся клетки, Leptotrichia buccalis — прямые или слегка изогнутые грамотрицательные палочки, облигатные неспорооб-разующие анаэробы, Entamoeba gingivalis (рис. 3, 4).

В цитограммах насчитывают от 15 до 40 сегментоядерных нейтрофилов.

При клинических признаках стоматита зубных рядов в цитограммах отпечатков отмечались нарастание дистрофических изменений клеток плоского эпителия, пласты полуразрушенных лимфоидных элементов (рис. 5). Резко возрастает число сегментоядерных нейтрофилов до 60-70 в поле зрения, мононуклеаров. Наличие в цитограммах клеток плоского эпителия, конта-минированных микроорганизмами, служит признаком плохой гигиены полости рта и указывает на высокий риск развития воспалительных процессов в зоне протезного ложа.

Анализ цитограмм отпечатков показал, что между выраженностью воспалительного процесса в зоне протезного ложа и увеличением численности сегментоядерных нейтрофилов, мононуклеаров, контаминированием клеток микроорганизмами, наличием в цитологических препаратах зубного налета, бактериальных скоплений в отпечатках имеется четкая связь: нарастание числа указанных клеток отражает степень воспалительного процесса в области ПЛ.

Таким образом, цитологический метод позволяет достаточно точно оценить гигиеническое состояние полости рта в области протезного ложа, в этой связи состав клеточных элементов протезного ложа имеет важное диагностическое значение для определения тактики проведения лечебно-профилактических мероприятий при стоматите зубных рядов.

ЛИТЕРАТУРА

1. Быков И. М., Сирак А. Г., Сирак С. В. Апробация нового зубного эликсира для профилактики кариеса зубов в условиях эксперимента // Современные проблемы науки и образования. -2013. — № 4 [электронный ресурс] URL: www.science-education. ru/110-9799.

2. Григорьянц Л. А., Сирак С. В. Лечение травм нижнеальвеолярного нерва, вызванных выведением пломбировочного материала в нижнечелюстной канал // Клиническая стоматология. -2006. — № 1. — С. 52-57.

3. Сторожук П. Г., Быков И. М., Еричев В. В. Ротовая полость и её секреты как система антибактериальной и антирадикальной защиты организма // Аллергология и иммунология. — 2009. — Т. 10. № 3. — С. 350-357.

4. Кочконян Т. С., Гаспарян А. Ф, Быков И. М. Процессы пе-рекисного окисления липидов и антиоксидантная система ротовой жидкости при несъемном протезировании // Кубанский научный медицинский вестник. — 2008. — № 3-4. — С. 37-39.

5. Коробкеев А. А., Сирак С. В., Копылова И. А. Изучение особенностей анатомо-топографического строения нижней челюсти для планирования эндодонтического и имплантологического лечения // Медицинский вестник Северного Кавказа. — 2010. — Т. 17. № 1. — С. 17-22.

6. Рубцова Н. Г., Сирак С. В., Сирак А. Г. Индивидуальная гигиена полости рта и микроскопическая оценка структуры щетинок зубных щеток при их ежедневном использовании // Эндодонтия Today. — 2013. — № 3. — С. 68-72.

7. Сирак С. В., Шаповалова И. А., Пугина Ю. Н., Лолае-ва А. К., Афанасьева О. В., Локтоинова М. В. Особенности выбора антимикробных препаратов для местного лечения воспалительных заболеваний пародонта у детей и подростков //

Стоматология детского возраста и профилактика. — 2008. -Т. 7. № 4. — С. 61-63.

8. Сирак С. В., Зекерьяева М. В. Изучение противовоспалительных и регенераторных свойств стоматологического геля на основе растительных компонентов, глюкозамина гидрохлорида и димексида в эксперименте // Пародонтология. — 2010. -№ 1. — С. 46-50.

9. Сирак С. В., Копылова И. А. Использование результатов анкетирования врачей-стоматологов для профилактики осложнений, возникающих на этапах эндодонтического лечения зубов // Эндодонтия Today. — 2010. № 1. — С. 47-51.

10. Сирак А. Г., Сирак С. В. Профилактика кариеса зубов и воспалительных заболеваний пародонта с использованием зубных эликсиров // Современные проблемы науки и образования. -2013. — №4 [электронный ресурс] URL: www.science-education. ru/110-9655

11. Сирак А. Г., Сирак С. В. Морфофункциональные изменения в пульпе зубов экспериментальных животных при лечении глубокого кариеса и острого очагового пульпита с использованием разработанных лекарственных композиций // Современные проблемы науки и образования. — 2013. — № 2 [электронный ресурс] URL: www.science-education.ru/108-8715

12. Сирак А. Г., Григорьян А. А., Сирак С. В. Разработка и клиническое применение нового ранозаживляющего средства для лечения заболеваний слизистой оболочки полости рта у детей и подростков // Современные проблемы науки и образования. — 2013. — № 2 [электронный ресурс] URL: www.science-education.ru/108-8700

13. Сирак С. В., Быков И. М., Сирак А. Г., Акопова Л. В. Профилактика кариеса и воспалительных заболеваний пародонта с использованием зубных эликсиров // Кубанский научный медицинский вестник. — 2013. — № 4. — С. 166-168.

14. Сирак А. Г., Сирак С. В., Быков И. М. Динамика биохимических показателей ротовой жидкости у детей и подростков при использовании разработанного зубного эликсира // Стоматология детского возраста и профилактика. — 2013. — Т. 24. № 4. — С. 62-66.

15. Пат. 2356530. Российская Федерация, МПК3 A 61 К 8/18, A 61 K 8/97, А 61 Р 1/02. Средство для полоскания полости рта при протезном стоматите и пародонтите / С. В. Сирак, А. Г. Сирак; заявитель и патентообладатель, Ставрополь, С. В. Сирак, ООО НПО «Фитодент». — № 2008101478/15; заявл. 11.01.2008; опубл. 20.05.2009; бюл. № 15. — С. 6.

16. Пат. 2364389. Российская Федерация, МПК2 A 61 К 8/97, A 61 Q 11/00. Средство для полоскания полости рта / С. В. Сирак, А. Г. Сирак; заявитель и патентообладатель, Ставрополь, С. В. Сирак, ООО НПО «Сфера». — № 2008108767/15; заявл. 11.03.2008; опубл. 20.08.2009; бюл. № 23. — С. 7.

Поступила 03.03.2014

K12 Стоматит и родственные поражения

K12 Стоматит и родственные поражения — МКБ-10

Препараты (51)

  • Абисил

    Латинское название: Abisyl

    Действующие вещества: Пихты сибирской терпены

    Фармакологические действия: Антибактериальное местное, Противовоспалительное, Противовоспалительное местное, Ранозаживляющее

    МКБ-10: J31.0 Хронический ринит, A46 Рожа, H60.9 Наружный отит неуточненный, J31.2 Хронический фарингит, J32 Хронический синусит, J35 Хронические болезни миндалин и аденоидов, J37 Хронический ларингит и ларинготрахеит, K05 Гингивит и болезни пародонта, K05.4 Пародонтоз, K10.3 Альвеолит челюстей, K12 Стоматит и родственные поражения, K12.2 Флегмона и абсцесс полости рта, L02 Абсцесс кожи, фурункул и карбункул, H66.9 Средний отит неуточненный, L08.0 Пиодермия, L89 Декубитальная язва, T14.1 Открытая рана неуточненной области тела, T30 Термические и химические ожоги неуточненной локализации, T35 Обморожение, захватывающие несколько областей тела и неуточненное обморожение, T79.3 Посттравматическая раневая инфекция, не классифицированная в других рубриках, T88.9 Осложнение хирургического и терапевтического вмешательства неуточненное, Z97.2 Наличие зубного протезного устройства (полного) (частичного), H68 Воспаление и закупорка слуховой [евстахиевой] трубы, J00 Острый назофарингит [насморк], J01 Острый синусит, J02.9 Острый фарингит неуточненный, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J04 Острый ларингит и трахеит

  • АквазанЖНВЛП

    Латинское название: Aquasan

    Действующие вещества: Povidone-iod

    МКБ-10: T14.1 Открытая рана неуточненной области тела, B36.9 Поверхностный микоз неуточненный, J02 Острый фарингит, T30 Термические и химические ожоги неуточненной локализации, T79.3 Посттравматическая раневая инфекция, не классифицированная в других рубриках, W57 Укус или ужаливание неядовитым насекомым и другими неядовитыми членистоногими, Z34 Наблюдение за течением нормальной беременности, Z40 Профилактическое хирургическое вмешательство, Z41.8 Другие процедуры, не имеющие лечебных целей, K05.2 Острый пародонтит, K12 Стоматит и родственные поражения, L08.0 Пиодермия, L30.3 Инфекционный дерматит, L70 Угри, L89 Декубитальная язва, N73.9 Воспалительные болезни женских тазовых органов неуточненные

  • Ампровизоль®

    Латинское название: Amprovisolum

    Фармакологические действия: Антисептическое, Обезболивающее, Противовоспалительное местное, Ранозаживляющее

    МКБ-10: A69.0 Некротизирующий язвенный стоматит, B00.2 Герпетический гингивостоматит и фаринготонзиллит, B37.0 Кандидозный стоматит, K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения, L30.9 Дерматит неуточненный, L55 Солнечный ожог, T30 Термические и химические ожоги неуточненной локализации

  • Анти-Ангин® Формула

    Латинское название: Anti-Angin Formula

    Действующие вещества: Тетракаин* + Хлоргексидин*, Тетракаин* + Хлоргексидин* + Аскорбиновая кислота*

    Фармакологические действия: Антибактериальное, Обезболивающее местное, Противогрибковое

    МКБ-10: Z54.0 Период выздоровления после хирургического вмешательства, J02 Острый фарингит, J03 Острый тонзиллит [ангина], J06 Острые инфекции верхних дыхательных путей множественной и неуточненной локализации, J31.2 Хронический фарингит, J35.0 Хронический тонзиллит, K05 Гингивит и болезни пародонта, K05.4 Пародонтоз, K12 Стоматит и родственные поражения

  • Бадана корневища брикет круглый

    Латинское название: Bergeniae rhizomatis briket rotundum

    Действующие вещества: Бадана корневища

    Фармакологические действия: Антибактериальное, Вяжущее, Гемостатическое

    МКБ-10: K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения, K52 Другие неинфекционные гастроэнтериты и колиты, N86 Эрозия и эктропион шейки матки

  • Биорал

    Латинское название: Bioral

    Действующие вещества: Карбеноксолон*

    Фармакологические действия: Противовоспалительное

    МКБ-10: K12 Стоматит и родственные поражения

  • Вокара®

    Латинское название: Vocara®

    МКБ-10: K12 Стоматит и родственные поражения, I88 Неспецифический лимфаденит, J02.9 Острый фарингит неуточненный, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J31.2 Хронический фарингит, J35.0 Хронический тонзиллит, K05.0 Острый гингивит, K05.1 Хронический гингивит

  • Гексадрепс

    Латинское название: Hexadreps ®

    Действующие вещества: Биклотимол*

    Фармакологические действия: Антисептическое

    МКБ-10: J02.9 Острый фарингит неуточненный, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J04 Острый ларингит и трахеит, J35 Хронические болезни миндалин и аденоидов, K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения

  • Гексализ

    Латинское название: Hexalyse ®

    Фармакологические действия: Анальгезирующее, Антисептическое, Противовоспалительное

    МКБ-10: J02.9 Острый фарингит неуточненный, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J04 Острый ларингит и трахеит, J35 Хронические болезни миндалин и аденоидов, K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения

  • Граммидин® с анестетиком нео

    Латинское название: Grammidin® with anaesthetic neo

    Действующие вещества: Грамицидин C* + Оксибупрокаин* + Цетилпиридиния хлорид

    Фармакологические действия: Антисептическое, Местноанестезирующее, Противомикробное

    МКБ-10: K12 Стоматит и родственные поражения, J02.9 Острый фарингит неуточненный, J03 Острый тонзиллит [ангина], J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J31.2 Хронический фарингит, J35.0 Хронический тонзиллит, K05 Гингивит и болезни пародонта, K05.4 Пародонтоз

  • Дезоксинат®

    Латинское название: Desoxynatum®

    Действующие вещества: Sodium deoxyribonucleate

    Фармакологические действия: Иммуностимулирующее, Лейкопоэтическое, Противовоспалительное, Ранозаживляющее, Регенерирующее

    МКБ-10: L58 Радиационный дерматит лучевой, A69.0 Некротизирующий язвенный стоматит, J02.9 Острый фарингит неуточненный, N76 Другие воспалительные болезни влагалища и вульвы, T30 Термические и химические ожоги неуточненной локализации, T66 Неуточненные эффекты излучения, T86 Отмирание и отторжение пересаженных органов и тканей, Z51.0 Курс радиотерапии, Z51.1 Химиотерапия по поводу новообразования, Z54 Период выздоровления, Z58.4 Воздействие радиационного загрязнения, Z94.5 Наличие трансплантированной кожи, J31 Хронический ринит, назофарингит и фарингит, K05.0 Острый гингивит, K12 Стоматит и родственные поражения, K13.7 Другие и неуточненные поражения слизистой оболочки полости рта, K20 Эзофагит, K51.0 Язвенный (хронический) энтероколит, K51.2 Язвенный (хронический) проктит

  • Доктор Тайсс Анги Септ

    Латинское название: Dr.Theiss Angi Sept

    Фармакологические действия: Антисептическое, Местнораздражающее, Противовоспалительное

    МКБ-10: J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J06 Острые инфекции верхних дыхательных путей множественной и неуточненной локализации, J11 Грипп, вирус не идентифицирован, J18 Пневмония без уточнения возбудителя, J35 Хронические болезни миндалин и аденоидов, K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения, R07.0 Боль в горле

  • Доктор Тайсс Шалфей

    Латинское название: Dr. Theiss Sage

    Действующие вещества: Шалфея лекарственного листьев экстракт

    Фармакологические действия: Противовоспалительное

    МКБ-10: K14.0 Глоссит, J02.9 Острый фарингит неуточненный, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J04.0 Острый ларингит, J31.2 Хронический фарингит, J37.0 Хронический ларингит, K05 Гингивит и болезни пародонта, K10.3 Альвеолит челюстей, K12 Стоматит и родственные поражения

  • Доналгин

    Латинское название: Donalgin

    Действующие вещества: Нифлумовая кислота*

    Фармакологические действия: Анальгезирующее, Антиагрегационное, Жаропонижающее, Противовоспалительное

    МКБ-10: M71 Другие бурсопатии, H66 Гнойный и неуточненный средний отит, I80 Флебит и тромбофлебит, M77.0 Медиальный эпикондилит, M77.1 Латеральный эпикондилит, M77.9 Энтезопатия неуточненная, N70 Сальпингит и оофорит, N73.2 Параметрит и тазовый целлюлит неуточненные, R52.2 Другая постоянная боль, T14.9 Травма неуточненная, J32 Хронический синусит, J37 Хронический ларингит и ларинготрахеит, K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения, M06.9 Ревматоидный артрит неуточненный, M10 Подагра, M45 Анкилозирующий спондилит

  • Дрилл

    Латинское название: Drill

    Действующие вещества: Тетракаин* + Хлоргексидин* + Аскорбиновая кислота*

    Фармакологические действия: Антисептическое, Местноанестезирующее

    МКБ-10: J02.9 Острый фарингит неуточненный, K12 Стоматит и родственные поражения

  • Календулы настойка

    Латинское название: Calendulae tinctura

    Действующие вещества: Календулы лекарственной цветки

    Фармакологические действия: Антисептическое, Желчегонное, Противовоспалительное

    МКБ-10: T30 Термические и химические ожоги неуточненной локализации, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J06 Острые инфекции верхних дыхательных путей множественной и неуточненной локализации, K12 Стоматит и родственные поражения, K81 Холецистит, T14.1 Открытая рана неуточненной области тела

  • Календулы цветков брикет круглый

    Латинское название: Chamomillae flores briket rotundum

    Действующие вещества: Календулы лекарственной цветки

    Фармакологические действия: Антисептическое, Противовоспалительное

    МКБ-10: J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения

  • Лапчатки корневища

    Действующие вещества: Лапчатки прямостоячей корневища

    МКБ-10: J03 Острый тонзиллит [ангина], K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения, K52 Другие неинфекционные гастроэнтериты и колиты, K59.1 Функциональная диарея

  • Ларипронт

    Латинское название: Larypront ®

    Действующие вещества: Деквалиния хлорид* + Лизоцима гидрохлорид

    Фармакологические действия: Муколитическое, Противовирусное, Противовоспалительное, Противомикробное

    МКБ-10: J02.9 Острый фарингит неуточненный, J03.9 Острый тонзиллит неуточненный (ангина агранулоцитарная), J04 Острый ларингит и трахеит, K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения

  • Лингезин

    Фармакологические действия: Антибактериальное, Протеолитическое

    МКБ-10: K05 Гингивит и болезни пародонта, K12 Стоматит и родственные поражения

Поделитесь с друзьями:   

Комментарии

Запись к врачу

  • © 2014-2021, Preparatum.ru.
    Все права защищены.
  • При любом использовании материалов с сайта,
    ссылка на «Препаратум.RU» обязательна.

«Препаратум.RU» является информационным ресурсом. Информация, размещенная на сайте «Препаратум.RU», не является справочной информацией. Информация, предоставленная на страницах информационного ресурса «Препаратум.RU» предназначена только для специалистов. Использование информации о препаратах, действующих веществах, симптомах и болезнях, в равной степени как и другая инфрмация, размещенная на «Препаратум.RU», не может быть использована для принятия решения о приёме лекарственных средств. Любое применение препаратов возможно только по назначению лечащего врача. «Препаратум.RU» не несет ответственности за неправильное трактование информации посетителями сайта. «Препаратум.RU» не несет ответственности за какие-либо последствия использования информации со страниц ресурса, повлекшие за собой вред здоровью. «Препаратум.RU» не дает никаких рекомендаций по использованию препаратов или их совместимости.

Диета

стимулирует коллективные миграции и влияет на иммунитет мормонских сверчков и саранчи: сравнение этих потенциальных сверхраспространителей болезни | Интегративная и сравнительная биология

Аннотация

Дифференциальная передача болезни между отдельными лицами в популяции или между видами в сообществе может привести к появлению суперраспространителей, относительно редких людей, ответственных за большую часть случаев передачи. Мигрирующие мормонские сверчки и нимфальная саранча охотно подвергаются каннибалистическим нападениям и некрофагии.Обычно труп употребляют несколько человек, что способствует распространению болезни. Каннибалистические атаки приводят к согласованному, скоординированному перемещению людей в огромных группах, которые маршируют ежедневно в течение нескольких недель. Скоординированное движение снижает частоту контактов, что снижает не только каннибализм, но и риск передачи заболеваний. В тесноте мормонские сверчки и саранча повышают свой основной иммунитет, что еще больше снижает риск передачи болезней. Группы мормонских сверчков демонстрируют дефицит различных макроэлементов в рационе, который определяет, будут ли они более восприимчивы к патогенным бактериям или грибам.В некоторых мигрирующих странах мормонские сверчки ищут углеводы и обладают меньшей антибактериальной активностью. Белок-переносчик липидов, который функционирует как в качестве топлива для миграции, так и в антибактериальной активности, может вызывать компромисс между двумя видами активности, когда углеводы ограничены. В других мигрирующих регионах мормонские сверчки предпочитают белок углеводам, что указывает на дефицит белка. В этих полосах общий иммунитет мормонских сверчков, измеряемый по фенолоксидазе, нарушен, и насекомые более восприимчивы к грибковой инфекции Beauveria bassiana .У саранчовых диета с высоким содержанием белка привела к большей восприимчивости к другому энтомопатогенному грибку, Metarhizium acridum , тогда как у мормонских сверчков как титры фенолоксидазы, так и иммунитет к M . acridum увеличивается с возрастом. Изменение цвета, связанное со смертью любого из этих грибов, уменьшает каннибализм, но группы могут убивать инфицированных или слишком быстро сталкиваться с трупами, чтобы эффективно снизить передачу грибков. До тех пор, пока насекомые не проявляют признаков инфекции, которые отражают их сородичей, инфицированные мормонские сверчки и саранча в мигрирующих стаях могут быть лучшими распространителями болезней.Однако болезни, которые они, скорее всего, будут переносить и распространять, могут зависеть от диетического дефицита, проявляемого членами группы.

