Опн постренальная: Страница не найдена |

Содержание

Страница не найдена |

Страница не найдена |



404. Страница не найдена

Архив за месяц

ПнВтСрЧтПтСбВс

      1

16171819202122

23242526272829

3031     

       

       

     12

       

     12

       

      1

3031     

     12

       

15161718192021

       

25262728293031

       

    123

45678910

       

     12

17181920212223

31      

2728293031  

       

      1

       

   1234

567891011

       

     12

       

891011121314

       

11121314151617

       

28293031   

       

   1234

       

     12

       

  12345

6789101112

       

567891011

12131415161718

19202122232425

       

3456789

17181920212223

24252627282930

       

  12345

13141516171819

20212223242526

2728293031  

       

15161718192021

22232425262728

2930     

       

Архивы

Метки

Настройки
для слабовидящих

Постренальная острая почечная недостаточность

Эта
форма ОПН обычно возникает вследствие
обструкции мочевыводящих путей (камнями,
сгустками крови, некротизированной
тканью сосочков) ниже устьев мочеточников,
наиболее часто — на уровне шейки мочевого
пузыря. Если обструкция локализована
выше, то выделительную функцию берёт
на себя непоражённая почка. Обструкция
на пути оттока мочи приводит к повышению
давления в мочеточниках и лоханках.
Острая обструкция первоначально приводит
к умеренному усилению почечного
кровотока, быстро сменяющемуся
вазоконстрикцией и снижением СКФ. ОПН
вследствие острого нарушения оттока
мочи из мочевого пузыря — самая частая
причина анурии в старческом возрасте,
у неврологических больных, а также у
больных сахарным диабетом (т.е. ОПН
возникает вследствие аденомы предстательной
железы, пузырно-мочеточникового рефлюкса,
вегетативной невропатии). Более редкие
причины постренальной ОПН — стриктуры
мочеиспускательного канала, лекарственный
ретроперитонеальный фиброз, шеечный
цистит.

Клиническая картина

Течение
ОПН традиционно делят на четыре стадии:
начальную, олигурическую, восстановления
диуреза (полиурическую) и полного
восстановления всех функций почек
(однако последняя возможна не всегда).

Начальная стадия

В
начальной стадии преобладают симптомы,
обусловленные этиологическим фактором:
шоком (болевым, анафилактическим,
инфекционно-токсическим и т.д.), гемолизом,
острым отравлением, инфекционным
заболеванием и т.д.

Олигурическая стадия

Олигурия
— выделение за сутки менее 400 мл мочи.
Совокупность гуморальных нарушений
приводит к нарастанию симптомов острой
уремии. Адинамию, потерю аппетита,
тошноту, рвоту наблюдают уже в первые
дни. По мере нарастания азотемии (обычно
концентрация мочевины в крови ежедневно
повышается на 0,5 г/л), ацидоза, гиперволемии
(особенно на фоне активных внутривенных
инфузий и обильного питья) и электролитных
нарушений появляются мышечные
подёргивания, сонливость, заторможенность,
усиливается одышка вследствие ацидоза
и отёка лёгких, раннюю стадию которого
определяют рентгенологически.

• Характерны
тахикардия, расширение границ сердца,
глухость тонов, систолический шум на
верхушке, иногда шум трения перикарда.
У части больных (20-30%) — АГ. Блокады сердца
или фибрилляция желудочков могут
привести к остановке сердца. Нарушения
ритма нередко связаны с гиперкалиемией.
При гиперкалиемии более 6,5 ммоль/л на
ЭКГ зубец Твысокий,
остроконечный, расширяется комплекс QRS,
может уменьшаться амплитуда зубца R.
Возможны инфаркт миокарда и ТЭЛА.

• Поражение
ЖКТ (боли в животе, увеличение печени)
часто отмечают при острой уремии. В
10-30% случаев регистрируют желудочно-кишечные
кровотечения из-за развития острых язв.

• Интеркуррентные
инфекции возникают в 50-90% случаев ОПН.
Высокая частота инфекций при ОПН связана
как с ослаблением иммунитета, так и
инвазивными вмешательствами (установление
артериовенозных шунтов, катетеризация
мочевого пузыря). Наиболее часто инфекция
при ОПН локализуются в мочевыводящих
путях, лёгких, брюшной полости. Острые
инфекции ухудшают прогноз больных с
ОПН, усугубляют избыточный катаболизм,
гиперкалиемию, метаболический ацидоз.
Генерализованные инфекции становятся
причиной смерти у 50% больных.

Продолжительность
олигурической стадии варьирует от 5 до
11 сут. У части больных с ОПН олигурия
может отсутствовать, например, при
воздействии нефротоксических агентов
развивается острое ухудшение почечной
функции, однако объём суточной мочи
обычно превышает 400 мл. Нарушения
азотистого обмена в этих случаях
развиваются вследствие усиленного
катаболизма.

Острая почечная недостаточность — Инновационный сосудистый центр

Острая почечная недостаточность –  потенциально обратимое, внезапно наступившее выраженное нарушение или прекращение функции почек. Характерно нарушение всех почечных функций (секреторной, выделительной и фильтрационной), выраженные изменения водно-электролитного баланса, быстро нарастающая азотемия. Почечная недостаточность ведет к выраженным нарушениям метаболических процессов в организме и без лечения приводит к смерти от остановки сердца.