Введение

Перемещаясь группами, массовые мигрирующие популяции потенциально являются главными распространителями инфекции (Altizer et al. 2011; Bauer and Hoye 2014). Лица, которые вносят непропорциональный вклад в распространение болезни, называются «суперраспространителями», независимо от того, происходит ли передача инфекции между людьми внутри одного вида или между видами в сообществе (Paull et al.2012). Неоднородность передачи может приводить к редким событиям сверхраспространения, характеризующимся инфицированным хозяином, вызывающим большую долю вторичных инфекций (например, см. Fritzsche McKay and Hoye, 2016). Неоднородность окружающей среды также может приводить к очагам распространения патогенов и передачи болезней (Paull et al. 2012). Групповое поведение — это, по определению, взаимодействие индивидов в непосредственной близости, а перемещение индивидов увеличивает частоту встреч с другими членами сообщества, будь то того же или другого вида.Следовательно, как группировка, так и перемещение увеличивают частоту контактов и могут привести к увеличению передачи болезни от инфицированных животных.

Однако уровень инфицирования также зависит от способности неинфицированных людей предотвращать болезнь. Чтобы предсказать риск заражения, мы должны понимать факторы, определяющие иммунитет к болезни. Жизненный цикл организма и ряд биотических и абиотических факторов влияют на основные компоненты иммунной системы и на то, как они взаимодействуют.Эти же факторы могут также влиять на склонность к миграции и частоту контактов с людьми, подверженными риску заражения (Altizer et al. 2011; Bauer and Hoye 2014). Эти и другие сложные взаимодействия затрудняют понимание экологии болезни любого организма.

Мормонские сверчки Anabrus simplex , представляющие собой катидиды (Orthoptera: Tettigoniidae), и нимфальную саранчу (Orthoptera: Acrididae), похожи в том, что они могут как собираться, так и мигрировать группами (рис.1; Bazazi et al. 2008 г.). Здесь термин «стая» зарезервирован для мормонских сверчков и нимфальной саранчи, последнюю из которых также называют личинками, потому что у них нет крыльев. Стаи предназначены для скоплений взрослой крылатой саранчи. Пустынная саранча Schistocerca gregaria , перелетная саранча Locusta migratoria и австралийская чумная саранча Chortoicetes terminifera являются примерами полосатых личинок (Уваров 1977, с. 151–187), которые также были объектами исследований диеты и иммунитета. .У мормонов крылья сверчка уменьшены, поэтому они ходят даже во взрослом возрасте. Начиная с третьей нимфальной стадии, они могут объединяться в плотные группы, ежедневно перемещаясь в одном и том же направлении в течение нескольких месяцев до взрослой стадии. Перелётные полосы мормонских сверчков могут достигать 10 км в длину, нескольких километров в ширину, содержать десятки насекомых на квадратный метр и перемещаться до 2 км в день (Cowan 1929; Wakeland 1959; Lorch et al. 2005).

Рис. 1

(A) Группа взрослых мормонов-сверчков переходит дорогу недалеко от Тускароры, штат Невада, в 2008 году.Транспортные средства проезжают мимо насекомых, которых затем убивают другие участники группы. Врезка: взрослый самец мормонского сверчка съедает взрослую самку. (B) Полоса перелетной саранчи L. migratoria нимф (в основном 5-го возраста) пересекает дорогу в Узбекистане в 2007 году. Врезка: нимфы объединяются в коллективном движении в пределах стайки. Фотографии саранчи любезно предоставлены А. Лачининским, Университет Вайоминга.

Рис. 1

(A) Группа взрослых мормонов-сверчков переходит дорогу недалеко от Тускароры, штат Невада, в 2008 году.Транспортные средства проезжают мимо насекомых, которых затем убивают другие участники группы. Врезка: взрослый самец мормонского сверчка съедает взрослую самку. (B) Полоса перелетной саранчи L. migratoria нимф (в основном 5-го возраста) пересекает дорогу в Узбекистане в 2007 году. Врезка: нимфы объединяются в коллективном движении в пределах стайки. Фотографии саранчи любезно предоставлены А. Лачининским, Университет Вайоминга.

Способность улавливать, измерять фенотипы или манипулировать ими, а также выпускать особей обратно в мигрирующие группы сделала мормонских сверчков и нимфальную саранчу модельными организмами для понимания коллективного движения (Vicsek and Zafeiris 2012).Кроме того, эти черты сделали их отличными организмами для понимания того, как миграция и иммунитет могут взаимодействовать через групповое поведение и диету. Бандажирование Мормонские сверчки и саранча занимаются каннибализмом и некрофагией, способствуя распространению болезней. Однако восприимчивость к болезням зависит от тесноты и диетических ограничений, как показано ниже.

Каннибализм, миграция и передача болезней

Мормонские сверчки с дефицитом белка и соли съедают членов группы (Simpson et al.2006). Преобладающее представление о мормонских крикетах и ​​бандах саранчи — это форсированный марш, в котором мормонские сверчки или прыгуны бегут от тех, кто позади, чтобы избежать каннибализма. Например, пустынная саранча, лишенная чувствительности к контакту со спины, с большей вероятностью подверглась каннибализации (Bazazi et al. 2008).

По крайней мере на первый взгляд, каннибализм, кажется, обеспечивает хорошо сбалансированную пищу, но он также имеет свои издержки как с точки зрения риска получения травм при порабощении сородичей, так и с точки зрения риска передачи болезней.Обычно мормонские сверчки в банде примерно одного возраста и, как следствие, одинакового размера, что затрудняет злоумышленнику успешное подчинение другого члена банды. Симпсон и др. (2006) отмечают, что когда мормонские сверчки обладали обеими задними ногами, риск каннибализма был низким, потому что они могли отбросить нападавших. Они становятся особенно уязвимыми во время линьки, когда их ноги становятся неподвижными, но они также линяют, свисая с растительности, что снижает шансы обнаружения группой, идущей по земле.По крайней мере, с момента появления транспортных средств и ядовитых приманок некрофагия может быть гораздо более распространенным явлением, чем каннибализм живых мормонских сверчков, хотя пиршество из мертвых мормонских сверчков также легче наблюдать, потому что это происходит там, где люди могут путешествовать (например, , проезжей части, рис. 1). С каннибализмом также возникает контакт с инфекционными агентами, которых скрывают покоренные. Действительно, качество питания и риск передачи заболеваний могут увеличиваться с филогенетическим сходством, так что каннибализм может быть менее полезным, чем потребление более отдаленно связанной добычи (Pfennig 2000).Каннибализм одного человека несколькими сородичами необходим для распространения болезни (Rudolf and Antonovics 2007), но плотность и направленность мигрирующих групп делают совместное потребление убитых и раненых весьма вероятным (личное наблюдение; Pulpitel 2014). Кроме того, если болезнь приводит к летаргии, но в остальном болезнь остается невыявленной, тогда частота контактов и риск каннибализма возрастают. Поскольку ослабленные люди встречаются и потребляются, потеря болезни в результате миграционной выбраковки инфицированных вряд ли повлияет на мигрирующие группы.

Действия, которые уменьшают частоту контактов, могут снизить риск каннибализма и передачи болезней. Например, организованное передвижение саранчи и мормонских сверчков внутри отряда снижает контакт с членами отряда. Согласованное коллективное движение зависит от плотности с переходом от неупорядоченного движения, происходящего у пустынной саранчи примерно на отметке 30 мин. 25 особей на 1 м 2 2 в лабораторных условиях (Buhl et al. 2006). Мормонские сверчки, отклонившиеся от общего направления группы, чаще контактировали с соседними членами группы, что увеличивало риск каннибализма (Bazazi et al.2010). Следовательно, упорядоченное движение снижает частоту контактов участников группы, что снижает не только каннибализм, но и передачу болезней.

Некрофагия между видами прямокрылых также является обычным явлением и может быть причиной распространения болезни между таксонами. Nosema locustae , микроспоридий, поражает несколько видов кузнечиков и мормонских сверчков и распространяется через некрофагию и каннибализм (Генри, 1972). Ряд болезнетворных агентов, таких как патогенные грибы Metarhizium acridum и Beauveria bassiana , а также бактерии родов Micrococcus , Serratia и Pseudomonas , являются общими для всех видов кузнечиков и мормонов.Существует также предположение, что вирус везикулярного стоматита, VSV, болезнь крупного рогатого скота, может распространяться на кузнечиков пастбищных угодий, которые затем усиливают болезнь и переносят ее среди населения посредством некрофагии. Передача VSV от кузнечиков обратно к домашнему скоту может происходить в результате случайного поедания линяющих нимф (Nunamaker et al. 2003).

Диета и эндокринология движения

Миграции мормонов-сверчков в более общем смысле можно рассматривать как поиск ограниченных питательных веществ.Мормонские сверчки всеядны и питаются в основном лиственными растениями (33–60% от общей сухой массы рациона), насекомыми (11–37%) и грибами (3–24%, Ueckert and Hansen 1970). Даже группами они не дефолируют в окружающей среде (Simpson et al. 2006), и у них часто есть выбор между богатыми углеводами и богатыми белками тканями растений (например, листьями и частями цветов или семенами, соответственно, Srygley, In press ). Когда у мормонских сверчков, взятых из некоторых групп, был свободный выбор между высоким содержанием белка и высоким содержанием углеводов, они предпочитали белок углеводам, а люди, которые питались белком, снижали скорость миграции по сравнению с теми, кто питался сахаром (Srygley et al.2009 г.). В других крикетных бандах мормонов насекомые предпочитали углеводы белкам, когда им предоставлялся выбор между двумя диетами (Srygley and Lorch 2011, 2013). В этих группах люди, которые питались углеводами, снижали скорость миграции по сравнению с теми, кто питался белками. Мормонские сверчки в отрядах, ищущих углеводы, также поедают раненых (личные наблюдения), и поэтому контакт с соседними членами отряда все еще может быть непосредственной причиной согласованного коллективного движения.Однако хищные осы могут также стать причиной массовой эмиграции мормонских сверчков из мест рождения (Srygley and Lorch, 2016).

Перелетная саранча и мормонские сверчки предпочитают рацион с соотношением углеводов к белку, близким к 1,3 (Chambers et al. 1995; Srygley, In press). Пустынная саранча предпочитает диету с равным количеством белков и углеводов (Simpson et al. 2002). Напротив, выживаемость монгольской саранчи Oedaleus asiaticus (Orthoptera: Acrididae) была наибольшей на предпочтительной диете с вдвое большим количеством углеводов по сравнению с белком (Cease et al.2012). В результате, монгольская саранча хорошо выживает на чрезмерно истощенных и обедненных азотом пастбищах, тогда как азотные удобрения плохо переносятся, например, при интенсивном земледелии (Cease et al. 2012, 2015). Кроме того, интенсивный выпас открывает полог и расширяет голую землю, где саранча регулирует терморегуляцию, чтобы максимизировать рост, воспроизводство и выживаемость (Branson and Sword 2008). Более глубокое понимание целей поглощения видов-очагов и характеристика потребностей в питании мигрирующих насекомых во время вспышек популяций позволит лучше понять коллективные движущие силы, стоящие за миграциями насекомых.

Продолжительное движение, характерное для мигрирующих животных, требует энергии, особенно когда насекомые ищут энергоемкие углеводы, как это наблюдается в некоторых мормонских крикетных бандах. Чтобы предотвратить истощение ограниченных запасов углеводов, насекомые мобилизуют липиды (Socha et al. 1999). Гормональная мобилизация липидных резервов наиболее подробно исследована у взрослых саранчовых (Goldsworthy and Joyce 2001). Помимо других стрессовых реакций, высвобождение октопамина нервными клетками быстро увеличивает концентрацию трегалозы и липидов в гемолимфе (Fields and Woodring, 1991), в то время как двигательная активность стимулирует высвобождение кинетического гормона жировой ткани (AKH) из сердечного тела (Goldsworthy and Joyce 2001). ).AKH действует непосредственно на жировое тело, превращая накопленные триглицериды в диглицериды для высвобождения из жирового тела в гемолимфу. В гемолимфе адиполипопротеины объединяются, чтобы транспортировать каждую молекулу диглицерида. Аполипофорин-III (ApoLp-III) может быть обменным, тогда как ApoLp-I и -II — нет (Weers and Ryan 2006). Октопамин и AKH также действуют непосредственно на летательную мышцу для усиления метаболизма (Steele 1985; Orchard et al. 1993), а AKH стимулирует ходьбу у нелетающего жука, Pyrrhocoris apterus (Socha et al.1999). Хотя у насекомого может быть более одной формы AKH, например, у пустынной саранчи их две, а у перелетной саранчи — три, молекулы, по-видимому, имеют одинаковые функции и отличаются только периодом полураспада (Goldsworthy and Joyce 2001). . Единственным AKH у мормонских сверчков является октопептид с той же структурой, что и AKH-II в S. gregaria (Gade et al. 2003).

Приводят ли ограничения в питании к компромиссу между миграцией и иммунитетом?

Иммунная система также требует энергии (Ardia et al.2012). В ответ на инфекцию иммунитет может предъявлять высокие требования к организму, а отсутствие движений является одним из внешних признаков болезни. Например, зараженная грибами пустынная саранча (Elliot et al. 2002) и мигрирующая саранча (Ouedraogo et al. 2004) терморегулируют до более высоких лихорадочных температур, продлевая выживаемость. Как следствие инфекции, запасы энергии могут быть переданы иммунитету за счет движения, и наоборот. Когда углеводов или липидов не хватает, компромисс между миграцией и иммунитетом должен быть наиболее очевидным.

Srygley and Lorch (2011, 2013) проверили эту гипотезу на группе мормонских сверчков, ищущих углеводы, в 2008 году и другой группе мормонских сверчков, ищущих углеводы, в 2009 году (Таблица 1). В 2008 году мормонские сверчки, взятые из мигрирующей группы в Неваде, получали либо диету, богатую белками (42% белка, 0% углеводов) ad libitum в течение одного часа, либо диету, богатую углеводами (42% углеводов, 0% белка) и выпущен обратно в миграционную полосу. У тех, кто получал богатую углеводами диету, снижалась скорость миграции и повышалась антибактериальная активность (Srygley and Lorch 2011).В 2009 году мормонские сверчки, взятые из мигрирующей группы в Неваде, снова получали либо богатую белком диету, либо диету с равным соотношением белков и углеводов. Были приготовлены два контрольных препарата: сверчков-мормонов, которых кормили смесью витаминов и соли, и сверчков, которых ловили, а не кормили и отпускали обратно в группу. Те, кто получал диету, богатую углеводами, имели пониженную миграционную активность и повышенную антибактериальную активность по сравнению с теми, кто получал диету, богатую белками, а те, кто получал белковую диету, не отличались по скорости или антибактериальной активности от любого контрольного лечения (Srygley and Lorch 2013).

Таблица 1

Ответ мормонских сверчков из мигрирующих полос около Тускароры, Невада, в два разных года на диету, богатую углеводами, по сравнению с диетой, богатой белками

. Год обучения


.

Экспериментальный анализ
.
2008 а
.
2009 б
.
Выбор диеты Ешьте больше углеводов (C) Ешьте больше углеводов
Движение Медленнее при кормлении C Медленнее при кормлении C
PO4 активности Нет ответа
proPO активность Больше при кормлении C Нет ответа
Инкапсуляция Выше при кормлении C нет данных
Антибактериальная активность Более

C

выше

C Больше при подаче C
. Год обучения


.

Экспериментальный анализ
.
2008 а
.
2009 б
.
Выбор диеты Ешьте больше углеводов (C) Ешьте больше углеводов
Движение Медленнее при кормлении C Медленнее при кормлении C
PO4 активности Нет ответа
proPO активность Больше при кормлении C Нет ответа
Инкапсуляция Выше при кормлении C нет данных
Антибактериальная активность Более

C

выше

C Больше при кормлении C

Таблица 1

Ответ мормонских сверчков из мигрирующих полос близ Тускароры, штат Невада, в два разных года на диету, богатую углеводами, по сравнению с диетой, богатой белком

. Год обучения


.

Экспериментальный анализ
.
2008 а
.
2009 б
.
Выбор диеты Ешьте больше углеводов (C) Ешьте больше углеводов
Движение Медленнее при кормлении C Медленнее при кормлении C
PO4 активности Нет ответа
proPO активность Больше при кормлении C Нет ответа
Инкапсуляция Выше при кормлении C нет данных
Антибактериальная активность Более

C

выше

C Больше при подаче C
. Год обучения


.

Экспериментальный анализ
.
2008 а
.
2009 б
.
Выбор диеты Ешьте больше углеводов (C) Ешьте больше углеводов
Движение Медленнее при кормлении C Медленнее при кормлении C
PO4 активности Нет ответа
proPO активность Больше при кормлении C Нет ответа
Инкапсуляция Выше при кормлении C нет данных
Антибактериальная активность Более

C

выше

C Больше при кормлении C

Белки ApoLp-III играют двойную роль.Они объединяются с ApoLp-I и ApoLp-II, чтобы окружить липидную молекулу во время ее транспортировки в гемолимфе из жирового тела, и они высвобождаются из липидов в мышцах (Weers and Ryan 2006). Следовательно, во время продолжительных перемещений, когда липиды используются в качестве топлива, они проводят больше времени, связанного с липидами, и меньше времени в свободном состоянии, чем когда насекомое не мигрирует. ApoLp-III также участвует во врожденном иммунном ответе. Он связывается с липополисахаридами (ЛПС) грамотрицательных бактерий и липотейхоевой кислотой (LTA) грамположительных бактерий (Whitten et al.2004 г.). В свободном состоянии ApoLp-III связывается с бета-1,3-глюканом, который является компонентом клеточных стенок грибов и некоторых бактерий (Whitten et al. 2004). Когда ApoLp-III не транспортирует липиды, он увеличивает антибактериальную литическую активность (Weisner et al. 1997; Halwani and Dunphy 1999). Например, если углеводы достаточно сконцентрированы в гемолимфе, транспорт липидов может не быть необходимым для подпитки миграции. Это согласуется с увеличением антибактериальной активности, которое мы наблюдали, когда в рацион мормонских сверчков из ограниченных по углеводам диапазонов добавлялись углеводы, по сравнению с рационами, дополненными белком (Srygley and Lorch 2011, 2013).Однако реконфигурация иммунной системы (Adamo 2014, Adamo et al. 2016), такая как усиление иммунитета в кишечнике, во время стрессовой деятельности может смягчить потерю антибактериальной активности гемолимфы.

Миграция мормонских сверчков и саранчи является результатом более частых контактов между кон-специфическими особями, а местная скученность приводит к большему риску заражения. Гипотеза зависимой от плотности профилактики предполагает, что конститутивный иммунитет должен возрастать с увеличением скопления людей (Wilson et al.2002). Следовательно, мы можем прогнозировать, что иммунитет саранчи и мормонских сверчков в мигрирующих полосах будет выше, чем у одиночных особей. Schistocerca gregaria , выращенный в лаборатории при высокой плотности, имел более высокую антибактериальную активность и был менее подвержен грибковой инфекции, чем растения, выращенные при низкой плотности (таблица 2). Активность фенолоксидазы, реакция на инкапсуляцию и количество гемоцитов не различались в зависимости от лечения (Wilson et al. 2002). Также в соответствии с профилактикой, зависящей от плотности, мормонские сверчки из популяций к востоку от Скалистых гор, которые исторически вели оседлый образ жизни и имели низкую плотность, обладали меньшей лизоцимной активностью и инкапсулировали чужеродных захватчиков медленнее, чем сверчки из высокоплотных мигрирующих популяций в Большом бассейне запад США.В лаборатории мормонские сверчки, выращиваемые группами, быстрее повышали свои титры пропенолоксидазы по мере старения и быстрее инкапсулировали чужеродных захватчиков, но спонтанные титры фенолоксидазы и антибактериальная активность оставались неизменными по сравнению с сверчками, выращенными в одиночку (Srygley 2012a). Напротив, количество гемоцитов уменьшалось с увеличением плотности среди группирующихся популяций C. terminifera (Miller and Simpson 2010). Нимфы последней стадии C. terminifera , снятые с повязки и хранящиеся в одиночестве в лаборатории, показали увеличение количества гемоцитов всего через 2 дня по сравнению с нимфами, содержащимися в группах по 100 человек (Miller and Simpson 2010).

Таблица 2

Зависимая от плотности профилактика и иммунный ответ саранчи и мормонских сверчков на высокую плотность

и др. (2002)

и др.(2002)

Насекомое
.
PO
.
proPO
.
Антибактериальная активность
.
Подсчет гемоцитов
.
Ответ инкапсуляции
.
Противогрибковое действие
.
Место учебы
.
ссылку
.
S. gregaria 0 a nd + 0 0 + лаборатория Wilson
C. terminifera nd nd nd () nd nd Население и лаборатория Миллер и

А.simplex nd nd + nd + nd население Bailey et al. (2008)
A. simplex 0 + 0 nd + nd лаборатория

091

Насекомое
.
PO
.
proPO
.
Антибактериальная активность
.
Подсчет гемоцитов
.
Ответ инкапсуляции
.
Противогрибковое действие
.
Место учебы
.
ссылку
.
S. gregaria 0 a nd + 0 0 + лаборатория Wilson
C. terminifera nd nd nd () nd nd Население и лаборатория Miller and

A. simplex nd nd + nd + nd население Bailey et al.(2008)
A. simplex 0 + 0 nd + nd лабораторный стол
Профилактика в зависимости от плотности и иммунный ответ саранчи и мормонских сверчков на высокие плотности

и др.(2002)

и др. (2002)

Насекомые
.
PO
.
proPO
.
Антибактериальная активность
.
Подсчет гемоцитов
.
Ответ инкапсуляции
.
Противогрибковое действие
.
Место учебы
.
ссылку
.
S. gregaria 0 a nd + 0 0 + лаборатория Wilson
C. terminifera nd nd nd () nd nd Население и лаборатория Miller and

A. simplex nd nd + nd + nd население Bailey et al.(2008)
A. simplex 0 + 0 nd + nd лаборатория

091

Насекомое
.
PO
.
proPO
.
Антибактериальная активность
.
Подсчет гемоцитов
.
Ответ инкапсуляции
.
Противогрибковое действие
.
Место учебы
.
ссылку
.
S. gregaria 0 a nd + 0 0 + лаборатория Wilson
С.terminifera nd nd nd () nd nd Население и лаборатория Miller and Simpson (2010)
9115

nd + nd + nd население Bailey et al. (2008)
А.simplex 0 + 0 nd + nd лаборатория Srygley (2012a)

протеин в дефиците, если нет гена

также, вероятно, будет ограниченным, в том числе для ферментов, связанных с иммунитетом, таких как каскады пропенолоксидазы и фенолоксидазы и антибактериальные лизоцимоподобные ферменты. В 2007 году мормонских сверчков, взятых из мигрирующей группы в Юте, кормили либо диетой, богатой белком (42% белка, 0% углеводов) в течение одного часа, либо диетой, богатой углеводами (42% углеводов, 0% белка), и отпускали обратно. в миграционную полосу (Srygley et al.2009 г.). Мормонские сверчки, получавшие протеиновые добавки, имели более низкую скорость миграции и повышенные титры фенолоксидазы по сравнению с теми, кто получал углеводы (Таблица 3). Антибактериальная активность и инкапсуляция постороннего объекта не различались между мормонскими сверчками с ограниченным содержанием белка, которых кормили двумя диетами. В лабораторных условиях диета с ограниченным содержанием белка приводила к тому, что мормонские сверчки имели более низкие титры фенолоксидазы, более медленную инкапсуляцию инородных тел и большую смертность от грибковой инфекции B. bassiana , чем при кормлении диетами с высоким содержанием белка (Srygley and Jaronski, представленные для публикации ).Антибактериальная активность не изменилась при соблюдении диеты в лаборатории. Следовательно, ограничение белка изменило грибковый иммунитет как у содержащихся в неволе, так и у мигрирующих мормонских сверчков, но дефицит углеводов повлиял только на бактериальный иммунитет мигрирующих насекомых (рис. 2). Эти недавние результаты являются дополнительным доказательством в поддержку гипотезы о прямом компромиссе между миграционной и антибактериальной активностью мормонских сверчков, в то время как фенолоксидаза находится под угрозой из-за низкого уровня диетического белка, независимо от миграционной активности (Srygley and Lorch 2013).

Рис. 2

Блок-схема взаимосвязей между поведением, эндокринологией, иммунологией и их вкладом в передачу болезни и потенциал для суперраспространителей. Черты, которые были продемонстрированы в лабораторных экспериментах или в полевых условиях, выделены жирным шрифтом, тогда как текст без жирного шрифта — это признаки, которые остаются гипотетическими. См. Основной текст для объяснения связей.

Рис. 2

Блок-схема взаимосвязей между поведением, эндокринологией, иммунологией и их вкладом в передачу заболевания и потенциал для суперраспространителей.Черты, которые были продемонстрированы в лабораторных экспериментах или в полевых условиях, выделены жирным шрифтом, тогда как текст без жирного шрифта — это признаки, которые остаются гипотетическими. См. Основной текст для объяснения связей.

Таблица 3

Ответ мормонских сверчков из мигрирующих полос в двух очень похожих высокогорных пустынных кустарниках Большого Бассейна

. Мигрирующее население и год обучения


.

Экспериментальный анализ
.
Вернал, Юта 2007 a
.
Тускарора, Невада 2008, 2009 b
.
Выбор диеты Предпочтение белку Предпочтение углеводов
Движение Медленнее при кормлении протеином Медленнее при приеме углеводов
При кормлении белком Больше активности PO ответа
Инкапсуляция Нет ответа Больше при приеме углеводов
Антибактериальная активность Нет ответа Больше при приеме углеводов
. Мигрирующее население и год обучения


.

Экспериментальный анализ
.
Вернал, Юта 2007 a
.
Тускарора, Невада 2008, 2009 b
.
Выбор диеты Предпочтительный белок Предпочтение углеводов
Движение Медленнее при кормлении белком Медленнее при приеме углеводов
При кормлении белком Больше активности PO ответа
Инкапсуляция Нет ответа Более высокая при кормлении углеводами
Антибактериальная активность Нет ответа Более высокая при кормлении углеводами

Таблица 3

Ответ двух мормонских сверчков в очень похожих мигрирующих группах , высокие кустарники пустыни Большого бассейна

. Мигрирующее население и год обучения


.

Экспериментальный анализ
.
Вернал, Юта 2007 a
.
Тускарора, Невада 2008, 2009 b
.
Выбор диеты Предпочтение белку Предпочтение углеводов
Движение Медленнее при кормлении протеином Медленнее при приеме углеводов
При кормлении белком Больше активности PO ответа
Инкапсуляция Нет ответа Больше при приеме углеводов
Антибактериальная активность Нет ответа Больше при приеме углеводов
. Мигрирующее население и год обучения


.

Экспериментальный анализ
.
Вернал, Юта 2007 a
.
Тускарора, Невада 2008, 2009 b
.
Выбор диеты Предпочтительный белок Предпочтение углеводов
Движение Медленнее при кормлении протеином Медленнее при приеме углеводов
При кормлении белком Больше активности PO ответа
Инкапсуляция Нет ответа Более высокая при кормлении углеводами
Антибактериальная активность Нет ответа Повышенная при кормлении углеводами

Диеты с высоким содержанием белка не всегда повышают выживаемость патогенов.Австралийская чумная саранча C. terminifera , получавшая пищу с высоким содержанием белка, быстрее уступила M. acridum , чем те, кто получал пищу с высоким содержанием углеводов (Graham et al. 2014). In vitro, M. acridum растет быстрее и производит больше токсинов на субстратах с высоким содержанием белка и низким содержанием углеводов по сравнению с субстратами с низким содержанием белка и высоким содержанием углеводов. In vivo гриб может использовать белковые добавки в рационе саранчи для выработки большего количества токсинов и противодействия иммунной системе саранчи (Graham et al 2014).В полевых условиях общий белок, циркулирующий в гемолимфе нимфы 4-го и 5-го возрастов и взрослой самки C. terminifera , был прямо пропорционален плотности гемоцитов и антибактериальной активности, но обратно пропорционален титрам пропенолоксидазы (Graham et al., 2015). Различия между стадиями не исследовались, поэтому сложно отделить онтогенетические изменения иммунитета австралийской саранчи от изменений, связанных с титрами белков.

Мормонские сверчки и перелетная саранча различаются по онтогенезу титров фенолоксидазы и пропенолоксидазы, что может влиять на восприимчивость к M.акридум . У мормонских сверчков титры фенолоксидазы и пропенолоксидазы увеличиваются в течение каждого нимфального возраста, а затем снижаются при линьке (Srygley 2012b). После линьки до взрослой особи титры фенолоксидазы и пропенолоксидазы у мормонских сверчков экспоненциально увеличиваются с возрастом. Напротив, титры фенолоксидазы остаются очень низкими у L. migratoria до 6-го дня после линьки до последней нимфальной стадии и не увеличиваются до 10-го дня после вылупления имаго (Mullen and Goldsworthy, 2003).Кроме того, активность пропенолоксидазы не изменялась с возрастом нимф последнего возраста или взрослых особей (Mullen and Goldsworthy 2003). Если такая же картина сохраняется для C. terminifera , то белковые добавки к рациону саранчи могут не иметь повышенной активности фенолоксидазы в последней нимфальной стадии, когда насекомые были инфицированы M. acridum .

Однако индукция активности фенолоксидазы увеличивается с возрастом L. migratoria , начиная с 4 дней после того, как они вырастают до взрослой особи (Mullen and Goldsworthy 2003).В тот же день ответ на AKH в L. migratoria резко возрастает с увеличением титров ApoLp-III в гемолимфе (Mwangi and Goldsworthy 1977). Ламинарин также индуцирует большую активность фенолоксидазы у голодных мигрирующих саранчовых, вероятно, из-за роли голодания в высвобождении AKH (Goldsworthy et al. 2002).

В отличие от подъема и падения уровня фенолоксидазы у мормонских сверчков с каждой линькой, инкапсуляция посторонних предметов постоянно увеличивается от предпоследнего возраста до взрослой стадии (Srygley 2012b).После взросления, возможно, когда фенолоксидаза больше не требуется для линьки, титры фенолоксидазы экспоненциально увеличиваются с возрастом после эклозии. Теоретически иммунокомпетентность также должна возрастать экспоненциально, по крайней мере, для генерализованного иммунного ответа с участием фенолоксидазы. В подтверждение этого прогноза выживаемость до инфекции M. acridum также возрастает экспоненциально с возрастом, в котором взрослый мормонский сверчок вступил в контакт с грибком (Srygley 2012b).

Поведенческое избегание инфицированных людей также снижает передачу болезней (Jaronski 2013).Кузнечики, в том числе Schistocerca americana , и мормонские сверчки избегали поедающих трупов, убитых одним из энтомопатогенов M. acridum или B. bassiana . Трупы изменили цвет из-за инфекций, красный при заражении M. acridum и розовый из B. bassiana , но грибки не спорулировали через кутикулу насекомых во время презентации неинфицированным людям. В исследовании каннибализма зараженной грибами австралийской чумной саранчи (Pulpitel 2014), C.terminifera не смогли различить зараженных M. acridum сородичей, замороженных перед смертью от инфекции, и неинфицированных контрольных животных, тогда как они отвергли трупы, которые умерли и стали красными от заражения M. acridum . Поскольку изменение цвета происходит после смерти (в течение 1 часа, Pulpitel 2014), саранча и мормонские сверчки в полосах, вероятно, встретят и съедят большинство зараженных грибами трупов до того, как они изменит цвет.

Заключение: Являются ли мигрирующие мормонские сверчки и саранча лучшими распространителями инфекции?

Привлечение мигрантов в скопления увеличивает каннибализм, некрофагию и риск передачи болезней.Мормонские сверчки и саранча реагируют на увеличение плотности населения повышением своего основного иммунитета. Коллективное движение участников группы снижает частоту контактов и каннибализм, тем самым снижая риск передачи болезней. Недостаток питания вызывает ослабление иммунной функции. Мы находим большую восприимчивость к грибку Beauveria при ограничении количества белка в рационе, и поэтому мы можем прогнозировать более высокую распространенность грибка в группах, состоящих из мормонских сверчков или саранчи с дефицитом белка (рис.2). Beauveria повсеместно встречается в почвах и эндофитен в растениях, с которыми часто контактируют насекомые. Мы обнаруживаем меньшую антибактериальную активность, когда количество углеводов ограничено, и поэтому мы могли бы предсказать большую распространенность бактерий в группах, состоящих из мормонских сверчков или саранчи с дефицитом углеводов. До тех пор, пока насекомые не поддаются инфекции и не проявляют признаков инфекции, которые могли бы предотвратить их сородичей, мы могли бы ожидать, что эти группы будут лучшими распространителями болезни.Тем не менее, болезни, которые они могут передать, будут зависеть от диетического дефицита членов группы.

Открытие того, что мормонские сверчки иногда мигрируют в поисках белков, а иногда мигрируют в поисках углеводов, послужило основанием для открытия того, что предпочтения в рационе одного из этих макроэлементов связаны со слабостью различных компонентов иммунной системы. По сути, антибактериальные и противогрибковые действия мормонских сверчков имеют разную валюту.Необходимы исследования, чтобы определить, ослабляет ли саранча, которая не может сбалансировать свой рацион в полевых условиях, эти два очень разных аспекта своей иммунной системы, но компромисс между энергично требовательной полетной активностью и антибактериальной активностью также наблюдается в Техасе. cricket Gryllus texensis (Adamo et al. 2008). Поскольку аполипофорин III участвует в транспорте липидов, а также в антибактериальной активности, этот компромисс, вероятно, будет иметь место у всех рассеивающих насекомых, которые используют жир в качестве основного топлива.

Полевые организмы могут казаться одинаковыми внешне, но они будут различаться по истории воздействия патогенов. Организмы, выращенные в контролируемой среде, имеют то преимущество, что исследователь имеет больший контроль над воздействием. Полевые исследования также необходимы для понимания естественных вариаций признаков и, в конечном итоге, для того, чтобы результаты лабораторных исследований были экологически значимыми.

Благодарности

Автор хотел бы поблагодарить Пэт Лорч и Лору Сеньор за всю их работу с мормонскими сверчками.Он также поблагодарит Алекса Лачининского, который дал разрешение на включение своих фотографий нимфального отряда мигрирующей саранчи, а также Бетани Хой и Алексу Фрицше Маккей за организацию симпозиума и приглашение принять участие.

Финансирование

Финансирование было предоставлено из операционных фондов Службы сельскохозяйственных исследований Министерства сельского хозяйства США.

Список литературы

2014

.

Влияние гормонов стресса на иммунную функцию может иметь жизненно важное значение для адаптивной реконфигурации иммунной системы во время поведения «сражайся или беги»

.

Интегр Комп Биол

54

:

419

26

.

2008

.

Конкуренция между иммунной функцией и транспортом липидов за белок аполипофорин III приводит к стресс-индуцированной иммуносупрессии у сверчков

.

J Exp Biol

211

:

531

8

.

2016

.

Реконфигурация сети иммунной системы при ограничении пищи у гусеницы
Manduca sexta.

J Exp Biol

219

:

706

18

.

2011

.

Миграция животных и риск инфекционных заболеваний

.

Наука

331

:

296

302

.

2012

.

Затраты на иммунитет у насекомых: индуцированный иммунный ответ увеличивает скорость метаболизма и снижает антимикробную активность

.

Func Ecol

26

:

732

9

.

2008

.

Меняется ли иммунитет в зависимости от плотности популяции диких популяций мормонских сверчков?

Evol Ecol Res

10

:

599

610

.

2014

.

Мигрирующие животные сочетают биоразнообразие и функционирование экосистем во всем мире

.

Наука

344

:

1242552.

2008

.

Коллективное движение и каннибализм в мигрирующих стаях саранчи

.

Curr Biol

18

:

735

9

.

2010

.

Социальный контекст каннибализма в мигрирующих стаях мормонского сверчка

.

PLoS ONE

5

:

e15118.

2008

.

Устойчивое управление насекомыми-травоядными в экосистемах пастбищ: новые перспективы в борьбе с кузнечиками

.

Биология

56

:

743

55

.

2006

.

От беспорядка к порядку в походной саранче

.

Наука

312

:

1402

6

.

2012

.

Тяжелый выпас скота способствует нашествию саранчи за счет снижения содержания азота в растениях

.

Наука

335

:

467

9

.

2015

.

Жизнь с саранчой: соединение азота в почве, нашествия саранчи, средства к существованию и рынки домашнего скота

.

Биология

665

:

551

8

.

1995

.

Поведенческие механизмы балансировки питательных веществ в
Locusta migratoria
нимфы

.

Анимационное поведение

50

:

1513

23

.

1929

. История жизни, привычки и способы борьбы с мормонским крикетом. Технический бюллетень 161, Министерство сельского хозяйства США, стр.

1

28

.

2002

.

Взаимодействие «хозяин-патоген» в различной среде: температура, поведенческая лихорадка и физическая форма

.

Proc R Soc Lond B

269

:

1599

607

.

1991

.

Мобилизация липидов и углеводов октопамином в домашнем сверчке,
Acheta domesticus.

J Физиология насекомых

37

:

193

9

.

2016

.

Являются ли мигрирующие животные лучшими распространителями инфекции?

Интегр Комп Биол

.

2003

.

Филогенетический анализ адипокинетических нейропептидов Ensifera

.

Physiol Entomol

28

:

283

9

.

2001

.
Физиология и эндокринный контроль полета
. В:

, редакторы.

Передвижение насекомых: механизмы и последствия

.

КАБИНА

,

Уоллингфорд, Великобритания

, п.

65

86

.

2002

.

Адипокинетический гормон усиливает вызванную ламинарином и бактериальными липополисахаридами активацию каскада пропенолоксидазы у африканской перелетной саранчи,
Locusta migratoria.

J Физиология насекомых

48

:

601

8

.

2014

.

Саранча увеличивает потребление углеводов для защиты от грибковых биопестицидов

.

J Ins Physiol

69

:

27

34

.

2015

.

Состояние тела ограничивает иммунную функцию полевых популяций самок австралийской чумной саранчи
Chortoicetes terminifera.

Иммунол против паразитов

37

:

233

41

.

1999

.