Причины и факторы риска

Этиология преренальной ОПН

Преренальная ОПН может развиваться при состояниях, которые сопровождаются снижением сердечного выброса (при тромбоэмболии легочной артерии, сердечной недостаточности, аритмии, тампонаде сердца, кардиогенном шоке). Нередко причиной становится уменьшение количества внеклеточной жидкости (при диарее, дегидратации, острой кровопотери, ожогах, асците, вызванном циррозом печени). Может возникать вследствие выраженной вазодилатации, возникающей при бактериотоксическом или анафилактическом шоке.

Этиология ренальной ОПН

Возникает при токсическом воздействии на почечную паренхиму удобрений, ядовитых грибов, солей меди, кадмия, урана и ртути. Развивается при бесконтрольном приеме нефротоксичных медикаментов (противоопухолевые препараты, ряд антибиотиков и сульфаниламидов). Рентгенконстрастные вещества и перечисленные препараты, назначенные в обычной дозировке, могут стать причиной ренальной ОПН у больных с нарушением функции почек. Кроме того, данная форма ОПН возникает при циркуляции в крови большого количества миоглобина и гемоглобина (при выраженной макрогемаглобинурии, переливании несовместимой крови, длительном сдавлении тканей при травме, наркотической и алкогольной коме). Реже развитие ренальной ОПН обусловлено воспалительным заболеванием почек.

Этиология постренальной ОПН

Развивается при механическом нарушении пассажа мочи при двухсторонней обструкции мочевых путей камнями. Реже возникает при опухолях предстательной железы, мочевого пузыря и мочеточников, туберкулезных поражениях, уретритах и периуретритах, дистрофических поражениях забрюшинной клетчатки. При тяжелых сочетанных травмах и обширных хирургических вмешательствах острая почечная недостаточность вызывается несколькими факторами (шок, сепсис, переливание крови, лечение нефротоксичными препаратами).

Классификация

Выделяют следующие формы ОПН:

— Гемодинамическая (преренальная). Возникает вследствие острого нарушения гемодинамики.

— Паренхиматозная (ренальная). Причиной становится токсическое или ишемическое поражение почечной паренхимы, реже – острый воспалительный процесс в почках.

— Обструктивная (постренальная). Развивается вследствие остро возникшей обструкции мочевыводящих путей.

Симптомы и течение ОПН

Выделяют четыре фазы острой почечной недостаточности:

  • Начальная фаза ОПН

Состояние пациента определяется основным заболеванием, вызывающим ОПН. Клинически начальная фаза обычно не выявляется из-за отсутствия характерных симптомов. Циркуляторный коллапс, возникающий в этой фазе, имеет очень малую продолжительность, поэтому проходит незамеченным. Неспецифичные симптомы ОПН (сонливость, тошнота, отсутствие аппетита, слабость) замаскированы проявлениями основного заболевания, травмы или отравления.

  • Олигоанурическая фаза ОПН

Анурия возникает редко. Количество отделяемой мочи — менее 500 мл в сутки. Характерна выраженная протеинурия, азотемия, гиперфосфатемия, гиперкалиемия, гипернатиемия, метаболический ацидоз. Отмечается понос, тошнота, рвота. При отеке легкого вследствие гипергидратации появляется одышка и влажные хрипы. Больной заторможен, сонлив, может впасть в кому. Нередко развивается перикардит, уремический гастроэнтероколит, осложняющийся кровотечениями. Пациент подвержен инфекции вследствие снижения иммунитета. Возможен панкреатит, стоматит паротит, пневмония, сепсис.

Олигоанурическая фаза ОПН развивается в течение первых трех суток после воздействия. Позднее развитие олигоанурической фазы считается прогностически неблагоприятным признаком. Средняя продолжительность этой стадии 10-14 дней. Период олигурии может укорачиваться до нескольких часов или удлиняться до 6-8 недель. Продолжительная олигурия чаще возникает у пожилых пациентов с сопутствующей сосудистой патологией. При олигурической стадии ОПН, длящейся более месяца, необходимо провести дополнительную дифференциальную диагностику для исключения прогрессирующего гломерулонефрита, почечного васкулита, окклюзии почечной артерии, диффузного некроза коры почек.

  • Диуретическая фаза ОПН

Длительность диуретической фазы – около двух недель. Суточный диурез постепенно увеличивается и достигает 2-5 литров. Отмечается постепенное восстановление водно-электролитного баланса. Возможна гипокалиемия вследствие значительных потерь калия с мочой.

  • Фаза выздоровления

Происходит дальнейшее восстановление почечных функций, занимающее от 6 месяцев до 1 года.

Осложнения острой почечной недостаточности

Выраженность нарушений, характерных для почечной недостаточности (задержка жидкости, азотемия, нарушение водно-электролитного баланса) зависит от состояния катаболизма и наличия олигурии. При выраженной олигурии отмечается снижение уровня клубочковой фильтрации, существенно уменьшается выделение электролитов, воды и продуктов азотного обмена, что приводит к более выраженным изменениям состава крови.

  • Нарушения водно-солевого обмена

При олигурии увеличивается риск развития водной и солевой сверхнагрузки. Гиперкалиемия при острой почечной недостаточности вызвана недостаточным выведением калия при сохраняющемся уровне его высвобождения из тканей. У больных, не страдающих олигурией, уровень калия составляет 0,3-0,5 ммоль/сут. Более выраженная гиперкалиемия у таких пациентов может говорить об экзогенной (переливание крови, лекарственные препараты, наличие в рационе продуктов, богатых калием) или энодгенной (гемолиз, деструкция тканей) калиевой нагрузке.