Аполипофорин-III в
Галерея меллонелла
усиливает литическую активность гемолимфы

.

Devel Comp Immunol

23

:

563

70

.

1972

.

Эпизоотология инфекций по
Nosema locustae
Консервирование (Microsporida: Nosematidae) кузнечиков

.

Acrida

1

:

111

20

.

2013

.

Микоз подавляет каннибализм с помощью
Melanoplus sanguinipes
,
М.дифференциал
,
Schistocerca americana
, и
Анабрус симплекс.

J Наука о насекомых

13

:

122.

2005

.

Радиотелеметрия выявляет различия в индивидуальных моделях передвижения между популяциями мормонов-сверчков во время вспышки и без нее

.

Экол Энтомол

30

:

548

55

.

2010

.

Изоляция от походного оркестра увеличивает плотность гемоцитов у дикой саранчи (
Chortoicetes terminifera
)

.

Экол Энтомол

35

:

236

9

.

2003

.

Изменения липофоринов связаны с активацией фенолоксидазы в гемолимфе
Locusta migratoria
в ответ на введение иммуногенов

.

Насекомое Biochem Mol Biol

33

:

661

70

.

1977

.

Возрастные изменения реакции на адипокинетический гормон у
Locusta migratoria.

Physiol Entomol

2

:

37

42

.

2003

.

Кузнечики (Orthoptera: Acrididae) могут служить резервуарами и переносчиками вируса везикулярного стоматита

.

Дж Мед Энтомол

40

:

957

63

.

1993

.

Многофункциональная роль октопамина в стае саранчи

.

Анну Рев Энтомол

38

:

227

49

.

2004

.

Поведенческая терморегуляция мигрирующей саранчи: терапия для преодоления грибковой инфекции

.

Oecol

138

:

312

9

.

2012

.

От суперраспространителей к очагам болезней: связь передачи между хостами и пространством

.

Передняя часть Ecol Environ

10

:

75

82

.

2000

.

Влияние филогенетического сходства хищник-жертва на последствия хищничества для приспособленности: компромисс между питанием и болезнью?

Am Nat

155

:

335

45

.

2014

. Экологическая иммунология: стратегии иммунной защиты австралийской саранчи [кандидатская диссертация]. Сидней, Австралия: Сиднейский университет.

2007

.

Передача болезни каннибализмом: редкое явление или обычное явление?

Proc R Soc Lond B

274

:

1205

10

.

2002

.

Сравнение регуляции питания личинок пустынной саранчи в одиночной и стадной фазах
Schistocerca gregaria.

J Exp Biol

205

:

121

9

.

2006

.

Сверчки-каннибалы на марше за белком и солью

.

PNAS

103

:

4152

6

.

1999

.

Адипокинетический гормон стимулирует двигательную активность насекомых

.

Naturwissenschaften

86

:

85

6

.

2012a

.

Профилактика в зависимости от возраста и плотности мигрирующих мормонских сверчков-людоедов
Анабрус симплекс
(Прямокрылые: Tettigoniidae)

.

Энвир Энтомол

41

:

166

71

.

2012b

.

Онтогенетические изменения иммунитета и предрасположенность мормонских сверчков к грибковой инфекции
Анабрус симплекс.

J Физиология насекомых

58

:

342

7

.

2011

.

Слабость в группе: опосредованный питательными веществами компромисс между миграцией и иммунитетом мормонских сверчков,
Анабрус симплекс.

Анимационное поведение

81

:

395

400

.

2013

.

Преодоление неопределенности: недостаток питательных веществ стимулирует миграцию насекомых за счет снижения иммунитета

.

Интегр Комп Биол

53

:

1002

13

.

2016

.

Потеря безопасности в численности и новый фактор массовой миграции: радиотелеметрия выявляет жестокое нападение на группу мормонских сверчков.

.

Рой Soc Open Sci

3

:

160113

.

2009

.

Немедленное влияние белковой диеты на подвижность и общую иммунокомпетентность мигрирующих мормонских сверчков
Анабрус симплекс
(Прямокрылые: Tettigoniidae)

.

Экол Энтомол

34

:

663

8

.

1985

.
Контроль обменных процессов
. В:

.

Эндокринология II, комплексная физиология, биохимия и фармакология насекомых, вып. 8

.

Оксфорд

:

Пергамонный пресс

. п.

99

145

.

1970

.

Сезонный сухой состав рациона мормонских сверчков

.

Дж Экон Энтомол

63

:

96

8

.

1977

.

Кузнечики и саранча: Справочник по общей акридологии, т. II

.

Лондон

:

Центр зарубежных исследований вредителей

.

2012

.

Коллективное движение

.

Phys Rep

517

:

71

140

.

1959

. Мормонские сверчки в Северной Америке. Технический бюллетень 1202, Министерство сельского хозяйства США, Типография правительства США, Вашингтон, округ Колумбия.

2006

.

Аполипофорин III: Ролевая модель аполипопротеина

.

Насекомое Biochem Mol Biol

36

:

231

40

.

1997

.

Изолированный Аполипофорин III из
Галерея меллонелла
стимулирует иммунные реакции этого насекомого

.

J Ins Physiol

43

:

383

91

.

2004

.

Новая роль аполипопротеина насекомых (Аполипофорин III) в распознавании бета-1,3-глюканового паттерна и реакциях клеточной инкапсуляции

.

Дж Иммунол

172

:

2177

85

.

2002

.

Как справиться с толпой: устойчивость к болезням пустынной саранчи в зависимости от плотности

.

PNAS

99

:

5471

5

.

Заметки автора

Опубликовано Oxford University Press от имени Общества интегративной и сравнительной биологии, 2016 г. Эта работа написана государственным служащим США и находится в общественном достоянии США.

Шаперон эндоплазматического ретикулума gp96 необходим для инфицирования вирусом везикулярного стоматита на JSTOR

Гликопротеин оболочки вируса везикулярного стоматита (VSV-G) позволяет вирусам проникать к хозяевам, находящимся на таком расстоянии, как насекомые и позвоночные.Из-за его способности поддерживать инфекцию большинства, если не всех типов клеток человека, VSV-G используется в вирусных векторах для генной терапии. Однако ни рецептор, ни какой-либо специфический фактор-хозяин для VSV-G не идентифицированы. Здесь мы демонстрируем, что инфицирование VSV и врожденный иммунитет через Toll-подобные рецепторы (TLR) требуют общего компонента, шаперона эндоплазматического ретикулума gp96. Клетки без gp96 или с каталитически неактивным gp96 не связывают VSV-G. Повсеместная экспрессия gp96, следовательно, важна для удивительно широкого тропизма VSV-G.Клетки, дефицитные по gp96, также лишены функциональных TLR, что указывает на то, что управляемое патогенами давление для TLR-опосредованного иммунитета поддерживает широкий диапазон хозяев VSV-G за счет положительного отбора для повсеместной экспрессии gp96.

PNAS — это самый цитируемый в мире междисциплинарный научный сериал.
Он публикует отчеты об исследованиях, комментарии, мнения, обзоры,
доклады коллоквиума и акции Академии. В соответствии с руководящими
принципы, установленные Джорджем Эллери Хейлом в 1914 году, PNAS издает
краткие первые объявления членов Академии и иностранных партнеров подробнее
важный вклад в исследования и работу, которая, по мнению Участника,
иметь особое значение.

Национальная академия наук (НАН) — это частная некоммерческая организация ведущих исследователей страны. НАН признает и продвигает выдающуюся науку путем избрания в члены; публикация в своем журнале PNAS; и его награды, программы и специальные мероприятия. Через Национальные академии наук, инженерии и медицины НАН предоставляет объективные, научно обоснованные советы по важнейшим вопросам, затрагивающим нацию.

Читальный зал ASCO | Примо Лара, доктор медицины, и Мэтью Тенолд, доктор медицины, о лечении позднего рака почки

Стратегии лечения прогрессирующей или метастатической почечно-клеточной карциномы (мПКР) постоянно развиваются.Варианты системной первичной терапии теперь включают комбинированную терапию на основе ингибиторов иммунных контрольных точек. За некоторыми исключениями, монотерапия ингибиторами рецептора тирозинкиназы сосудистого эндотелиального фактора роста (VEGFR-TKIs) или ингибиторами mTOR больше не является подходящим вариантом в первичных условиях, Примо Лара, доктор медицины, и Мэтью Тенолд, доктор медицины, оба из Калифорнийского университета Об этом говорится в статье ASCO Educational Book , опубликованной в «Комплексном онкологическом центре Дэвиса» и его коллегах.

Несмотря на установленную эффективность комбинаций передовых иммунных контрольных точек на основе ингибиторов, большинству пациентов с мПКР, вероятно, потребуются дополнительные линии терапии. Авторы отметили, что при выборе другой терапии онкологи должны хорошо подумать, особенно в ситуациях непереносимости лекарств или явного прогрессирования заболевания. Последующие варианты системной терапии, как правило, основаны на TKI, и продолжающиеся клинические испытания помогут оптимизировать алгоритм лечения.

В следующем совместном интервью Лара и Тенольд обсудили нынешние подходы к лечению, а также то, что ждет в будущем в этой быстро меняющейся области.

Многим пациентам с мПКР целесообразно сразу начинать терапию. Однако у отдельных пациентов может быть целесообразным активное наблюдение и / или циторедуктивная хирургия. Какие это пациенты?

Лара и Тенолд: Бессимптомные пациенты с небольшим объемом заболевания являются кандидатами на участие в программе активного наблюдения. Это влечет за собой возможность проводить долгосрочное наблюдение с запланированными визитами в офис и эпизодическими исследованиями изображений, частота которых со временем уменьшается, если болезнь остается стабильной.Пациенты с IMDC [оценка прогностической модели Международного консорциума баз данных мПКР] — заболевание с низким риском имеет более короткое время для лечения с помощью этой стратегии и, следовательно, маловероятные кандидаты для этого подхода.

Пациенты с низким бременем заболевания, статусом IMDC-Fav [orable] или -Int [средний] и хорошим статусом работоспособности могут рассматриваться для циторедуктивной нефрэктомии при участии мультидисциплинарной комиссии по опухолям. Отобранные пациенты, у которых есть отличный начальный ответ на системную терапию и олигометастатическое заболевание, являются кандидатами на циторедуктивную операцию (включая метастазэктомию), которая может избавить их от рентгенологического лечения.

Несмотря на высокоактивную первичную иммунотерапию, большинству пациентов потребуются дополнительные линии терапии. Какие наиболее важные факторы следует учитывать онкологам при выборе терапии второй линии?

Лара и Тенолд: Первое, что нужно сделать, это то, доступно ли клиническое испытание и подходит ли пациент для этого испытания. Участие в клинических испытаниях остается наивысшим приоритетом при любом ПКР.

При выборе второй линии терапии при первичном рефрактерном заболевании или заболевании, которое явно прогрессирует после первоначального ответа, очень важно учитывать выбранный метод терапии первой линии.Если блокада иммунных контрольных точек (ICB) использовалась в первичных условиях (например, ниволумаб / ипилимумаб) и не было получено ответа, то VEGFR-TKI часто является предпочтительным вариантом второй линии.

И наоборот, если одноагрессивный VEGFR-TKI использовался в первой линии (что становится все реже), то ниволумаб одобрен FDA для второй линии на основе результатов CheckMate-025. Следует отметить, что некоторые врачи будут лечить этих же пациентов комбинацией ипилимумаб / ниволумаб.

Оптимальная терапия второй линии для пациентов, у которых прогрессирует комбинация ICB + TKI (например, пембролизумаб / акситиниб), менее ясна; у большинства этих пациентов часто рассматривается последовательное использование терапии VEGFR-TKI. Комбинация ленватиниб / эверолимус иногда используется после прогрессирования ИТК, хотя это, вероятно, будет более применимо к третьей линии или после нее.

Некоторым пациентам с олигометастатическим заболеванием поддаются местные абляционные методы лечения, такие как резекция или стереотаксическая лучевая терапия.

Факторы, связанные с пациентом, в условиях второй линии обычно возникают из-за непереносимости терапии из-за побочных эффектов. Прежде чем принять решение о переходе на терапию второй линии, иногда можно предпринять усилия, чтобы сделать текущую терапию пациента более переносимой. Существует большая гибкость с TKI, когда снижение дозы с учетом симптомов пациента может быть полезным без ущерба для эффективности лечения.

Лечебный отпуск продолжительностью 1-2 недели также позволяет избавиться от побочных эффектов.Также может быть полезным усиление поддерживающей терапии с помощью дополнительных методов лечения кисты и стопы, стоматита и диареи или привлечение специалистов в данной системе органов, испытывающих побочные эффекты.

Побочные эффекты от ICB часто имеют меньшую гибкость в управлении, поскольку нет разумных стратегий снижения дозы. При незначительных побочных эффектах лечение кортикостероидами может привести к исчезновению симптомов, и лечение может быть возобновлено. В случае тяжелых или стойких симптомов это может привести к необходимости рассмотреть вопрос о прекращении ИКБ и назначении терапии второй линии.Исключением могут быть такие события, как эндокринопатия 4 степени, когда недостаточность рассматриваемой железы (то есть щитовидной железы, надпочечников, гипофиза) может быть адекватно преодолена с помощью заместительной гормональной терапии и, таким образом, может быть продолжена ICB.

Можете ли вы посоветовать, как онкологи могут обсудить с пациентами эти сложные варианты лечения и рекомендации?

Лара и Тенолд: Ключевыми шагами являются ознакомление пациентов на каждой фазе пути болезни с вариантами лечения и ожидаемыми токсичностями, а также управление их ожиданиями.В нашей практике мы часто вместе с пациентом просматриваем ориентированную на пациента литературу в клинике и предоставляем легкие для понимания материалы, которые можно использовать для последующего просмотра дома. Они могут быть особенно полезны для вовлечения пациентов в мониторинг их безопасности, а также соблюдения режима приема лекарств, что является сложной проблемой в эпоху удобных оральных методов лечения, мониторинг которых может быть затруднен.

Случайные исключительные реакции, наблюдаемые при терапии ICB, вызвали в клинике повышенный оптимизм пациентов, но это следует компенсировать значительной вероятностью последующего прогрессирования заболевания.Возможные исходы следует обсудить с пациентами с самого начала, поскольку лечение может стать сложным и потребовать творческого, глубокого управления, что иногда может расстраивать пациентов. Мотивация пациентов к оказанию помощи при раннем установлении реалистичных ожиданий также может иметь большое значение для раннего выявления побочных эффектов и содействия приверженности к лечению.

Обсуждение общих побочных эффектов и типичной стратегии лечения с пациентами — информирование их о том, что корректировка дозы, например, является обычным и может потребоваться — может быть полезным для обеспечения того, чтобы пациенты сообщали о симптомах по мере их развития, что позволяет раньше и более эффективное вмешательство.Это может позволить более длительные периоды времени на данном методе лечения и потенциально более длительный контроль болезни.

Несмотря на то, что в последнее время было одобрено множество препаратов для лечения рака почки, существует острая необходимость в определении новых терапевтических целей. Есть ли что-нибудь многообещающее на горизонте?

Лара и Тенолд: Один из них — ингибирование аденозина: аденозин — это иммуносупрессивная молекула, которая экспрессируется после ряда событий, следующих за клеточным повреждением и гипоксией — состояниями, которые, как известно, вносят вклад в биологию ПКР.Гены ADORA2A и NT5E оба высоко экспрессируются в ПКР и играют роль во внеклеточной продукции аденозина. Этот путь может быть вызван изменениями гена VHL , ведущими к высокой активности HIF1 и HIF2 , которые имитируют состояние гипоксии и обычно наблюдаются при ПКР.

Получающаяся в результате оболочка повышенного внеклеточного аденозина защищает раковые клетки от иммунной атаки за счет активации пуринергических рецепторов A2a и A2b.Обычно эти рецепторы защищают ткань от несоответствующей атаки иммунной системы, но этот путь используется раковыми клетками, чтобы избежать противоопухолевой иммунной атаки.

Новые агенты, которые ингибируют аденозин в микроокружении опухоли, в настоящее время разрабатываются как противоопухолевые методы лечения. Например, CPI-444 является ингибитором A2AR, который прерывает этот путь, и было показано, что он активен в качестве монотерапии или в комбинации с атезолизумабом. Через 6 месяцев контроль заболевания наблюдался у 50% пациентов, ранее не получавших ICB, и у 39% всей популяции исследования.

Также многообещающим является ингибирование HIF2: HIF обычно активируется в светлоклеточном ПКР в результате нарушения гена-супрессора опухоли Von Hippel Lindau ( VHL ). VHL Мутация или молчание активирует механизм ответа на гипоксию через неспособность расщепить белок HIF2a, который впоследствии способствует транскрипции генов, которые, среди прочего, облегчают ангиогенез, пролиферацию клеток и выживание клеток.

В настоящее время существуют ингибиторы HIF2, которые проходят клиническую разработку при ПКР.Например, PT2385 представляет собой пероральный биодоступный селективный ингибитор HIF2a, который был оценен в исследовании фазы I, где было обнаружено, что он хорошо переносится и приводит к стабильному заболеванию у 52% пациентов, частичному ответу у 12% и полному ответу ответ в 2%. Другой пероральный биодоступный ингибитор HIF2a, MK-6482, также проходит активную оценку, и в первом испытании фазы I / II на людях было показано, что он дает обнадеживающий ответ.

Прочтите исследование здесь и комментарии экспертов о клинических последствиях здесь.

Лара раскрыла финансовые отношения с CellMax Life, Janssen, Merck и Pfizer.

Компания Tenold сообщила об отсутствии конфликта интересов.

Официальный сайт Bioline International (сайт регулярно обновляется)

17726607
д.о.и 10.1177 / 175

17726607
Pubmed: 5588809
PMC: 28870089

Данне С., Рыжаков Г., Martinez-Lopez, M., Ilott, NE, Franchini, F., Cuskin, F., Lowe, EC, Bullers, SJ, Arthur, JSC и Powrie, F. (2017) Большой полисахарид, продуцируемый Helicobacter hepaticus, вызывает Сигнатура противовоспалительного гена в макрофагах. Клетка-хозяин и микроб. 22, 733-745 e735
d.o.i 10.1016 / j.chom.2017.11.002
Pubmed: 5734933
PMC: 2

40

Дарлинг, Н. Дж., Тот, Р., Артур, Дж. С. и Кларк, К. (2017) Ингибирование SIK2 и SIK3 во время дифференцировки усиливает противовоспалительный фенотип макрофагов.Биохимический журнал. 474, 521-537
д.о.и 10.1042 / BCJ20160646
PMC: 27

3

Даумас, С., Хантер, Си-Джей, Мистри, РБ, Мор, Л., Привитера, Л., Купер, Д.Д., Рейскенс, К.М., Флинн, Х.Т., Моррис, Р.Г., Артур, Д.С. и Френгуелли, Б.Г. (2017) Киназная функция MSK1 регулирует передачу сигналов BDNF для CREB и базальную синаптическую передачу, но не требуется для долговременной потенциации гиппокампа или пространственной памяти. eNeuro. 4d.o.i 10.1523 / ENEURO.0212-16.2017
Опубликован: 5318545
PMC: 28275711

Гжес, К.М., Свами, М., Хукельманн, Дж. Л., Эмсли, Э., Синклер, Л. В. и Кантрелл, Д. А. (2017) Контроль транспорта аминокислот координирует метаболическое перепрограммирование при злокачественных опухолях Т-клеток. Лейкемия. 31, 2771-2779
d.o.i 10.1038 / leu.2017.160
Pubmed: 5729345
PMC: 28546582

Харди, Д. Г. (2017) Использование сенсора энергии для лечения диабета. Наука. 357, 455-456
d.o.i 10.1126 / science.aao1913
PMC: 28774917

Харди, Д. Г. (2017) Онкогенная роль убиквитинлигазы UBE2O путем нацеливания на деградацию AMPK-alpha2.Раковая клетка. 31, 163-165
д.о.и 10.1016 / j.ccell.2017.01.010
PMC: 28196589

Hardie, D. G. и Lin, S. C. (2017) AMP-активированная протеинкиназа — не только датчик энергии. F1000 Исследования. 6, 1724
d.o.i 10.12688 / f1000research.11960.1
Pubmed: 5615778
PMC: 2

85

Хаякава, М., Хаякава, Х., Петрова, Т., Ритпраджак, П., Сутавани, Р.В., Хименес-Андраде, Г.Ю., Сано, Ю., Чу, М.К., Сивитт, Дж., Венигалла, Р.К., Оцу , К., Георгопулос, К., Артур, Дж.С. и Парк, Дж. М. (2017) Потеря функционально избыточных изоформ p38 в Т-клетках усиливает регуляторную индукцию Т-клеток. Журнал биологической химии. 292, 1762-1772
d.o.i 10.1074 / jbc.M116.764548
Pubmed: 52
PMC: 28011639

Heap, RE, Hope, AG, Pearson, LA, Reyskens, K., McElroy, SP, Hastie, CJ, Porter, DW, Arthur, JSC, Gray, DW and Trost, M. (2017) Идентификация ингибиторов воспаления: Новый высокопроизводительный скрининговый тест MALDI-TOF для солевых киназ (SIK).Открытие SLAS: продвижение исследований и разработок в области наук о жизни 22, 1193-1202
d.o.i 10.1177 / 2472555217717473
Pubmed: 5700774
PMC: 286

Хо, КМС, Чхабра, А., Старкл, П., Шнорр, П.Дж., Уилмс, С., Морага, И., Квон, Х.С., Гауденцио, Н., Сибилано, Р., Верман, Т.С., Гакович, М. ., Sockolosky, JT, Tiffany, MR, Ring, AM, Piehler, J., Weissman, IL, Galli, SJ, Shizuru, JA, и Garcia, KC (2017) Разделение функциональной плейотропии фактора стволовых клеток путем настройки c-Kit Сигнализация.Cell. 168, 1041-1052 e1018
d.o.i 10.1016 / j.cell.2017.02.011
Pubmed: 5526607
PMC: 28283060

Ким, А.Р., Улирш, Дж. К., Вилмс, С., Унал, Э., Морага, И., Каракукчу, М., Юань, Д., Казерунян, С., Абдулхай, Нью-Джерси, Кинг, Д.С., Гупта, Н. ., Габриэль, С.Б., Ландер, Е.С., Патироглу, Т., Озкан, А., Оздемир, М.А., Гарсия, К.С., Пилер, Дж., Газда, Х.Т., Кляйн, Д.Э. и Санкаран, В.Г. (2017) Функциональная селективность в Передача сигналов цитокинов через патогенную мутацию ЭПО.Cell. 168, 1053-1064 e1015
d.o.i 10.1016 / j.cell.2017.02.026
Pubmed: 5376096
PMC: 28283061

Кониси, Х., Кобаяси, М., Кунисава, Т., Имаи, К., Сайо, А., Малиссен, Б., Крокер, PR, Сато, К. и Кияма, Х. (2017) Siglec-H представляет собой специфический для микроглии маркер, который отличает микроглию от связанных с ЦНС макрофагов и моноцитов, инфильтрирующих ЦНС. Глия. 65, 1927-1943
д.о.и 10.1002 / glia.23204
PMC: 28836308

Лин, С. К. и Харди, Д. Г. (2017) AMPK: определение уровня глюкозы, а также состояния энергии клеток.Клеточный метаболизмd.o.i 10.1016 / j.cmet.2017.10.009
PMC: 2

08

Липина К. и Хундал Х. С. (2017) Эндоканнабиноидная система: «НЕТ» более анонимного в контроле нитрергической передачи сигналов? Журнал молекулярной клеточной биологии. 9, 91-103
d.o.i 10.1093 / jmcb / mjx008
Pubmed: 5439392
PMC: 28130308

Липина К. и Хундал Х. С. (2017) Липидная модуляция массы и функции скелетных мышц. Журнал кахексии, саркопении и мышц. 8, 190-201
д.о.и 10.1002 / jcsm.12144
Pubmed: 5377414
PMC: 27897400

Lopez-Mejia, IC, Lagarrigue, S., Giralt, A., Martinez-Carreres, L., Zanou, N., Denechaud, PD, Castillo-Armengol, J., Chavey, C., Orpinell, M., Делакуизин, Б., Насраллах, А., Коллодет, С., Чжан, Л., Виоллет, Б., Харди, Д.Г. и Фаджас, Л. (2017) CDK4 фосфорилирует AMPKalpha2, подавляя его активность и подавляя окисление жирных кислот. Молекулярная клетка. 68, 336-349 e336
d.o.i 10.1016 / j.molcel.2017.09.034
PMC: 2

Memórias do Instituto Oswaldo Cruz
Fundação Oswaldo Cruz, Fiocruz
ISSN: 1678-8060
Vol. 93, Чис. 2, 1998, стр.+ Автор, ответственный за переписку. Эл. Почта: [email protected]

Поступило 8 сентября 1997 г .; Принята к печати 8 января 1998 г.


Кодовый номер: OC98040
Размеры файлов:
Текст: 7.4K
Графика: Фотографии (jpg) — 10,1 КБ

Ключевые слова: герпесвирус — диагностика — ПЦР

ИССЛЕДОВАТЕЛЬСКАЯ ЗАПИСКА

Кожно-слизистые герпетические инфекции часто встречаются в различных клинических случаях.
состояния и могут быть представлены в виде пузырьков, язв, корок и пустул.Когда клинический диагноз не очевиден, как у хозяев с ослабленным иммунитетом, вирусная
культуры и мазки Цанка могут быть использованы для диагностики (GT Nahass et al.
1992 JAMA 268 : 2541-2544). У больных СПИДом появление
штаммы, устойчивые к ацикловиру, не редкость, и развитие
атипичные герпетические поражения могут привести к неверному диагнозу и
терапевтический (PA Chatis et al. 1989 N Engl J Med 320 :
297-300).

ПЦР использовалась как быстрый и специфический метод диагностики
некоторые вирусные инфекции, включая вирус герпеса.Несколько авторов показывают, что ПЦР
может использоваться для диагностики герпетических инфекций при различных
условиях и что он настолько эффективен или превосходит вирусные культуры и
мазки Цанка для установления и подтверждения диагноза герпетической
инфекции. Использовали образцы из тампонов, пузырьков, корок, архивных
ткани и вирусологические культуры (S Kido et al., 1991 J Clin
Microbiol
29 : 76-79, CA Thomas et al. 1994 Am J
Dermatopathol
16 : 268-274, Nahass et al.1992 loc. cit .,
1995 J Am Acad Dermatol 32: 730-733). Все эти авторы использовали
Этап экстракции ДНК с использованием органических реагентов в протоколе.

В попытке улучшить метод быстрой диагностики, основанный на анализе ПЦР для
кожно-слизистая герпетическая инфекция мы предложили анализ ПЦР без ДНК
извлечение из клинических образцов герпетических инфекций.

У девяти пациентов с кожно-слизистыми герпетическими поражениями они были вымыты.
стерильным физиологическим раствором и стерильным ватным тампоном натирали основание
язвы и погружены в минимальную необходимую среду Орла плюс
пенициллин, амикацин, амфотерицин B и 1% фетальная бычья сыворотка.R), буферы, праймеры (по 10 пМ, HSV1TK3
5’TCAGTTAGCCTCCCCCATC и HSV1TK5 5’ATGGCTTCGTACCCCTGCC или VZVTK3
5’AGGAAGTGTTGTCCTGAACGGC и VZVTK5 5’ATGTCAACGGATAAAACC GATGT), ДНК
шаблон и воду до конечного объема 20 мл. ПЦР-амплификация была
выполняется следующим образом: 35 циклов по 1 мин при 94 ° C, 55 ° C и 72 ° C и один
цикл 15 мин при 72 ° C для HSV. Для VZV температура отжига составила 57
C. Фрагмент ДНК размером 1130 п.н. или 1025 п.н. амплифицировали в соответствии с
Ген TK HSV-1 или VZV соответственно.Амплифицированный продукт был визуализирован
на 1% -ном агарозном геле, окрашенном бромистым этидием. Для подтверждения специфики
реакции проводили саузерн-блоттинг, гибридизацию и
условия стирки были выполнены согласно GM Church и W Gilbert (1984
Proc Natl Acad Sci USA 81 : 1991-1995). Фрагмент ДНК, содержащий
Ген HSV или VZV TK (HSVTK или VZVTK) был помечен компанией Nick Translation
Система »(PromegaA), описанная производителями.

Мы обследовали девять пациентов.В четырех образцах VZVTK был усилен. Эти
пациенты имели лицевой и глазной опоясывающий лишай (два случая), один ребенок с
ветряная оспа и взрослый с подавленным иммунитетом, страдающий опоясывающим лишаем. Без усилений с
В этих случаях были визуализированы праймеры HSV. В трех из этих случаев
Саузерн-блот подтвердил специфичность реакций. В одном случае
Саузерн-блоттинг не проводился. У пяти пациентов с инфекциями HSV
Анализ ПЦР был положительным. Образцы от двух пациентов с волдырями, одного ребенка
с рецидивирующим герпетическим кератитом, один ребенок с герпетическим кератитом и
блефарит и молодая женщина со стоматитом дали положительный результат ПЦР на ВПГ-1.При использовании праймеров VZVTK амплификации VZV не обнаружено. В
Саузерн-блоттинг был проведен в двух случаях и дал положительный результат в обоих.
Все контрольные реакции были выполнены.

Наши результаты без выделения ДНК согласуются с другими сообщениями
ПЦР-амплификация HSV-1 и VZV из клинических образцов, таких как Kido (1991).
loc. cit .), Thomas et al. (1994 loc. Cit .) И Nahass et al.
(1995 , место цит. .) Наши результаты также показывают, что анализ ПЦР без ДНК
экстракция имеет клиническое применение. Фенол-хлороформная экстракция — это
стандартный метод извлечения вирусной ДНК для анализа ПЦР. Наш подход показывает
преимущество во времени для проведения анализа ПЦР, может предотвратить ДНК от
загрязнение образцов руководством и не содержит органических реагентов, которые
может ингибировать анализ ПЦР.

Мы пришли к выводу, что анализ ПЦР без экстракции ДНК является хорошим методическим
инструмент для диагностики кожно-слизистых герпетических инфекций.Использование
мультиплексная ПЦР на HSV / VZV или общий праймер HSV / VZV, как описано JM Baron
и другие. (1996 J Med Virol 49 : 279-282) может улучшить наши
подход. Ген TK — наиболее частый локус мутаций в
устойчивые к ацикловиру штаммы VZV и HSV (G Boivin et al. 1994 J
Infect Dis
170 : 68-757, HJ Field & SE Goldthorpe 1992 Res
Вирол
143 : 120-124). Амплификация этого гена может дать
методический подход к определению штаммов, устойчивых к ацикловиру.

    Рисунок : ПЦР поражений двух пациентов с
    подозрение на ВПГ (пациент SC05, дорожки a-c) или VZV (пациент HC05, дорожки d-g)
    заражение проводилось специфическими праймерами HSVTK или VZVTK,
    соответственно. Продукты ПЦР фракционировали на 1% агарозном геле и
    окрашены бромистым этидием. Дорожка a клинический образец, полоса b положительная
    контроль и полоса с отрицательным контролем. Дорожка d, клинический образец, дорожка е
    положительный контроль, полосы f и g отрицательные контроли с праймерами VZVTK.Р). Стрелки указывают на амплифицированную ПЦР.
    продукт длиной 1130 и 1025 п.н., соответствующий генам HSVTK или VZVTK,
    соответственно.

Выражение признательности : докторам Жилберто Фрейтасу и Андерсону Кунья
(Clinica de Olhos, Santa Casa de Misericordia, Белу-Оризонти) и проф.
Ламбертуччи (Faculdade de Medicina, UFMG) за доступ к клиническим
образцы.

Частично поддерживается CNPq, CAPES и FAPEMIG. Авторы (MLN, PCPF, CAB
и EGK) являются стипендиатами CNPq.

Copyright 1998 Fundacao Oswaldo Cruz — Fiocruz


Доступны следующие изображения, относящиеся к этому документу:

Фото изображения

[oc98040a.jpg]

Cell Signaling and Immunology 2017

Abdul-Sada, H., Muller, M., Mehta, R., Toth, R., Arthur, JSC, Whitehouse, A. и Macdonald, A. (2017) The PP4R1 субъединица протеинфосфатазы PP4 важна для ингибирования NF-kappaB малым опухолевым антигеном полиомавируса Меркеля.Oncotarget. 8, 25418-25432
d.o.i 10.18632 / oncotarget.15836
Pubmed: 5421940
PMC: 28445980

Чой, Ю.С., Хорнинг, П., Атен, С., Карелина, К., Альзате-Корреа, Д., Артур, АО, Хойт, К.Р. и Обриетан, К. (2017) Митоген- и стресс-активированная протеинкиназа 1 Регулирует гибель клеток, вызванную эпилептическим статусом, в гиппокампе. ASN neuro. 9, 175

57

Мацциотти, Р., Baroncelli, L., Ceglia, N., Chelini, G., Sala, GD, Magnan, C., Napoli, D., Putignano, E., Silingardi, D., Tola, J., Tognini, P., Arthur, JSC, Baldi, P. и Pizzorusso, T. (2017) Мир-132/212 необходим для развития бинокулярного согласования предпочтений ориентации и восприятия глубины. Связь природы. 8, 15488
d.o.i 10.1038 / ncomms15488
Pubmed: 5457514
PMC: 28534484

МакЭван, Д. Г. (2017) Взаимодействие патогенов и хозяев и подрыв аутофагии. Очерки биохимии.61, 687-697
д.о.и 10.1042 / EBC20170058
PMC: 2

78

Макгуайр, В.А., Роснер, Д., Ананьева, О., Росс, Е.А., Элкомб, С.Е., Накви, С., ван ден Бош, М.М., Монк, С.Е., Руис-Зоррилла Диез, Т., Кларк, А.Р. и Arthur, JS (2017) Производство бета-интерферона регулируется протеинкиназой p38, активируемой митогеном, в макрофагах посредством как MSK1 / 2-, так и тристетрапролин-зависимых путей. Молекулярная и клеточная биология. 37d.o.i 10.1128 / MCB.00454-16
Опубликован: 51

PMC: 27795299

Мендоса, Дж.Л., Шнайдер, В. М., Хоффманн, Х. Х., Веркаутерен, К., Джуд, К. М., Сюн, А., Морага, И., Хортон, Т. М., Гленн, Дж. С., де Йонг, Ю. П., Райс, С. М. и Гарсия, К. К. (2017) Комплекс IFN-lambda-IFN-lambdaR1-IL-10Rbeta выявляет структурные особенности, лежащие в основе функциональной пластичности IFN типа III. Иммунитет. 46, 379-392
d.o.i 10.1016 / j.immuni.2017.02.017
Pubmed: 5510750
PMC: 28329704

Миллуорд, Д. Дж., Холлидей, Д., Хундал, Х., Тейлор, П., Атертон, П., Гринхафф, П. и Смит, К.(2017) Майкл Джон Ренни, магистр, доктор философии, FRSE, FHEA, 1946-2017: оценка его работы по метаболизму белков в мышцах человека. Американский журнал лечебного питания. 106, 1-9
д.о.и 10.3945 / ajcn.117.157818
PMC: 28566312

Moraga, I., Spangler, JB, Mendoza, JL, Gakovic, M., Wehrman, TS, Krutzik, P. и Garcia, KC (2017) Синтекины являются суррогатными агонистами цитокинов и факторов роста, которые вызывают передачу сигналов через неприродный рецептор. димеры. eLife. 6д.о.и 10.7554 / eLife.22882
Pubmed: 5429090
PMC: 28498099

Рена, Г., Харди, Д. Г. и Пирсон, Э. Р. (2017) Механизмы действия метформина. Диабетология. 60, 1577-1585
d.o.i 10.1007 / s00125-017-4342-z
Pubmed: 5552828
PMC: 28776086

Рихтер, Д., Морага, И., Винкельман, Х., Биркхольц, О., Вильмс, С., Шульте, М., Крайх, М., Кенневег, Х., Бейтель, О., Селенщик, П. , Патерок, Д., Гавутис, М., Шмидт, Т., Гарсия, К.С., Мюллер, Т.Д. и Пилер, Дж.(2017) Лиганд-индуцированные димеры рецептора интерлейкина-4 типа II поддерживаются быстрой реассоциацией в микрокомпартментах плазматической мембраны. Связь природы. 8, 15976
д.о.и 10.1038 / ncomms15976
Pubmed: 5519985
PMC: 28706306

Рогов, В.В., Штольц, А., Равичандран, А.С., Риос-Швед, Д.О., Сузуки, Х., Книсс, А., Лор, Ф., Вакацуки, С., Дотч, В., Дикич, И., Добсон, Р.К. и МакЭван, Д.Г. (2017) Структурный и функциональный анализ мотива взаимодействия GABARAP (GIM).EMBO сообщает. 18, 1382-1396
d.o.i 10.15252 / embr.201643587
Pubmed: 5538626
PMC: 28655748

Росс, Ф. А., Хоули, С. А., Аусиелло, Ф. Р., Гованс, Г. Дж., А., Атрих, А., Ламонт, Д. Дж. И Харди, Д. Г. (2017) Механизмы парадоксальной активации AMPK ингибиторами киназ SU6656 и Сорафенибом. Клеточная химическая биология. 24, 813-824 e814
d.o.i 10.1016 / j.chembiol.2017.05.021
Pubmed: 5522529
PMC: 28625738

Salt, I.P. и Hardie, D.G. (2017) AMP-Activated Protein Kinase: Unibiquitous signal pathway with key role in the сердечно-сосудистая система.Исследование кровообращения. 120, 1825-1841
д.о.и 10.1161 / CIRCRESAHA.117.309633
Pubmed: 5447810
PMC: 28546359

Salvador-Bernaldez, M., Mateus, SB, Del Barco Barrantes, I., Arthur, SC, Martinez, AC, Nebreda, AR и Salvador, JM (2017) p38alpha регулирует индуцированную цитокинами секрецию IFNgamma через путь Mnk1 / eIF4E в клетках Th2. Иммунология и клеточная биология. 95, 814-823
д.о.и 10.1038 / icb.2017.51 ​​
PMC: 28611474

Шинде, П. В., Сюй, Х. К., Maney, SK, Kloetgen, A., Namineni, S., Zhuang, Y., Honke, N., Shaabani, N., Bellora, N., Doerrenberg, M., Trilling, M., Pozdeev, VI, van Ройен, Н., Шой, С., Пфеффер, К., Крокер, П.Р., Танака, М., Дуггимпуди, С., Нолле, П., Хайкенвальдер, М., Руланд, Дж., Мак, Т.В., Бреннер, D., Pandyra, AA, Hoell, JI, Borkhardt, A., Haussinger, D., Lang, KS и Lang, PA (2017) TNF-опосредованная выживаемость клеток CD169 (+) способствует активации иммунной системы при инфицировании вирусом везикулярного стоматита. Журнал вирусологии.o.i 10.1128 / JVI.01637-17
PMC: 2