Первые симптомы гиперкалиемии появляются, когда уровень калия превышает 6,0-6,5 ммоль/л. Больные жалуются на мышечную слабость. В некоторых случаях развивается вялый тетрапарез. Отмечаются изменения ЭКГ. Снижается амплитуда зубцов P, увеличивается интервал P-R, развивается брадикардия. Значительное повышение концентрации калия может вызвать остановку сердца.

На первых двух стадиях ОПН наблюдаются гипокальциемия, гиперфосфатемия, слабо выраженная гипермагниемия.

  • Изменения крови

Следствием выраженной азотемии является угнетение эритропоэза. Сокращается продолжительность жизни эритроцитов. Развивается нормоцитарная нормохромная анемия.

  • Иммунные нарушения

Угнетение иммунитета способствует возникновению инфекционных заболеваний у 30-70% пациентов с острой почечной недостаточностью. Присоединение инфекции утяжеляет течение заболевания и нередко становится причиной смерти больного. Развивается воспаление в области послеоперационных ран, страдает полость рта, дыхательная система, мочевыводящие пути. Частым осложнением острой почечной недостаточности является сепсис, который может вызываться как грамположительной, так и грамотрицательной флорой.

  • Неврологические нарушения

Отмечается сонливость, спутанность сознания, дезориентация, заторможенность, чередующаяся с периодами возбуждения. Периферическая нейропатия чаще возникает у пожилых пациентов.

  • Осложнения со стороны сердечно-сосудистой системы

При ОПН может развиться застойная сердечная недостаточность, аритмия, перикардит, гипертензия.

  • Нарушения деятельности ЖКТ

Больных беспокоит ощущение дискомфорта в брюшной полости, тошнота, рвота, потеря аппетита. В тяжелых случаях развивается уремический гастроэнтероколит, часто осложняющийся кровотечениями.

Прогноз

Летальность в первую очередь зависит от тяжести патологического состояния, ставшего причиной развития ОПН. На исход заболевания влияет возраст больного, степень нарушения функции почек, наличие осложнений. У выживших пациентов почечные функции восстанавливаются полностью в 35-40% случаев, частично – в 10-15% случаев. 1-3% больных необходим постоянный гемодиализ.

Диагностика почечной недостаточности у собак и кошек




















Признак

ОПН

(Может быть преренальная, ренальная, постренальная)

ХПН

Гломерулонефропатии (ГН)

Физ.кондиция

хорошая

плохая

различная

Анамнез

Резкое обострение, тяжелое состояние. Рвота, анорексия, депрессия

Хронически прогрессирующие изменения. Потеря веса, ↓ аппетита; хр.рвота. Состояние зависит от величины уремии

Асимптоматично до момента ХПН, потеря веса. Клинические признаки связаны с основным заболеванием (хромота, неоплазия, асциты, плевр.выпоты)

Причина

Исключить гипокортизоловый кризис (б.Адиссона)

Острый пиелонефрит

Лептоспироз

Обструкция МВП

Лимфома

FIP

Нефротоксические препараты (аминогликозиды)

НСПВС

В больш.случаев к моменту развития картины ХПН причину ПН выявить уже не удастся.

Поликистоз почек (персы, др.длиннош.кошки; бигли, керн-терьеры)

Почечная дисплазия (молодые животные с абнорм.строением почек на УЗИ)

Амилоидоз (шар-пей, абессинские к.)

Синдром Фанкони (бассенджи)

ГН со вторичной ХПН

Исключить пре- и постренальные источники протеинурии

Амилоидоз

Вторичные (любые хронич.инфекции, воспаления и неоплазии) и идиопатические (когда причину определить не удается).

Инфекции (бак.эндокардит, пиометра, дирофиляриоз, рикеттсии (эрлихии, анаплазма), бруцеллез, спирохеты-бореллиоз).

Неоплазии (лимфомы, миелома), СКВ

FeLV, FIV

ПД/ПУ (полидипсия/полиурия)

Может быть поли-, ан- или олигурия

+++

+ → +++

Размер почки

Часто увеличены, болезненны

уменьшены

От нормы до уменьшеных

Азотемия

+

+

+/-

Электролиты

↑К (ану – или олигурия) при ПН

↑К при обструкции

↓К постобструктивный диурез

↓К у кошек (для собак не характерно)

 

N

Са/P

P↑ при сокращении объема гломерулярной фильтрации

< 15 % от нормы

↕Ca – в зависимости от статуса гидратации

Гиперфосфатемия не проявляется до азотемии или потери ≥75 % нефронов

→ компенсаторный вторичный почечный гиперпаратиреоз

90 % пациентов имеют Ca в границах нормы

10 % собак ↓Ca

Нет изменений до момента начала ХПН

Альбумин, Глобулин

↑Alb при дегидратации

Может быть ↓Alb как отрицательный белок острой фазы

М.б. ↑Alb при дегидратации

М.б. ↑Glob вторично к ПН

↓Alb вторично к ПН

70 % собак с амилоидозом имеют Alb <21 г/л

Glob в норме или ↑

(при потере белка через ЖКТ = ↓Alb +Glob)

Холестерол

 