34

Стриксон, С., Эммерих, СН, Го, ETH, Чжан, Дж., Келсалл, И.Р., Макартни, Т., Хасти, С.Дж., Кнебель, А., Пегги, М., Марчези, Ф., Артур, АО и Cohen, P. (2017) Роль лигаз TRAF6 и Pellino E3 в передаче сигналов MyD88 и RANKL. Труды Национальной академии наук Соединенных Штатов Америки. 114, E3481-E3489
d.o.i 10.1073 / pnas.1702367114
Pubmed: 5410814
PMC: 28404732

Сутавани, Р.V., Phair, IR, Barker, R., McFarlane, A., Shpiro, N., Lang, S., Woodland, A. и Arthur, JSC (2017) Дифференциальная регуляция индуцированной TLR4 продукции IL-10 в В-клетках и макрофаги раскрывают новую роль RSK1 и 2 в В-клетках. Журнал биологической химии d.o.i 10.1074 / jbc.M117.805424
PMC: 2

81

Вара-Цируелос, Д., Дандапани, М., Грей, А., Эгбани, Э.О., Эванс, А.М. и Харди, Д.Г. (2017) Генотоксическое повреждение активирует изоформу AMPK-alpha1 в ядре через Са (2 +) / Передача сигналов CaMKK2 для увеличения выживаемости опухолевых клеток.Исследование молекулярного рака: MCRd.o.i 10.1158 / 1541-7786.MCR-17-0323
PMC: 2

90

Вада, М., Каналс, Д., Адада, М., Коант, Н., Салама, М. Ф., Хелке, К. Л., Артур, Дж. С., Шройер, К. Р., Китатани, К., Обейд, Л. М., и Ханнун, Ю. А. ( 2017) P38 delta MAPK способствует прогрессированию рака груди и метастазированию в легкие, усиливая пролиферацию и отслоение клеток. Онкоген. 36, 6649-6657
d.o.i 10.1038 / onc.2017.274
Pubmed: 5746050
PMC: 28783172

Ву, Г., Нагала, М.и Крокер П. Р. (2017) Идентификация лектиновых контррецепторов на клеточных мембранах с помощью метки близости. Гликобиология. 27, 800-805
d.o.i 10.1093 / glycob / cwx063
PMC: 28810661

Xu, Y., Gray, A., Hardie, DG, Uzun, A., Shaw, S., Padbury, J., Phornphutkul, C. и Tseng, YT (2017) Новая мутация de novo в PRKAG2 ген: инфантильный фенотип и задействованный сигнальный путь. Американский журнал физиологии. Физиология сердца и кровообращения. 313, h383-h392
г.o.i 10.1152 / ajpheart.00813.2016
Опубликован: 5582920
PMC: 28550180

Чжан, С.С., Хоули, С.А., Цзун, Ю., Ли, М., Ван, З., Грей, А., Ма, Т., Цуй, Дж., Фэн, Дж. В., Чжу, М., Ву, YQ, Li, TY, Ye, Z., Lin, SY, Yin, H., Piao, HL, Hardie, DG и Lin, SC (2017) Фруктозо-1,6-бисфосфат и альдолаза опосредуют определение глюкозы с помощью AMPK. Природа. 548, 112-116
д.о.и 10.1038 / nature23275
Pubmed: 5544942
PMC: 2872389

Повышение противоопухолевой эффективности с помощью комбинаторных схем онколитической виротерапии | Молекулярный рак

  • 1.

    Мартин Н.Т., Белл Дж. Комбинированная терапия онколитическим вирусом: убийство одной птицы двумя камнями. Mol Ther. 2018; 26 (6): 1414–22.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 2.

    Ле Бёф Ф., Гебремескель С., МакМюллен Н., Хе Х., Гриншилдс А.Л., Хоскин Д.В. и др. Белок FAST реовируса усиливает онколитическую виротерапию вируса везикулярного стоматита на моделях первичных и метастатических опухолей. Мол Онколитики. 2017; 6: 80–9.

    Google ученый

  • 3.

    Моррис Дж. К., Уайлднер О. Терапия плоскоклеточного рака головы и шеи онколитическим аденовирусом, экспрессирующим HSV-tk. Mol Ther. 2000. 1 (1): 56–62.

    CAS
    PubMed

    Google ученый

  • 4.

    Zhang Q, Yu YA, Wang E, Chen N, Dannel RL, Munson PJ, et al. Ликвидация солидных опухолей молочной железы человека у голых мышей с помощью внутривенного введения светоизлучающего онколитического вируса коровьей оспы. Cancer Res. 2007. 67 (20): 10038–46.

    CAS
    PubMed

    Google ученый

  • 5.

    Amagai Y, Fujiyuki T., Yoneda M, Shoji K, Furukawa Y, Sato H и др. Онколитическая активность рекомбинантного вируса кори, слепого к сигнальной молекуле активации лимфоцитов, против клеток колоректального рака. Научный доклад 2016; 6: 24572.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 6.

    Andtbacka RHI, Kaufman HL, Collichio F, Amatruda T, Senzer N, Chesney J, et al. Талимоген Лахерпарепвек улучшает стойкость ответа у пациентов с запущенной меланомой.J Clin Oncol. 2015; 33 (25): 2780 – U98.

    CAS
    PubMed

    Google ученый

  • 7.

    Bommareddy PK, Shettigar M, Kaufman HL. Интеграция онколитических вирусов в комбинированную иммунотерапию рака. Nat Rev Immunol. 2018; 18 (8): 498–513.

    CAS
    PubMed

    Google ученый

  • 8.

    Маземанн Д., Бургелинг Ю., Людвиг С. Использование РНК-вирусов для борьбы с раком: новое понимание онколитической виротерапии.Biol Chem. 2017; 398 (8): 891–909.

    CAS
    PubMed

    Google ученый

  • 9.

    Felix J, Savvides SN. Механизмы иммуномодуляции с помощью рецепторов-приманок млекопитающих и вирусов: понимание структур. Nat Rev Immunol. 2017; 17 (2): 112–29.

    CAS
    PubMed

    Google ученый

  • 10.

    Kaufman HL, Kohlhapp FJ, Zloza A. Онколитические вирусы: новый класс иммунотерапевтических препаратов.Nat Rev Drug Discov. 2016; 15 (9): 660.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 11.

    Кирн Д., Мартуза Р.Л., Цвибель Дж. Репликационно-селективная виротерапия рака: биологические принципы, управление рисками и будущие направления. Nat Med. 2001. 7 (7): 781–7.

    CAS
    PubMed

    Google ученый

  • 12.

    Ханахан Д., Вайнберг, РА. Признаки рака: следующее поколение.Cell. 2011; 144 (5): 646–74.

    CAS
    PubMed

    Google ученый

  • 13.

    Ся Т., Конно Х., Ан Дж., Барбер Г.Н. Нарушение регуляции передачи сигналов при колоректальной карциноме ограничивает ответы на повреждение ДНК и коррелирует с онкогенезом. Cell Rep. 2016; 14 (2): 282–97.

    CAS
    PubMed

    Google ученый

  • 14.

    Lichty BD, Breitbach CJ, Stojdl DF, Bell JC. Распространение вируса с иммунотерапией рака.Nat Rev Рак. 2014. 14 (8): 559–67.

    CAS
    PubMed

    Google ученый

  • 15.

    Коффи М.С., Стронг Дж.Э., Форсайт, Пенсильвания, Ли П.В.К. Реовирусная терапия опухолей с активированным Ras-путем. Наука. 1998. 282 (5392): 1332–4.

    CAS
    PubMed

    Google ученый

  • 16.

    Стронг Дж.Э., Коффи М.С., Тан Д., Сабинин П., Ли Пак. Молекулярная основа вирусного онколиза: узурпация пути передачи сигналов Ras реовирусом.EMBO J. 1998; 17 (12): 3351–62.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 17.

    Dorig RE, Marcil A, Chopra A, Richardson CD. Молекула CD46 человека является рецептором вируса кори (штамм Эдмонстон). Cell. 1993. 75 (2): 295–305.

    CAS
    PubMed

    Google ученый

  • 18.

    Андерсон Б.Д., Накамура Т., Рассел С.Дж., Пэн К.В. Высокая плотность рецепторов CD46 определяет преимущественное уничтожение опухолевых клеток онколитическим вирусом кори.Cancer Res. 2004. 64 (14): 4919–26.

    CAS
    PubMed

    Google ученый

  • 19.

    Терстеген Л., Гациос П., Людвиг С., Плешка С., Янен-Дехент В., Генрих П.С. и др. Матричный белок вируса везикулярного стоматита ингибирует гликопротеин-130-зависимую активацию STAT. J Immunol. 2001. 167 (9): 5209–16.

    CAS
    PubMed

    Google ученый

  • 20.

    Ахмед М., Маккензи МО, Пакетт С., Хойнаки М., Поликвин Л., Лайлс Д.С.Способность матричного белка вируса везикулярного стоматита подавлять экспрессию гена бета-интерферона генетически коррелирует с ингибированием РНК хозяина и синтеза белка. J Virol. 2003. 77 (8): 4646–57.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 21.

    Stojdl DF, Lichty BD, tenOever BR, Paterson JM, Power AT, Knowles S и др. Штаммы VSV с дефектами их способности отключать врожденный иммунитет являются мощными системными противораковыми средствами.Раковая клетка. 2003. 4 (4): 263–75.

    CAS
    PubMed

    Google ученый

  • 22.

    Mulvey M, Poppers J, Sternberg D, Mohr I. Регулирование фосфорилирования eIF2 альфа во время дискретных фаз в герпесе с помощью различных функций, которые действуют в жизненном цикле симплекс-вируса типа 1. J Virol. 2003. 77 (20): 10917–28.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 23.

    Фридман Г.К., Нэн Л., Хаас М.К., Келли В.М., Мур Б.П., Лангфорд С.П. и др.γ 1 34,5-делетированный HSV-1-экспрессирующий ген IRS1 человеческого цитомегаловируса убивает клетки глиобластомы человека так же эффективно, как HSV-1 дикого типа при нормоксии или гипоксии. Gene Ther. 2015; 22 (4): 348–55.

    CAS
    PubMed

    Google ученый

  • 24.

    Канаи Р., Заупа С., Сгубин Д., Антощик С.Дж., Мартуза Р.Л., Вакимото Х. и др. Влияние делеций гамма 34,5 на активность онколитического вируса простого герпеса в опухолях головного мозга. J Virol. 2012. 86 (8): 4420–31.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 25.

    Минета Т., Рабкин С.Д., Язаки Т., Хантер В.Д., Мартуза Р.Л. Аттенуированный мультимутантный вирус простого герпеса-1 для лечения злокачественных глиом. Nat Med. 1995; 1 ​​(9): 938–43.

    CAS
    PubMed

    Google ученый

  • 26.

    Heise C, Hermiston T, Johnson L, Brooks G, Sampson-Johannes A, Williams A, et al.Мутант аденовируса E1A, демонстрирующий сильную и избирательную системную противоопухолевую эффективность. Nat Med. 2000. 6 (10): 1134–9.

    CAS
    PubMed

    Google ученый

  • 27.

    Bischoff JR, Kim DH, Williams A, Heise C, Horn S, Muna M и др. Мутант аденовируса, который избирательно реплицируется в опухолевых клетках человека с дефицитом р53. Наука. 1996. 274 (5286): 373–6.

    CAS
    PubMed

    Google ученый

  • 28.

    Кирн Д. Результаты клинических исследований dl1520 (Onyx-015), репликационно-селективного аденовируса для лечения рака: что мы узнали? Gene Ther. 2001. 8 (2): 89–98.

    CAS
    PubMed

    Google ученый

  • 29.

    Uchida H, Marzulli M, Nakano K, Coins WF, Chan J, Hong C-S и др. Эффективное лечение ортотопической модели ксенотрансплантата глиобластомы человека с использованием онколитического вируса простого герпеса с ретаргетингом на EGFR. Mol Ther.2013; 21 (3): 561–9.

    CAS
    PubMed

    Google ученый

  • 30.

    Nemunaitis J, Tong AW, Nemunaitis M, Senzer N, Phadke AP, Bedell C, et al. Фаза I исследования теломеразоспецифичного репликационного онколитического аденовируса (теломелизина) для различных солидных опухолей. Mol Ther. 2010. 18 (2): 429–34.

    CAS
    PubMed
    Статья

    Google ученый

  • 31.

    Кавасима Т., Кагава С., Кобаяси Н., Сиракия Ю., Умэока Т., Тераиси Ф. и др.Теломеразно-специфическая репликационно-селективная виротерапия рака человека. Clin Cancer Res. 2004. 10 (1): 285–92.

    CAS
    PubMed
    Статья

    Google ученый

  • 32.

    Kambara H, Okano H, Chiocca EA, Saeki Y. Онколитический мутант HSV-1, экспрессирующий ICP34.5 под контролем промотора нестина, увеличивает выживаемость животных даже при наличии симптомов опухоли мозга. Cancer Res. 2005. 65 (7): 2832–9.

    CAS
    PubMed
    Статья

    Google ученый

  • 33.

    Guedan S, Jose Rojas J, Gros A, Mercade E, Cascallo M, Alemany R. Экспрессия гиалуронидазы онколитическим аденовирусом увеличивает его внутриопухолевое распространение и подавляет рост опухоли. Mol Ther. 2010. 18 (7): 1275–83.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 34.

    Sasso E, Froechlich G, Cotugno G, D’Alise AM, Gentile C, Bignone V и др. Репликативное кондиционирование вируса простого герпеса типа 1 промотором сурвивина в сочетании с перенацеливанием ERBB2 улучшает ограниченный опухолевыми клетками онколиз.Научный доклад 2020; 10 (1): 4307.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 35.

    Кан Й.А., Шин Х.С., Ю Дж.Й., Ким Дж.Х., Ким Дж.С., Юн Си. Новая антиангиотерапия рака с использованием искусственного белка цинковых пальцев, нацеленного на промотор VEGF, и онколитического аденовируса. Mol Ther. 2008. 16 (6): 1033–40.

    CAS
    PubMed
    Статья

    Google ученый

  • 36.

    Канерва А., Зинн К.Р., Чаудхури Т.Р., Лам Дж. Т., Сузуки К., Уил Т. Г. и др. Повышенная терапевтическая эффективность рака яичников с помощью онколитического аденовируса, нацеленного на рецептор серотипа 3. Mol Ther. 2003. 8 (3): 449–58.

    CAS
    PubMed
    Статья

    Google ученый

  • 37.

    Galluzzi L, Buque A, Kepp O, Zitvogel L, Kroemer G. Иммуногенная смерть клеток при раке и инфекционных заболеваниях. Nat Rev Immunol. 2017; 17 (2): 97–111.

    CAS
    PubMed
    Статья

    Google ученый

  • 38.

    Лю П., Чжао Л., Поль Дж., Левеск С., Петраццуоло А., Пфиршке С. и др. Кризотиниб-индуцированная гибель иммуногенных клеток при немелкоклеточном раке легкого. Nat Commun. 2019; 10: 1486.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 39.

    Demaria S, Golden EB, Formenti SC. Роль местной лучевой терапии в иммунотерапии рака. JAMA Онкология. 2015; 1 (9): 1325–32.

    PubMed
    Статья

    Google ученый

  • 40.

    Koks CA, Garg AD, Ehrhardt M, Riva M, Vandenberk L, Boon L, et al. Виротерапия при болезни Ньюкасла способствует долгосрочному выживанию и опухолеспецифической иммунной памяти при ортотопической глиоме за счет индукции гибели иммуногенных клеток. Int J Cancer. 2015; 136 (5): E313 – E25.

    CAS
    PubMed
    Статья

    Google ученый

  • 41.

    Доннелли О.Г., Эррингтон-Мэйс Ф., Стил Л., Хадак Е., Дженнингс В., Скотт К. и др. Вирус кори вызывает гибель иммуногенных клеток меланомы человека.Gene Ther. 2013; 20 (1): 7–15.

    CAS
    PubMed
    Статья

    Google ученый

  • 42.

    Миямото С., Иноуэ Х., Накамура Т., Ямада М., Сакамото С., Урата Ю. и др. Вирус Коксаки B3 — онколитический вирус с иммуностимулирующими свойствами, активный против аденокарциномы легких. Cancer Res. 2012. 72 (10): 2609–21.

    CAS
    PubMed
    Статья

    Google ученый

  • 43.

    Iurescia S, Fioretti D, Rinaldi M. Нацеливание на цитозольные пути определения нуклеиновых кислот для иммунотерапии рака. Фронт Иммунол. 2018; 9: 711.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 44.

    Woo S-R, Fuertes MB, Corrales L, Spranger S, Furdyna MJ, Leung MYK и др. STING-зависимое цитозольное распознавание ДНК опосредует распознавание иммуногенными опухолями врожденным иммунитетом. Иммунитет. 2014; 41 (5): 830–42.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 45.

    Дай П., Ван В., Ян Н., Серна-Тамайо С., Рикка Дж. М., Замарин Д. и др. Внутриопухолевая доставка инактивированного модифицированного вируса осповакцины Анкара (iMVA) индуцирует системный противоопухолевый иммунитет через STING и Batf3-зависимые дендритные клетки. Sci Immunol. 2017; 2 (11): eaal1713.

    PubMed
    PubMed Central
    Статья

    Google ученый

  • 46.

    de Queiroz NMGP, Xia T, Konno H, Barber GN. Клетки рака яичников обычно демонстрируют дефектную передачу сигналов STING, что влияет на чувствительность к вирусному онколизу.Mol Cancer Res. 2019; 17 (4): 974–86.

    PubMed
    Статья

    Google ученый

  • 47.

    Guillerme JB, Boisgerault N, Roulois D, Ménager J, Combredet C, Tangy F, et al. Опухолевые клетки, инфицированные вакциной против кори, индуцируют перекрестную презентацию опухолевого антигена плазматическими дендритными клетками человека. Clin Cancer Res. 2013. 19 (5): 1147–58.

    CAS
    PubMed
    Статья

    Google ученый

  • 48.

    Катаяма Й, Татибана М., Курису Н., Оя Й, Терасава Й, Года Х и др. Онколитический реовирус ингибирует иммуносупрессивную активность миелоидных клеток-супрессоров TLR3-зависимым образом. J Immunol. 2018; 200 (8): 2987–99.

    CAS
    PubMed
    Статья

    Google ученый

  • 49.

    Benencia F, Courreges MC, Fraser NW, Coukos G. Онколитическая терапия вирусом герпеса обращает вспять иммунную дисфункцию опухоли и способствует презентации опухолевого антигена.Cancer Biol Ther. 2008. 7 (8): 1194–205.

    CAS
    PubMed
    Статья

    Google ученый

  • 50.

    Gujar SA, Marcato P, Pan D, Lee PWK. Реовирусная виротерапия преодолевает уклонение от презентации опухолевого антигена и способствует защитному противоопухолевому иммунитету. Mol Cancer Ther. 2010. 9 (11): 2924–33.

    CAS
    PubMed
    Статья

    Google ученый

  • 51.

    Gujar S, Dielschneider R, Clements D., Helson E, Shmulevitz M, Marcato P, et al.Многогранное терапевтическое воздействие на перитонеальный карциноматоз яичников посредством иммуномодуляции, индуцированной вирусом. Mol Ther. 2013. 21 (2): 338–47.

    CAS
    PubMed
    Статья

    Google ученый

  • 52.

    Gasteiger G, Kastenmuller W., Ljapoci R, Sutter G, Drexler I. Перекрестный прайминг цитотоксических Т-клеток диктует антигенные требования для модифицированных векторных вакцин против вируса осповакцины. J Virol. 2007. 81 (21): 11925–36.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 53.

    Twumasi-Boateng K, Pettigrew JL, Kwok YYE, Bell JC, Nelson BH. Онколитические вирусы как инженерные платформы для комбинированной иммунотерапии. Nat Rev Рак. 2018; 18 (7): 419–32.

    CAS
    PubMed
    Статья

    Google ученый

  • 54.

    Schietinger A, Philip M, Liu RB, Schreiber K, Schreiber H. Для уничтожения рака очевидцем требуется взаимодействие CD4 (+) и CD8 (+) Т-клеток во время эффекторной фазы. J Exp Med. 2010. 207 (11): 2469–77.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 55.

    Цай В., Джонсон Д.Е., Рахман А., Вен С.Ф., Лафас Д., Филопена Дж. И др. Влияние нейтрализующих антител человека на противоопухолевую эффективность онколитического аденовируса на мышиной модели. Clin Cancer Res. 2004. 10 (21): 7199–206.

    CAS
    PubMed
    Статья

    Google ученый

  • 56.

    Стетсон Д.Б., Меджитов Р.Интерфероны типа I в защите хозяина. Иммунитет. 2006. 25 (3): 373–81.

    CAS
    PubMed
    Статья

    Google ученый

  • 57.

    Jain RK, Tong RT, Munn LL. Влияние нормализации сосудов с помощью антиангиогенной терапии на интерстициальную гипертензию, отек перитуморали и лимфатические метастазы: выводы из математической модели. Cancer Res. 2007. 67 (6): 2729–35.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 58.

    Макки Т.Д., Гранди П., Мок В., Александракис Г., Инсин Н., Циммер Дж. П. и др. Разложение фибриллярного коллагена в ксенотрансплантате меланомы человека повышает эффективность вектора онколитического вируса простого герпеса. Cancer Res. 2006. 66 (5): 2509–13.

    CAS
    PubMed
    Статья

    Google ученый

  • 59.

    Mok W., Boucher Y, Jain RK. Матричные металлопротеиназы-1 и -8 улучшают распространение и эффективность онколитического вируса. Cancer Res.2007. 67 (22): 10664–8.

    CAS
    PubMed
    Статья

    Google ученый

  • 60.

    Ganesh S, Gonzalez-Edick M, Gibbons D, Van Roey M, Jooss K. Совместное внутриопухолевое введение фермента гиалуронидазы и онколитических аденовирусов увеличивает эффективность вируса в моделях метастатических опухолей. Clin Cancer Res. 2008. 14 (12): 3933–41.

    CAS
    PubMed
    Статья

    Google ученый

  • 61.

    ЛеБлан А.К., Наик С., Галион Г.Д., Дженкс Н., Стил М., Пэн К.В. и др. Исследования безопасности внутривенного введения онколитического рекомбинантного вируса везикулярного стоматита у специально выведенных собак породы гончая. Hum Gene Ther Clin Dev. 2013. 24 (4): 174–81.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 62.

    Кулу Й., Дорфман Дж. Д., Куруппу Д., Фукс BC, Гудвин Дж. М., Фуджи Т. и др. Сравнение внутривенного и внутрибрюшинного введения онколитического вируса простого герпеса 1 для лечения перитонеального карциноматоза у мышей.Cancer Gene Ther. 2009. 16 (4): 291–7.

    CAS
    PubMed
    Статья

    Google ученый

  • 63.

    Габрилович Д.И., Нагарадж С. Миелоидные клетки-супрессоры как регуляторы иммунной системы. Nat Rev Immunol. 2009. 9 (3): 162–74.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 64.

    Ной Р., Поллард Дж. У. Макрофаги, связанные с опухолями: от механизмов к терапии.Иммунитет. 2014. 41 (1): 49–61.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 65.

    McGray AJR, Huang R-Y, Battaglia S, Eppolito C, Miliotto A, Stephenson KB, et al. Онколитический вирус Мараба, вооруженный опухолевым антигеном, усиливает прайминг вакцины и выявляет различные паттерны терапевтического ответа в сочетании с блокадой контрольных точек при раке яичников. J Immunother Cancer. 2019; 7 (1): 189.

    PubMed
    PubMed Central
    Статья

    Google ученый

  • 66.

    Woller N, Guerlevik E, Fleischmann-Mundt B, Schumacher A, Knocke S, Kloos AM, et al. Вирусная инфекция опухолей преодолевает устойчивость к PD-1-иммунотерапии за счет расширения неоантигеномно-направленных ответов Т-клеток. Mol Ther. 2015; 23 (10): 1630–40.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 67.

    Самсон А., Скотт К.Дж., Таггарт Д., Уэст Е.Дж., Уилсон Е., Нуово Г.Дж. и др. Внутривенная доставка онколитического реовируса пациентам с опухолью головного мозга иммунологически готовит к последующей блокаде контрольных точек.Sci Transl Med. 2018; 10 (422): eaam7577.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 68.

    Spranger S, Spaapen RM, Zha Y, Williams J, Meng Y, Ha TT, et al. Повышающая регуляция PD-L1, IDO и T-reg в микроокружении меланомной опухоли управляется CD8 (+) Т-клетками. Sci Transl Med. 2013; 5 (200): 200ра116.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 69.

    Замарин Д., Рикка Дж. М., Садекова С., Оселедчик А., Ю. Ю., Блюменшейн В. М. и др. PD-L1 в микроокружении опухоли опосредует устойчивость к онколитической иммунотерапии. J Clin исследования. 2018; 128 (4): 1413–28.

    PubMed
    Статья

    Google ученый

  • 70.

    Роулстон В., Твиггер К., Заиди С., Пенкавел Т., Кюла Дж. Н., Уайт С. и др. Синергетическая цитотоксичность онколитического реовируса в сочетании с химиотерапией дублетом цисплатин-паклитаксел.Gene Ther. 2013; 20 (5): 521–8.

    CAS
    PubMed

    Google ученый

  • 71.

    Jung KH, Choi I-K, Lee H-S, Yan HH, Son MK, Ahn HM, et al. Онколитический аденовирус, экспрессирующий релаксин (YDC002), повышает терапевтическую эффективность гемцитабина против рака поджелудочной железы. Cancer Lett. 2017; 396: 155–66.

    CAS
    PubMed

    Google ученый

  • 72.

    Habiba U, Hossain E, Yanagawa-Matsuda A, Chowdhury AFMA, Tsuda M, Zaman A-U, et al.Цисплатин перемещает РНК-связывающий белок HuR и усиливает онколитическую активность аденовируса с делецией E4orf6. Раки. 2020; 12 (4): 809.

    PubMed Central
    PubMed

    Google ученый

  • 73.

    Gomez-Gutierrez JG, Nitz J, Sharma R, Wechman SL, Riedinger E, Martinez-Jaramillo E, et al. Комбинированная терапия онколитическим аденовирусом и темозоломидом усиливает виротерапию рака легких in vitro и in vivo. Вирусология. 2016; 487: 249–59.

    CAS
    PubMed

    Google ученый

  • 74.

    Workenhe ST, Pol JG, Lichty BD, Cummings DT, Mossman KL. Комбинация онколитического вируса простого герпеса-1 с иммуногенным препаратом, вызывающим гибель клеток, митоксантроном нарушает иммунную толерантность к раку и улучшает терапевтическую эффективность. Cancer Immunol Res. 2013; 1 (5): 309–19.

    CAS
    PubMed

    Google ученый

  • 75.

    Карапанайоту Э.М., Роулстон В., Твиггер К., Болл М., Танай М., Наттинг С. и др. Фаза I / II испытания химиотерапии карбоплатином и паклитакселом в сочетании с внутривенным онколитическим реовирусом у пациентов с запущенными злокачественными новообразованиями.Clin Cancer Res. 2012; 18 (7): 2080–209.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 76.

    Ли Дж.К., Шин Д.В., Пак Х, Ким Дж., Юн И, Ким Дж. Х и др. Переносимость и безопасность аденовирусной генной терапии двойного самоубийства с введением EUS и химиотерапией при местнораспространенном раке поджелудочной железы: испытание фазы I. Gastrointest Endosc. 2020. в печати, https://doi.org/10.1016/j.gie.2020.02.012.

  • 77.

    Goel A, Carlson SK, Classic KL, Greiner S, Naik S, Power AT и др.Радиойодидная визуализация и радиовиротерапия множественной миеломы с использованием VSV (Delta 51) -NIS, аттенуированного вируса везикулярного стоматита, кодирующего ген симпортера йодида натрия. Кровь. 2007. 110 (7): 2342–50.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 78.

    Opyrchal M, Allen C, Iankov I., Aderca I, Schroeder M, Sarkaria J, et al. Эффективная радиовиротерапия злокачественных глиом с использованием штаммов онколитического вируса кори, кодирующего симпортер йодида натрия (MV-NIS).Hum Gene Ther. 2012. 23 (4): 419–27.

    CAS
    PubMed
    Статья

    Google ученый

  • 79.

    Ли Х, Накашима Х, Деклевер Т.Д., Нейс Р.А., Рассел С.Дж. HSV-NIS, онколитический вирус простого герпеса типа 1, кодирующий симпортер йодида натрия человека для доклинической радиовиротерапии рака простаты. Cancer Gene Ther. 2013. 20 (8): 478–85.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 80.

    Галанис Э., Атертон П.Дж., Маурер М.Дж., Кнутсон К.Л., Дауди С.К., Клиби В.А. и др. Онколитический вирус кори, экспрессирующий симпортер йодида натрия, для лечения лекарственно-устойчивого рака яичников. Cancer Res. 2015; 75 (1): 22–30.

    CAS
    PubMed

    Google ученый

  • 81.

    Mansfield DC, Kyula JN, Rosenfelder N, Chao-Chu J, Kramer-Marek G, Khan AA, et al. Вирус онколитической осповакцины как вектор терапевтической генной терапии симпортерного йодида натрия при раке простаты.Gene Ther. 2016; 23 (4): 357–68.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 82.

    Vijayakumar G, Palese P, Goff PH. Вирус онколитической болезни Ньюкасла, экспрессирующий ингибитор контрольной точки в качестве радиоактивного агента при меланоме мышей. Эбиомедицина. 2019; 49: 96–105.

    PubMed
    PubMed Central

    Google ученый

  • 83.

    Adusumilli PS, Stiles BM, Chan MK, Chou TC, Wong RJ, Rusch VW и др.Лучевая терапия потенцирует эффективную онколитическую вирусную терапию при лечении рака легких. Ann Thorac Surg. 2005. 80 (2): 409–17.

    PubMed
    PubMed Central

    Google ученый

  • 84.

    Hart LS, Yannone SM, Naczki C, Orlando JS, Waters SB, Akman SA, et al. Белок аденовируса E4orf6 ингибирует репарацию двухцепочечных разрывов ДНК и радиосенсибилизирует опухолевые клетки человека E1B-55K-независимым образом. J Biol Chem. 2005. 280 (2): 1474–81.

    CAS
    PubMed

    Google ученый

  • 85.

    Мелл Л.К., Брумунд К.Т., Дэниэлс Г.А., Адвани С.Дж., Закери К., Райт М.Э. и др. Испытание фазы i внутривенного онколитического вируса осповакцины (GL-ONC1) с цисплатином и лучевой терапии у пациентов с местно-регионарной карциномой головы и шеи. Clin Cancer Res. 2017; 23 (19): 5696–702.

    CAS
    PubMed

    Google ученый

  • 86.

    Ямамура К., Касуя Х., Сахин Т.Т., Тан Дж., Хотта Й., Цурумару Н. и др. Комбинированное лечение моделей ксенотрансплантатов рака поджелудочной железы человека с ингибитором тирозинкиназы рецептора эпидермального фактора роста эрлотинибом и онколитическим вирусом простого герпеса HF10. Энн Сург Онкол. 2014; 21 (2): 691–8.

    PubMed

    Google ученый

  • 87.

    Wu Z, Ichinose T, Naoe Y, Matsumura S., Villalobos IB, Eissa IR, et al. Комбинация цетуксимаба и онколитического вируса канерпатуры синергетически подавляет рост колоректального рака человека.Мол тер онколитики. 2019; 13: 107–15.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 88.

    Джексон Дж. Д., Маркерт Дж. М., Ли Л., Кэрролл С. Л., Кэссиди К. А.. Ингибиторы STAT1 и NF-каппа B снижают базальную экспрессию генов, стимулированную интерфероном, и улучшают продуктивную инфекцию онколитического HSV в клетках MPNST. Mol Cancer Res. 2016; 14 (5): 482–92.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 89.

    Ghonime MG, Кэссиди К.А. Комбинированная терапия с использованием руксолитиниба и онколитического HSV делает устойчивые MPNST чувствительными к виротерапии. Cancer Immunol Res. 2018; 6 (12): 1499–510.

    CAS
    PubMed

    Google ученый

  • 90.

    Marozin S, Altomonte J, Muñoz-Álvarez KA, Rizzani A, De Toni EN, Thasler WE, et al. Ингибирование STAT3 снижает токсичность онколитического VSV и обеспечивает потенциально синергетическую комбинированную терапию гепатоцеллюлярной карциномы.Cancer Gene Ther. 2015; 22 (6): 317–25.

    CAS
    PubMed

    Google ученый

  • 91.

    Роулстон В., Педерсен М., Кюла Дж., Мэнсфилд Д., Хан А.А., МакЭнти Дж. И др. Нацеленные на BRAF и MEK низкомолекулярные ингибиторы проявляют усиленный антимеланомный эффект в сочетании с онколитическим реовирусом через ER стресс. Mol Ther. 2015; 23 (5): 931–42.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 92.

    Голами С., Чен С.Х., Гао С., Лу Е., Фудзисава С., Карсон Дж. И др. Роль MAPK в терапии онколитических вирусов герпеса при тройном отрицательном раке молочной железы. Cancer Gene Ther. 2014; 21 (7): 283–9.

    CAS
    PubMed

    Google ученый

  • 93.

    Beug ST, Tang VA, LaCasse EC, Cheung HH, Beauregard CE, Brun J, et al. Миметики Smac и стимулы врожденного иммунитета взаимодействуют, способствуя смерти опухоли. Nat Biotechnol. 2014; 32 (2): 182.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 94.

    Ким Д.С., Дастидар Х., Чжан С., Цемп Ф.Дж., Лау К., Эрнст М. и др. Миметики Smac и онколитические вирусы действуют синергично, управляя противоопухолевыми Т-клеточными ответами посредством дополнительных механизмов. Nat Commun. 2017; 8 (1): 344.

    PubMed
    PubMed Central

    Google ученый

  • 95.

    Лун Х, Ален Т., Земп Ф.Дж., Чжоу Х., Рахман М.М., Гамильтон М.Г. и др. Виротерапия вирусом миксомы для глиомы на моделях иммунокомпетентных животных: оптимизация путей введения и синергия с рапамицином.Cancer Res. 2010. 70 (2): 598–608.

    CAS
    PubMed

    Google ученый

  • 96.

    Igase M, Shibutani S, Kurogouchi Y, Fujiki N, Hwang CC, Coffey M, et al. Комбинированная терапия реовирусом и ингибитором ATM увеличивает гибель клеток и репликацию вируса при меланоме собак. Мол тер онколитики. 2019; 15: 49–59.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 97.

    Джон Л. Б., Хоуленд Л. Дж., Флинн Дж. К., Западный АС, Дево С., Дуонг С. П. и др. Комбинированная терапия онколитического вируса и анти-4-1BB вызывает сильный противоопухолевый иммунитет против установленного рака. Cancer Res. 2012. 72 (7): 1651–60.

    CAS
    PubMed

    Google ученый

  • 98.

    Роберт С., Лонг Г.В., Брэди Б., Дютрио С., Майо М., Мортье Л. и др. Ниволумаб при ранее нелеченой меланоме без мутации BRAF. N Engl J Med. 2015; 372 (4): 320–30.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 99.

    Brahmer J, Reckamp KL, Baas P, Crino L, Eberhardt WEE, Poddubskaya E, et al. Ниволумаб по сравнению с доцетакселом при запущенном плоскоклеточном немелкоклеточном раке легкого. N Engl J Med. 2015; 373 (2): 123–35.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 100.

    Motzer RJ, Escudier B, McDermott DF, George S, Hammers HJ, Srinivas S, et al.Ниволумаб в сравнении с эверолимусом при запущенной почечно-клеточной карциноме. N Engl J Med. 2015; 373 (19): 1803–13.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 101.

    Bjoern J, Nitschke NJ, Iversen TZ, Schmidt H, Fode K, Svane IM. Иммунологические корреляты лечения и ответа у пациентов со злокачественной меланомой IV стадии, получавших ипилимумаб. Онкоиммунология. 2016; 5 (4): e1100788.

    PubMed

    Google ученый

  • 102.

    Bourgeois-Daigneault M-C, Roy DG, Aitken AS, El Sayes N, Martin NT, Varette O и др. Неоадъювантная онколитическая виротерапия перед операцией повышает сенсибилизацию трижды отрицательного рака груди к терапии иммунных контрольных точек. Sci Transl Med. 2018; 10 (422): eaao1641.

    PubMed

    Google ученый

  • 103.

    Ян Y, Xu W, Peng D, Wang H, Zhang X, Wang H и др. Онколитический аденовирус, нацеленный на трансформирующий фактор роста β, подавляет протуморигенные сигналы и вызывает иммунную активацию: новый подход к усилению терапии анти-PD-1 и анти-CTLA-4.Hum Gene Ther. 2019; 30 (9): 1117–32.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 104.

    Chen C-Y, Wang P-Y, Hutzen B., Sprague L, Swain HM, Love JK, et al. Взаимодействие онколитической герпетической виротерапии и блокады PD-1 на мышиных моделях рабдомиосаркомы. Научный доклад 2017; 7 (1): 2396.

    PubMed
    PubMed Central

    Google ученый

  • 105.

    Лю З., Равиндранатан Р., Калински П., Го З.С., Бартлетт Д.Л.Рациональная комбинация онколитического вируса осповакцины и блокады PD-L1 работает синергетически, повышая терапевтическую эффективность. Nat Commun. 2017; 8: 14754.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 106.

    Рохас Дж. Дж., Сампат П., Хоу В., Торн Ш. Определение эффективных комбинаций блокады иммунных контрольных точек и онколитической виротерапии. Clin Cancer Res. 2015; 21 (24): 5543–51.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 107.

    Shekarian T, Sivado E, Jallas AC, Depil S, Kielbassa J, Janoueix-Lerosey I, et al. Повторное использование ротавирусных вакцин для внутриопухолевой иммунотерапии может преодолеть устойчивость к блокаде иммунных контрольных точек. Sci Transl Med. 2019; 11 (515): eaat5025.

    CAS
    PubMed

    Google ученый

  • 108.

    Замарин Д., Холмгаард Р. Б., Субудхи С. К., Парк Дж. С., Мансур М., Палезе П. и др. Локальная онколитическая виротерапия преодолевает системную резистентность опухоли к иммунотерапии, блокирующей иммунные контрольные точки.Sci Transl Med. 2014; 6 (226): 12.

    Google ученый

  • 109.

    Пузанов И., Мильхем М.М., Минор Д., Хамид О, Ли А., Чен Л. и др. Талимоген лахерпарепвек в комбинации с ипилимумабом при ранее нелеченой неоперабельной меланоме IIIB-IV стадии. J Clin Oncol. 2016; 34 (22): 2619 – U109.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 110.

    Чесни Дж., Пузанов И., Колличио Ф, Сингх П., Милхем М.М., Гласпи Дж. И др.Рандомизированное открытое исследование фазы II, в котором оценивалась эффективность и безопасность талимогена лахерпарепвека в сочетании с ипилимумабом по сравнению с одним ипилимумабом у пациентов с запущенной неоперабельной меланомой. J Clin Oncol. 2018; 36 (17): 1658.