 

Часто ↑ у собак с гломерулонефритом и амилоидозом

Протеинурия

Обычно N, зависит от конкр.случая

­­­________          _________

Преренальная ОПН: неспецифическое появление повышенного числа гиалиновых и зернистых цилиндров

Ренальная ОПН:

Зернистые цилиндры, почечный эпителий, гематурия, протеинурия

Постренальная ОПН:

Гематурия, протеинурии и цилиндров нет

От N до слегка ↑

+++

Плотность мочи

↓ плотность при наличии азотемии – ренальная ОПН

↑плотность – преренальная ОПН

Изостенурия, однако кошки дольше собак сохраняют способность концентрировать мочу

 

Электролиты мочи

Na < 20 ммоль/л

ЕFNa меньше, чем 1% (преренальная ПН)

Na > 40 ммоль/л

ЕFNa — выше 3% (ренальная ПН)

 

 

Биохимия мочи

1. Амилаза (кошки 20-200)

 

 

 

 

 

1. Неинформативно: те же значения, что и в норме (кошки 50-220)

 

Расчетные факторы

1. Креатинин мочи/креатинин крови (норма 45-100 в мг/дл)

 

 

 

1. > 50:1 (преренальная ПН)

   < 37:1 (ренальная ПН)

 

 

 

1. латент.ф. 30-45:1

    клинич.ф. 5-20:1

 

Лейкоциты

 

Нейтрофильный лейкоцитоз со сдвигом влево или без сдвига

Может быть ассоциирована с лимфопенией и нейтрофилией без палочек как следствие эндог.кортикостероидов или стресса

 

Анемия

Нет, кроме случаев язв ЖКТ и геморрагии

Обычно зависит от серьезности ПН

Нормохромная, нормоцитарная

Нерегенеративная

+/-

Мониторинг

Краткосрочный м.:

Азотемия, электролиты, энурез

Азотемия может вначале увеличится в зависимости от конкр.случая и приходить в норму после курса терапии лишь через дни или недели

Долгосрочный м.:

Периодически моч/кре

При возвращении азотемии – также как и для пациентов с ХПН

Краткосрочный:

Моч/кре, Ht ежедневно, коррекция дегидратации до стабильного статуса

След измерение моч/кре перед выпиской

Долгосрочный:

Через 2-3 мес ренальный профиль

( Лейкоциты, моч/кре, электролиты, Альб, ОБ, Ca/P

 

бак исследование рекомендовано в след случаях:

При изостенурии (<1,015) и/или более 5 лейкоцитов в п/зр

А также во всех случаях эндокринопатий

Долгосрочный: белок/креатинин в моче

Острая почечная недостаточность

ОПН (острая почечная недостаточность или острое почечное повреждение) – это клинический синдром, характеризующийся резким увеличением концентраций креатинина и мочевины в сыворотке крови выше нормы.

Важнейшим условием успешного лечения пациентов с острой почечной недостаточностью является ранняя диагностика. В ветеринарном центре «Астин» пациентов с подозрением на острую почечную недостаточность госпитализируют в ОРИТ. Внедренные в клиническую практику широкий спектр эффективных антибактериальных препаратов, новые подходы к гемодинамической, антиоксидантной терапии и респираторной поддержки привели к увеличению количества пациентов, которые с положительной динамикой преодолевают кризис острой почечной недостаточности.

Классификация

  • Преренальная – снижение почечного кровотока;
  • Ренальная – непосредственное повреждение паренхимы почек;
  • Постренальная – закрытие просвета мочевыводящих путей.

Причины

  1. Почечная недостаточность — синдром, возникающий на фоне сопутствующих заболеваний, уже поразивших мочеполовую систему (нефроз, пиелонефрит, мочекаменная болезнь и другие патологии) или вследствие стремительного развития патологического процесса (например, ОЗМ, отравление нефротоксинами, инфекционные заболевания — лептоспироза).
  2. Почечная саморегуляция у животных, также, как и у людей, зависит от баланса расширения приносящих артериол, которую вызывают оксид азота и простагландины, и сужения выносящих артериол под воздействием ангиотензина-2. Если среднее давление держится ниже 70 мм рт.ст., то саморегуляция нарушается, и СКФ уменьшается пропорционально его снижению.
  3. Лекарственные препараты, которые взаимодействуют с этими медиаторами (НПВС или селективные ингибиторы ЦОГ-2, ингибиторы АПФ или АРА), способны вызвать преренальную острую почечную недостаточность.
  4. Наиболее частой ренальной причиной ОПН у животных является острый некроз канальцев. Он возникает в результате длительного течения одного и того же патофизиологического процесса, который приводит к преренальной гипоперфузии. Другой ренальной причиной острой почечной недостаточности является сепсис.
  5. Обструктивная нефропатия начинается как острая почечная недостаточность относительно редко, поэтому её важно своевременно распознать, поскольку быстрая диагностика и своевременно начавшееся лечение помогут улучшить или даже полностью восстановить функционирование почки.

Симптомы острой почечной недостаточности могут быть разными:

  • уменьшение объёма мочи (олигурия) или её полное отсутствие (анурия)
  • острая сердечная недостаточность при преренальной ОПН
  • острый гастроэнтерит (например, при отравлении солями тяжелых металлов)
  • апатия и общая слабость животного
  • понижение температуры тела животного
  • диспепсические расстройства (рвота, диарея, снижение или отсутствие аппетита)
  • появление отеков
  • изменения цвета слизистых (бледность или покраснение)

Для ранней диагностики ОПН в ветеринарном центре «Астин» применяются лабораторные экспресс-методы: определение уровня креатинина, калия и мочевины в крови.

Жизнеугрожающие факторы ОПН

К олигурии и анурии могут быстро присоединяться симптомы внеклеточной (характерезуется полостными и периферическими отёками), а после и внутриклеточной гипергидратации (отёк мозга, лёгких, острая левожелудочковая недостаточность). Такие жизнеугрожающие состояния невозможно разрешить амбулаторно. Для оказания помощи данному пациенту требуется стационарное лечение и командная работа ветеринарных врачей разных специальностей.

Знаковым признаком ОПН является азотемия – повышение концентрации азота в крови. Чем быстрее при ОПН прогрессирует азотемия, тем тяжелее протекает ОПН.

При олигурической и анурической ОПН развивается гиперкалиемия – повышение содержания калия в сыворотке до уровня более 5,5 мэкв/л. Критическая (жизнеугрожающая) гиперкалиемия может развиться в течение первых суток болезни и определить темп нарастания уремии. В ветеринарном центре «Астин» в ОРИТ для выявления гиперкалиемии и последующего контроля уровня калия проводят биохимический мониторинг с забором сыворотки крови, а также регистрируют его изменения по ЭКГ.

При выраженных нарушениях кислотно-основного состояния с большим дефицитом бикарбонатов и снижением кислотности крови усугубляются нарушения сердечного ритма, вызванные гиперкалиемией, присоединяются шумное дыхание Куссмауля и другие признаки поражения центральной нервной системы. Для острой почечной недостаточности характерно тяжёлое угнетение функций иммунной системы.

К ОПН может присоединяться респираторный дистресс-синдром. Он проявляется острой дыхательной недостаточностью с ухудшением легочного газообмена и изменениями в лёгких (интерстициальным отёком, множественными ателектазами). Также может развиваться бактериальная пневмония. Такие пациенты категорируются как тяжелые и располагаются в стационаре ОРИТ с надлежащим круглосуточным аппаратным мониторингом.

Диагностика ОПН

Первым этапом диагностики является сбор анамнеза при поступлении пациента на прием к врачу. В ходе беседы врач предварительно на основании анамнеза дифференцирует анурию (отсутствие поступления мочи в мочевой пузырь) от острой задержки мочи. В отсутствии мочи в мочевом пузыре убеждаются с помощью ультразвукового исследования. Экспресс – диагностика биохимических показателей позволяет определить уровень креатинина, мочевины и калия сыворотки крови.

Последующим этапом диагностики устанавливают форму ОПН. В первую очередь исключают обструкцию мочевых путей с помощью ультразвуковых и рентгенологических методов диагностики. Также проводят лабораторное исследование мочи (если моча не содержит свободной крови в своем составе).

Когда врачи исключат преренальную острую почечную недостаточность, то устанавливают форму ренальной ОПН. Это возможно осуществить на основании анализа мочи по присутствию в ней эритроцитарных и белковых цилиндров (свидетельствует о поражении клубочков). Наличие эозинофилов и полиморфно-ядерных лейкоцитов характерно для острого тубулоинтерстициального нефрита.

На заключительных этапах диагностики рекомендуется проведение биопсии почки.

Лечение ОПН

При лечении постренальной острой почечной недостаточности устраняют обструкцию и восстанавливают нормальный отток мочи. После этого постренальная ОПН в большинстве случаев пропадает.

При диагностированной преренальной острой почечной недостаточности устраняются факторы, которые вызвали острую сосудистую недостаточность или гиповолемию, отменяют препараты, приведшие к преренальной ОПН. Для выведения из шока и восполнения объема циркулирующей крови внутривенно проводят инфузионную терапию кристаллоидными и коллоидными растворами, раствора альбумина. При кровопотере переливают цельную кровь или эритроцитарную массу.

Если ОПН является гипонатриемия и дегидратация, внутривенно вводят кристаллоидные растворы. Инфузионная терапия в ОРИТ проводится под контролем диуреза и мониторингом давления. Пациентам с некоторыми вариантами ренальной ОПН в терапию добавляют антибиотики, иммунодепрессанты.

Предупредить развитие почечной недостаточности у животного не всегда представляется возможным.

Однако при подозрении на нарушение работы органов мочевыделительной системы рекомендуется обратиться в ветеринарную клинику.

Острая почечная недостаточность у собаки


Если Вашей собаке ставят диагноз острая почечная недостаточность, то это совсем не значит, что питомец останется инвалидом на всю оставшуюся жизнь. Конечно, есть вероятность, что животное не вынесет характерное для этого состояния резкого повышения уровня креатинина, мочевины и калия. Но всегда стоит бороться! Благоприятных исходов гораздо больше, чем летальных. Но летальные, к сожалению, тоже есть.



Собака с острой почечной недостаточностью, как правило, хорошо выглядит: шерсть лоснится, отсутствует перхоть, отсутствует исхудание. Но чаще всего есть отказ от корма, угнетение,  повышенная жажда, рвота ( может быть кормом, желчью, слюной, белой пеной),  запах мочевины из ротовой  полости, может быть увеличение или наоборот прекращение выделения мочи, отёки.



Существует несколько типов острой почечной недостаточности:

1. преренальная

2. ренальная

3. постренальная.



При преренальной ( или допочечной) острой почечной недостаточности почки как таковые  не повреждены, но из-за общего нарушения кровообращения не могут выполнять свои функции полноценно.



Причины преренальной острой почечной недостаточности:



  1. гиповолемия (обезвоживание, кровотечение, прием мочегонных препаратов, рвота, жидкий стул, а возможно, и сочетание нескольких факторов в течение нескольких дней),

  2. низкий сердечный выброс ( патология сердца),

  3. вазодилатация ( расширение сосудов).

 



Ренальная (или истинная почечная)  острая почечная недостаточность связана с повреждением структуры почек ввиду, например, воспалительного характера:



  • интерстициальный нефрит,

  • гломерулонефрит

  • острый тубулярный некроз ( чаще происходит по причине отравления).

 



Причиной постренальной ( или послепочечной) острой почечной недостаточности является препятствие нормальному оттоку мочи ( может встать пробка из песка, конкремента, белка, клеточного детрита или смешанного происхождения) на любом уровне мочевыводящих путей ( уретра, мочевой пузырь, мочеточник, почка), двустороннее или одностороннее.


 



Лечение пациентов с острой почечной недостаточностью всегда зависит от того, как быстро владелец обратился в клинику и как быстро был поставлен правильный диагноз. Лечение должно быть комплексным, чаще всего удастся выявить и устранить причину острой почечной недостаточности.  Помимо устранения причины необходимо  откорректировать водно — электролитный дисбаланс, кислотно-щелочные нарушения путем инфузионной терапии ( капельницы внутривенные или подкожные, возможно совмещение тех и других). Чаще всего назначаются энтеросорбенты для выведение из организма накопившихся  токсинов. Данным пациентам чаще всего требуется проведение интенсивной терапии в условиях стационара.



Если у Вашей собаки диагносцирована острая задержка мочи и соответственно постренальная острая почечная недостаточность, то необходимо как можно быстрее устранить причину и обеспечить свободный отток мочи. Чаще всего в таких случаях производится установка уретрального катетера под общей седацией ( анестезией) для предотвращения  травматизации полового члена. Иногда требуются оперативные вмешательства.



Особенно Вам необходимо быть внимательными,  когда  собака болеет заболеваниями, передающимися с укусом клеща. Очень часто пироплазмоз у собак сопровождается серьезным течением острой почечной недостаточности, именно поэтому так необходимо проводить капельные инфузии в процессе лечения пироплазмоза.

Острая и хроническая почечная недостаточность — информация для владельцев и заводчиков

ОПН – острая почечная недостаточность – Это острое нарушение функции почек, которое развивается от нескольких часов до нескольких суток и характеризуется комплексом характерных симптомов.

Этиология прежде всего зависит от причины нарушения. Соответственно от того, где лежит причина возникновения проблемы ОПН делится на преренальную, ренальную и постренальную. Причиной преренальной ОПН является недостаточное кровоснабжение почек при: обезвоживании, различных видах шока, тромбозах, недостаточной оксигенации крови.

Причиной ренальной ОПН является непосредственное повреждение структур почек при воспалении , интоксикации, травме или закупорка канальцев почек – «засор фильтра».

Причиной постренальной ОПН является все возможные причины. Которые препятствуют оттоку мочи от почек: воспаление мочеточников, опухоли, уролитиаз.


Патогенез острой почечной недостаточности

Вне зависимости от причины, при ОПН нарушается главная функция почек – формирование и отведение мочи. При этом происходит повреждение всех структур почек и всего организма вследствие отравления продуктами белкового обмена и всем тем, что должно было быть выведенно из организма вместе с мочей. При этом симптомы нарастают постепенно в зависимости от тяжести процесса и собственно степени необходимости быстрого отведения мочи. Причем, чем дольше не отводится моча, тем сильней повреждение и больше продуктов. Которые нужно вывести из организма.

Клиника

Первым признаком ОПН является резкое снижение диуреза от четверти диуреза до полной анурии. Кроме этого присутствуют нарастающие признаки интоксикации: угнетение, апатия, рвота, нарушение дыхания и сердцебиения, а также присутствуют симптомы непосреедственной причины ОПН.

Диагнозставится комплексно на основании клинических признаков и возможно результатов УЗИ почек.

Лечение: Направлено прежде всего на устранение причины ОПН и восстановление диуреза и других функций почек, а также устранение последствий в виде интоксикации и других. Соответственно, лечение сильно разнится в соответствии с этиологией ОПН.

Опасными последствиями ОПН являются: интоксикация, которая может привести к серьезным повреждениям прежде всего нервной системы, гиперкалийэмия, которая нарушает мышечным и сердечный тонус. Также при длительной ОПН может произойти необратимое повреждение структур почек и ОПН перейдет в ХПН.


ХПН – хроническая почечная недостаточность

Стабильное длительное нарушение функции почек, характеризующееся нарушением фильтрационной, концентрационной, выделительной, кроветворной и других функций почек, возникшее вследствиие поражения значительной части почечной ткани. Часто это состояние уже необратимо, так как проявляется клинически у животных, когда более 2/3 почечной ткани уже не функционирует.

Этиология: Причиной служит стойкое повреждение или разрушение структурных единиц почек – нефронов и замещение их фиброзной тканью. Причиной также может быть атрофия нефронов при поликистозе, гидронефрозе и других причинах.

Патогенез: При полном разрушении нефронов они не восстанавливаются,так как в отличии от нефроэпителия, где есть бластные клетки, целый нефрон просто не из чего вырастить организму. Поэтому на место разрушенного нефрона замещается фиброзной тканью – «внутрипочечный рубец».

Клиника

К сожалению, клинически ХПН проявляется уже на поздних стадиях, когда почки уже не могут компенсировать потерю ткани усиленным диурезом, который для хозяев часто незаметен. К тому же клинические признаки ХПН не специфичны и могут проявляться при многих заболеваниях. Это: повышенная жажда и усиленный диурез, слабость, апатия, исхудание, снижение аппетита, неприятный запах, язвы во рту и многие другие.

Диагноз ставится на основании клинических симптомов, результатов анализов крови и результатов УЗИ почек.

Лечение: Как таковое к излечению чаще всего не ведет и служит для снижения силы проявления симптомов и продления жизни животного. Лечение сводится к антиитоксикационной терапии — инфузии внутривенные, подкожные, гемо- и перитонеальный диализ, а также препараты защищающие слизистую ЖКТ, антибиотики при необходимости, соответствующая диета.

Что вызывает постренальное острое повреждение почек (ОПП)?

  • Schrier RW, Wang W, Poole B, Mitra A. Острая почечная недостаточность: определения, диагностика, патогенез и терапия. Дж. Клин Инвест . 2004 июл.114 (1): 5-14. [Медлайн]. [Полный текст].

  • Белломо Р., Ронко С., Келлум Дж. А., Мехта Р.Л., Палевски П. Острая почечная недостаточность — определение, критерии исходов, модели на животных, инфузионная терапия и потребности в информационных технологиях: Вторая международная конференция по консенсусу Инициативы по качеству острого диализа (ADQI) Группа. Crit Care . 2004 8 августа (4): R204-12. [Медлайн]. [Полный текст].

  • Mehta RL, Kellum JA, Shah SV, Molitoris BA, Ronco C, Warnock DG, et al. Сеть Acute Kidney Injury Network: отчет об инициативе по улучшению результатов лечения острой почечной недостаточности. Crit Care . 2007. 11 (2): R31. [Медлайн]. [Полный текст].

  • Ронко К., Хаапио М., Хаус А.А., Анавекар Н., Белломо Р. Кардиоренальный синдром. Джам Колл Кардиол . 2008, 4 ноября. 52 (19): 1527-39.[Медлайн].

  • Gandhi S, Fleet JL, Bailey DG, McArthur E, Wald R, Rehman F и др. Взаимодействие блокаторов кальциевых каналов и кларитромицина и острое повреждение почек. JAMA . 2013, 18 декабря. 310 (23): 2544-53. [Медлайн]. [Полный текст].

  • Durand F, Graupera I, Ginès P, Olson JC, Nadim MK. Патогенез гепаторенального синдрома: значение для терапии. Am J Kidney Dis . 2015 21 октября [Medline].

  • Rennie TJW, De Souza N, Donnan PT, Marwick CA, Davey P, Dreischulte T. и др.Риск острого повреждения почек после назначения антибиотиков в сообществе: серия случаев с самоконтролем. Циферблат нефрола . 28 июня 2018 г. [Medline].

  • Талвинг П., Караманос Э., Скиада Д., Лам Л., Тейшейра П.Г., Инаба К. и др. Взаимосвязь повышения уровня креатинкиназы и острого повреждения почек у детей с травмами. J Хирург для неотложной помощи при травмах . 2013 Март 74 (3): 912-6. [Медлайн].

  • Mancini E, Caramelli F, Ranucci M, et al.Связано ли время на искусственное кровообращение во время кардиохирургической операции с острым повреждением почек, требующим диализа? Хемодиал Инт . 2011 8 ноября [Medline].

  • Ronco C, Reis T, Husain-Syed F. Управление острым повреждением почек у пациентов с COVID-19. Ланцет Респир Мед . 2020 Июль 8 (7): 738-742. [Медлайн]. [Полный текст].

  • Али Х., Дауд А., Мохамед М.М., Салим С.А., Есаян Л., Бахарани Дж. И др. Выживаемость пациентов с острым повреждением почек и COVID-19: систематический обзор и метаанализ. Ren Fail . 2020 Ноябрь 42 (1): 393-397. [Медлайн]. [Полный текст].

  • Batlle D, Soler MJ, Sparks MA, Hiremath S, South AM, Welling PA, et al. Острая травма почек при COVID-19: новые свидетельства отчетливой патофизиологии. Дж. Ам Соц Нефрол . 2020 31 июля (7): 1380-1383. [Медлайн]. [Полный текст].

  • Надим МК, Forni LG, Mehta RL, ET AL. Острое повреждение почек, связанное с COVID-19: согласованный отчет 25-й Рабочей группы Инициативы по качеству острых заболеваний (ADQI). Нат Рев Нефрол . 2020 16 (12) декабря: 747-764. [Медлайн]. [Полный текст].

  • Kheterpal S, Tremper KK, Heung M, Rosenberg AL, Englesbe M, Shanks AM и др. Разработка и проверка индекса риска острого повреждения почек для пациентов, перенесших общую операцию: результаты из национального набора данных. Анестезиология . 2009 Март 110 (3): 505-15. [Медлайн].

  • Ronco C, Bellomo R, Kellum JA. Острая травма почек. Ланцет .2019 23 ноября. 394 (10212): 1949-1964. [Медлайн].

  • Панек Р., Теннанкоре К.К., Киберд Б.А. Частота, этиология и значение острого повреждения почек в ранний период после трансплантации почки. Клиническая трансплантация . 2015 24 октября [Medline]. [Полный текст].

  • Harding JL, Li Y, Burrows NR, Bullard KM, Pavkov ME. Тенденции в США госпитализации при острой почечной недостаточности, требующей диализа, у людей с диабетом и без него. Am J Kidney Dis .2020 июн.75 (6): 897-907. [Медлайн].

  • Холмс Дж., Райнер Т., Джин Дж., Робертс Дж., Мэй К., Уилсон Н. и др. Острая травма почек в эпоху оповещения AKI E-Alert. Clin J Am Soc Nephrol . 2016 28 октября. [Medline].

  • Алобайди Р., Морган С., Голдштейн С.Л., Багшоу С.М. Популяционная эпидемиология и исходы острой почечной недостаточности у детей в критическом состоянии. Pediatr Crit Care Med . 2020 21 января (1): 82-91. [Медлайн].

  • Feest TG, Mistry CD, Grimes DS, Mallick NP.Частота прогрессирующей хронической почечной недостаточности и необходимость заместительной почечной терапии в конечной стадии. BMJ . 20 октября 1990 г. 301 (6757): 897-900. [Медлайн]. [Полный текст].

  • Панну Н., Джеймс М., Хеммельгарн Б.Р., Донг Дж., Тонелли М., Кларенбах С. Модификация исходов после острой травмы почек при наличии ХБП. Am J Kidney Dis . 2011 Август 58 (2): 206-13. [Медлайн].

  • Ван А.Ю., Белломо Р., Касс А., Финфер С., Гаттас Д., Майбург Дж. И др.Связанное со здоровьем качество жизни выживших после острой почечной недостаточности: исследование долгосрочных результатов рандомизированной оценки результатов исследования заместительной терапии нормального и повышенного уровней. Нефрология (Карлтон) . 2015 июл.20 (7): 492-8. [Медлайн].

  • Uchino S, Kellum JA, Bellomo R, Doig GS, Morimatsu H, Morgera S и др. Острая почечная недостаточность у пациентов в критическом состоянии: многонациональное многоцентровое исследование. JAMA . 2005 17 августа. 294 (7): 813-8.[Медлайн].

  • Багшоу С.М., Учино С., Белломо Р., Моримацу Х., Моргера С., Шетц М. и др. Острое септическое повреждение почек у тяжелобольных: клиническая характеристика и исходы. Clin J Am Soc Nephrol . 2007 май. 2 (3): 431-9. [Медлайн].

  • Риччи З., Круз Д., Ронко С. Критерии RIFLE и смертность при остром повреждении почек: систематический обзор. Почки Инт . Март 2008 г., 73 (5): 538-46. [Медлайн].

  • граммов ME, Estrella MM, Coresh J, Brower RG, Liu KD.Баланс жидкости, использование диуретиков и смертность при острой почечной недостаточности. Clin J Am Soc Nephrol . 2011 Май. 6 (5): 966-973. [Медлайн]. [Полный текст].

  • Джеймс М.Т., Хеммельгарн Б.Р., Вибе Н., Панну Н., Маннс Б.Дж., Кларенбах СВ и др. Скорость клубочковой фильтрации, протеинурия, частота и последствия острого повреждения почек: когортное исследование. Ланцет . 18 декабря 2010 г. 376 (9758): 2096-103. [Медлайн].

  • Уол Т.С., Грэм Л.А., Моррис М.С., Ричман Дж.С., Холлис Р.Х., Джонс С.Э. и др.Связь между предоперационной протеинурией и послеоперационной острой почечной недостаточностью и повторной госпитализацией. JAMA Surg . 2018 3 июля. E182009. [Медлайн].

  • Philips B, MacPhee I. Предотвращают ли статины острое повреждение почек ?. Мнение экспертов по наркотикам Saf . 2015 14 октября (10): 1547-61. [Медлайн].

  • Дормут С.Р., Хеммельгарн Б.Р., Патерсон Дж.М., Джеймс М.Т., Тир Г.Ф., Раймонд С.Б. и др. Использование высокоэффективных статинов и частота госпитализаций по поводу острого повреждения почек: многоцентровый ретроспективный наблюдательный анализ административных баз данных. BMJ . 2013 18 марта. 346: f880. [Медлайн]. [Полный текст].

  • Джакоппо Д., Каподанно Д., Капранцано П., Арута П., Тамбурино С. Мета-анализ рандомизированных контролируемых исследований предпроцедурного введения статинов для уменьшения острого повреждения почек, вызванного контрастированием, у пациентов, перенесших коронарную катетеризацию. Ам Дж. Кардиол . 2014 15 августа. 114 (4): 541-8. [Медлайн].

  • Marenzi G, Cosentino N, Werba JP, Tedesco CC, Veglia F, Bartorelli AL.Метаанализ рандомизированных контролируемых исследований статинов для профилактики острого повреждения почек, вызванного контрастированием, у пациентов с острым коронарным синдромом и без него. Инт Дж. Кардиол . 2015 15 марта. 183: 