    CAS
    PubMed

    Google ученый

  • 111.

    Рибас А., Даммер Р., Пузанов И., Вандервальде А., Андтбака Р.И., Михиелин О. и др. Онколитическая виротерапия способствует внутриопухолевой инфильтрации Т-клетками и улучшает иммунотерапию против PD-1.Cell. 2017; 170 (6): 1109–19.e10.

    CAS
    PubMed

    Google ученый

  • 112.

    Havunen R, Siurala M, Sorsa S, Groenberg-Vaehae-Koskela S, Behr M, Taehtinen S, et al. Онколитические аденовирусы, вооруженные фактором некроза опухоли альфа и интерлейкином-2, обеспечивают успешную адоптивную клеточную терапию. Мол тер онколитики. 2017; 4: 77–86.

    CAS
    PubMed

    Google ученый

  • 113.

    Cervera-Carrascon V, Quixabeira DCA, Havunen R, Santos JM, Kutvonen E, Clubb JHA, et al. Сравнение клинически значимых платформ онколитических вирусов для улучшения Т-клеточной терапии солидных опухолей. Мол тер онколитики. 2020; 17: 47–60.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 114.

    Melzer MK, Zeitlinger L, Mall S, Steiger K, Schmid RM, Ebert O и др. Повышенная безопасность и эффективность онколитической терапии VSV за счет комбинации с трансгенными Т-клетками рецептора Т-клеток в качестве носителей.Мол тер онколитики. 2019; 12: 26–40.

    CAS
    PubMed

    Google ученый

  • 115.

    Johnson LA, June CH. Разработка генно-инженерной Т-клеточной иммунотерапии рака. Cell Res. 2017; 27 (1): 38–58.

    CAS
    PubMed

    Google ученый

  • 116.

    Халил Д.Н., Смит Е.Л., Брентдженс Р.Дж., Волчок Д.Д. Будущее лечения рака: иммуномодуляция, CAR и комбинированная иммунотерапия.Нат Рев Клин Онкол. 2016; 13 (5): 273–90.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 117.

    Moon EK, Wang L-CS, Bekdache K, Lynn RC, Lo A, Thorne SH, et al. Внутриопухолевая доставка CXCL11 через вирус осповакцины, но не с помощью модифицированных Т-клеток, повышает эффективность адоптивной Т-клеточной терапии и вакцин. Онкоиммунология. 2018; 7 (3): e1395997.

    PubMed
    PubMed Central

    Google ученый

  • 118.

    Nishio N, Diaconu I, Liu H, Cerullo V, Caruana I, Hoyos V и др. Вооруженный онколитический вирус усиливает иммунные функции Т-клеток, модифицированных химерными рецепторами антигена, в солидных опухолях. Cancer Res. 2014. 74 (18): 5195–205.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 119.

    Постов М.А., Сидлоу Р., Хеллманн М.Д. Иммунные побочные эффекты, связанные с блокадой иммунных контрольных точек. N Engl J Med. 2018; 378 (2): 158–68.

    CAS

    Google ученый

  • 120.

    Tanoue K, Shaw AR, Watanabe N, Porter C, Rana B, Gottschalk S и др. Вооруженное мини-тело PD-L1, экспрессирующее онколитический аденовирус, усиливает противоопухолевые эффекты Т-клеток химерного антигена рецептора в солидных опухолях. Cancer Res. 2017; 77 (8): 2040–51.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 121.

    Shaw AR, Porter CE, Watanabe N, Tanoue K, Sikora A, Gottschalk S, et al. Аденовиротерапия, доставляющая цитокин и ингибитор контрольных точек, усиливает CAR T-клетки против метастатического рака головы и шеи.Mol Ther. 2017; 25 (11): 2440–51.

    Google ученый

  • 122.

    Wing A, Fajardo CA, Posey AD Jr, Shaw C, Da T, Young RM и др. Улучшение терапии солидных опухолей CART-клетками с помощью онколитического вируса продуцирования биспецифического активатора Т-клеток. Cancer Immunol Res. 2018; 6 (5): 605–16.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 123.

    Леунг Э.Й.Л., Эннис Д.П., Кеннеди П.Р., Ханселл С., Доусон С., Фаркухарсон М. и др.NK-клетки усиливают цитотоксичность онколитического аденовируса при раке яичников. Мол тер онколитики. 2020; 16: 289–301.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 124.

    Клозе С., Берхтольд С., Шмидт М., Бейл Дж., Смирнов И., Вентурелли С. и др. Биологическое лечение детских сарком с помощью комбинированной виротерапии и терапии NK-клетками. BMC Рак. 2019; 19 (1): 1172.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 125.

    Chen XL, Han JF, Chu JH, Zhang LL, Zhang JY, Chen C и др. Комбинированная терапия EGFR-CAR NK-клеток и онколитического вируса простого герпеса 1 для метастазов рака молочной железы в мозг. Oncotarget. 2016; 7 (19): 27764–77.

    PubMed
    PubMed Central

    Google ученый

  • 126.

    Yoo JY, Jaime-Ramirez AC, Bolyard C, Dai H, Nallanagulagari T., Wojton J, et al. Лечение бортезомибом повышает чувствительность онколитических опухолей, обработанных ВПГ-1, к иммунотерапии NK-клетками.Clin Cancer Res. 2016; 22 (21): 5265–76.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 127.

    Ким Й, Ю Джи, Ли Т.Дж., Лю Дж, Ю Дж, Калиджури М.А. и др. Комплексная роль NK-клеток в регуляции терапии онколитическим вирусом бортезомиб. Proc Natl Acad Sci U S. A. 2018; 115 (19): 4927–32.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 128.

    Cerullo V, Pesonen S, Diaconu I, Escutenaire S, Arstila PT, Ugolini M, et al.Онколитический аденовирус, кодирующий колониестимулирующий фактор гранулоцитов-макрофагов, индуцирует противоопухолевый иммунитет у онкологических больных. Cancer Res. 2010. 70 (11): 4297–309.

    CAS
    PubMed

    Google ученый

  • 129.

    Хео Дж., Рид Т., Руо Л., Брейтбах С.Дж., Роуз С., Блумстон М. и др. Рандомизированное клиническое испытание онколитической иммунотерапевтической вакцины JX-594 по подбору доз при раке печени. Nat Med. 2013. 19 (3): 329–36.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 130.

    Du T, Shi G, Li YM, Zhang JF, Tian HW, Wei YQ и др. Опухолевые онколитические аденовирусы, экспрессирующие колониестимулирующий фактор гранулоцитарных макрофагов или антитела против CTLA4, для лечения рака. Cancer Gene Ther. 2014; 21 (8): 340–8.

    CAS
    PubMed

    Google ученый

  • 131.

    Mao L-j, Ding M, Xu K, Pan J, Yu H, Yang C. Онколитический аденовирус, содержащий интерлейкин-24, улучшает химиотерапию при запущенном раке простаты.J Рак. 2018; 9 (23): 4391–7.

    PubMed
    PubMed Central
    Статья

    Google ученый

  • 132.

    Quetglas JI, Labiano S, Aznar MA, Bolanos E, Azpilikueta A, Rodriguez I, et al. Виротерапия с использованием вектора на основе вируса леса Семлики, кодирующего IL12, синергично с блокадой PD-1 / PD-L1. Cancer Immunol Res. 2015; 3 (5): 449–54.

    CAS
    PubMed
    Статья

    Google ученый

  • 133.

    Masuelli L, Fantini M, Benvenuto M, Sacchetti P, Giganti MG, Tresoldi I, et al. Внутриопухолевая доставка рекомбинантного вируса осповакцины, кодирующего ErbB2 / Neu, подавляет рост клеток карциномы слюнной железы. J Transl Med. 2014; 12: 122.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 134.

    de Vries CR, Monken CE, Lattime EC. Добавление рекомбинантной вакцины HER2 / neu к онколитической вакцине-GMCSF, введенной в микроокружение опухоли, преодолевает опосредованный MDSC иммунный бегство и системную анергию.Cancer Gene Ther. 2015; 22 (3): 154–62.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 135.

    Sharp D, Lattime EC. Рекомбинантный поксвирус и микроокружение опухоли: онколиз, иммунная регуляция и иммунизация. Биомедицины. 2016; 4 (3): 19.

    PubMed
    PubMed Central
    Статья
    CAS

    Google ученый

  • 136.

    Bridle BW, Boudreau JE, Lichty BD, Brunelliere J, Stephenson K, Koshy S, et al.Вирус везикулярного стоматита как новый вектор противораковой вакцины для создания противоопухолевого иммунитета, поддающийся быстрой стимуляции аденовирусом. Mol Ther. 2009. 17 (10): 1814–21.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 137.

    Pol JG, Zhang L, Bridle BW, Stephenson KB, Resseguier J, Hanson S, et al. Вирус мараба как мощный вектор онколитической вакцины. Mol Ther. 2014. 22 (2): 420–9.

    CAS
    PubMed
    Статья

    Google ученый

  • 138.

    Илетт Э., Коттке Т., Томпсон Дж., Раджани К., Заиди С., Эвгин Л. и др. Прайм-буст с использованием отдельных онколитических вирусов в сочетании с блокадой контрольных точек улучшает противоопухолевую терапию. Gene Ther. 2017; 24 (1): 21–30.

    CAS
    PubMed
    Статья

    Google ученый

  • 139.

    Dias JD, Hemminki O, Diaconu I., Hirvinen M, Bonetti A, Guse K, et al. Нацеленная иммунотерапия рака с онколитическим аденовирусом, кодирующим полностью человеческое моноклональное антитело, специфичное к CTLA-4.Gene Ther. 2012; 19 (10): 988–98.

    CAS
    PubMed
    Статья

    Google ученый

  • 140.

    Bartee MY, Dunlap KM, Bartee E. Локализованная в опухоли секреция растворимого PD1 усиливает онколитическую виротерапию. Cancer Res. 2017; 77 (11): 2952–63.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 141.

    Клингер М., Бенджамин Дж., Кишел Р., Стиенен С., Цугмайер Г.Использование Т-клеток для борьбы с раком с помощью конструкций антител BiTE (R) — прошлые разработки и будущие направления. Immunol Rev.2016; 270 (1): 193–208.

    CAS
    PubMed
    Статья

    Google ученый

  • 142.

    Yu F, Wang X, Guo ZS, Bartlett DL, Gottschalk SM, Song X-T. Онколитический вирус осповакцины, вооруженный Т-клетками, значительно усиливает противоопухолевую терапию. Mol Ther. 2014; 22 (1): 102–11.

    CAS
    PubMed
    Статья

    Google ученый

  • 143.

    Альберто Фахардо С., Гедан С., Альфонсо Рохас Л., Морено Р., Ариас-Бадиа М., де Состоа Дж. И др. Онколитическая аденовирусная доставка активатора Т-клеток, нацеленного на EGFR, улучшает противоопухолевую эффективность. Cancer Res. 2017; 77 (8): 2052–63.

    Артикул
    CAS

    Google ученый

  • 144.

    Freedman JD, Hagel J, Scott EM, Psallidas I, Gupta A, Spiers L, et al. Онколитический аденовирус, экспрессирующий биспецифические антитела, нацелен на цитотоксичность Т-клеток в биоптатах рака.Эмбо Мол Мед. 2017; 9 (8): 1067–87.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 145.

    Mader EK, Maeyama Y, Lin Y, Butler GW, Russell HM, Galanis E, et al. Носители мезенхимальных стволовых клеток защищают онколитические вирусы кори от нейтрализации антителами в модели лечения ортотопического рака яичников. Clin Cancer Res. 2009. 15 (23): 7246–55.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 146.

    Юн А.Р., Хонг Дж., Ли Й, Шин Х.С., Ли Х., Ким Х.С. и др. Доставка онколитического аденовируса, опосредованная мезенхимальными стволовыми клетками, повышает противоопухолевую эффективность при гепатоцеллюлярной карциноме. Cancer Res. 2019; 79 (17): 4503–14.

    CAS
    PubMed
    Статья

    Google ученый

  • 147.

    Хаммад М., Корнехо Ю. Р., Баталла-Ковелло Дж., Маджид А. А., Берк С., Лю З. и др. Нервные стволовые клетки улучшают доставку онколитического химерного ортопоксвируса в модели метастатического рака яичников.Мол тер онколитики. 2020; 18: 326–34.

    PubMed
    PubMed Central
    Статья

    Google ученый

  • 148.

    Burke B, Giannoudis A, Corke KP, Gill D, Wells M, Ziegler-Heitbrock L, et al. Вызванная гипоксией экспрессия генов в макрофагах человека — последствия для ишемических тканей и генной терапии, регулируемой гипоксией. Am J Pathol. 2003. 163 (4): 1233–43.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 149.

    Muthana M, Giannoudis A, Scott SD, Fang H-Y, Coffelt SB, Morrow FJ и др. Использование макрофагов для нацеливания терапевтического аденовируса на опухоли простаты человека. Cancer Res. 2011; 71 (5): 1805–18015.

    CAS
    PubMed
    Статья

    Google ученый

  • 150.

    Muthana M, Rodrigues S, Chen Y-Y, Welford A, Hughes R, Tazzyman S, et al. Доставка онколитического вируса макрофагами предотвращает повторный рост опухоли и метастазирование после химиотерапии или облучения.Cancer Res. 2013. 73 (2): 490–5.

    CAS
    PubMed
    Статья

    Google ученый

  • 151.

    Илетт Э.Дж., Прествич Р.Дж., Коттке Т., Эррингтон Ф., Томпсон Дж.М., Харрингтон К.Дж. и др. Дендритные клетки и Т-клетки доставляют онколитический реовирус для уничтожения опухолей, несмотря на ранее существовавший противовирусный иммунитет. Gene Ther. 2009. 16 (5): 689–99.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 152.

    Дженнингс В.А., Илетт Э.Дж., Скотт К.Дж., Вест Э.Дж., Вайл Р., Панда Х. и др. Лимфокин-активируемые киллеры и перенос дендритных клеток усиливают онколитическую реовирусную терапию рака яичников, преодолевая нейтрализацию антител при асците. Int J Cancer. 2014. 134 (5): 1091–101.

    CAS
    PubMed
    Статья

    Google ученый

  • 153.

    Гуо Y, Чжан З.З., Сюй XG, Сюй З.Й., Ван С.Б., Хуанг Д.С. и др. Стволовые клетки, полученные из менструальной крови, как средства доставки для онколитической аденовирусной виротерапии колоректального рака.Stem Cells Dev. 2019; 28 (13): 882–96.

    CAS
    PubMed
    Статья

    Google ученый

  • 154.

    Na YJ, Nam JP, Hong J, Oh E, Shin HC, Kim HS, et al. Системное введение мезенхимальных стромальных клеток человека, инфицированных покрытым полимером онколитическим аденовирусом, индуцирует эффективную самонаведение и инфильтрацию опухоли поджелудочной железы. J Control Release. 2019; 305: 75–88.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 155.

    Илетт Э.Д., Барсена М., Эррингтон-Мэйс Ф., Гриффин С., Харрингтон К.Дж., Панда Х.С. и др. Интернализация онколитического реовируса носителями дендритных клеток человека защищает вирус от нейтрализации. Clin Cancer Res. 2011. 17 (9): 2767–76.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 156.

    Чжун З., Хань Дж., Ван И, Чжан З., Сан X. Анионные липосомы усиливают и продлевают опосредованную аденовирусом экспрессию генов в эпителии дыхательных путей in vitro и in vivo.Mol Pharm. 2011. 8 (3): 673–82.

    CAS
    PubMed
    Статья

    Google ученый

  • 157.

    Ван И, Хуанг Х, Цзоу Х, Тиан Х, Ху Дж, Цю П и др. Липосомная инкапсуляция онколитического вируса M1 для снижения иммуногенности и иммунного клиренса in vivo. Mol Pharm. 2019; 16 (2): 779–85.

    CAS
    PubMed
    Статья

    Google ученый

  • 158.

    Lv P, Liu X, Chen X, Liu C, Zhang Y, Chu C и др.Генетически сконструированные нанопузырьки клеточной мембраны для доставки онколитического аденовируса: универсальная платформа для виротерапии рака. Nano Lett. 2019; 19 (5): 2993–3001.

    CAS
    PubMed
    Статья

    Google ученый

  • 159.

    Носаки К., Хамада К., Такашима Ю., Сагара М., Мацумура Ю., Миямото С. и др. Новый онколитический вирус кори с полимерным покрытием преодолевает иммуносупрессию и вызывает сильную противоопухолевую активность. Мол тер онколитики.2016; 3: 16022.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 160.

    Choi JW, Jung SJ, Kasala D, Hwang JK, Hu J, Bae YH, et al. pH-чувствительный гибрид онколитического аденовируса, нацеленный на кислое микроокружение опухоли и ангиогенез. J Control Release. 2015; 205: 134–43.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 161.

    Wan Y, Han J, Fan G, Zhang Z, Gong T, Sun X. Ферментно-чувствительные липосомы модифицировали аденовирусные векторы для усиления трансдукции опухолевых клеток и снижения иммуногенности. Биоматериалы. 2013. 34 (12): 3020–30.

    CAS
    PubMed
    Статья

    Google ученый

  • 162.

    Мацумура Ю., Маэда Х. Новая концепция макромолекулярной терапии в химиотерапии рака — механизм туморитропного накопления белков и противоопухолевый агент SMANCS.Cancer Res. 1986. 46 (12): 6387–92.

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 163.

    Tan PH, Xue S-A, Wei B, Holler A, Voss R-H, George AJT. Изменение вирусного тропизма с использованием иммунолипосом изменяет стабильность экспрессии генов: последствия для дизайна вирусного вектора. Mol Med. 2007. 13 (3–4): 216–26.

    CAS
    PubMed
    PubMed Central
    Статья

    Google ученый

  • 164.

    Юн А.Р., Касала Д., Ли Й, Хонг Дж., Ли В., Юнг С.-Дж. И др. Противоопухолевый эффект и профиль безопасности системно доставляемого онколитического аденовируса в комплексе с EGFR-направленным дендримером на основе PAMAM на модели ортотопической опухоли легкого. J Control Release. 2016; 231: 2–16.

    CAS
    PubMed
    Статья

    Google ученый

  • % PDF-1.7
    %
    2 0 obj
    >
    >>
    / Метаданные 4 0 R
    / Контуры 5 0 R
    / Страницы 6 0 R
    / Тип / Каталог
    / ViewerPreferences>
    >>
    endobj
    4 0 obj
    >
    ручей
    2020-05-29T11: 28: 37-05: 002020-05-29T11: 28: 37-05: 00Adobe InDesign CS6 (Windows) 2020-05-29T11: 32: 55-05: 00uuid: 1f4c43ed-2be4-43db- b686-

    347de26xmp.сделал: 619835B4A530E611AFD6B5D6E6FD47B6xmp.id: D7100D6DC9A1EA11A13F841D9E2BFC1Aproof: pdfxmp.iid: D6100D6DC9A1EA11A13F841D9E2BFC1Axmp.did: 18028BA77A0BE7118832AC975DF268E4xmp.did: 619835B4A530E611AFD6B5D6E6FD47B6default

  • convertedfrom применение / х-InDesign к применению / pdfAdobe InDesign CS6 (Windows) / 2020-05-29T11: 28: 37-05: 00
  • application / pdf Adobe PDF Library 10.0.1 Ложь

    конечный поток
    endobj
    22 0 объект
    >
    ручей
    x} ksGwX! L «dJlHOoD {> P $ D $ | X # @ JmypnM7 / 9L7? ם \.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *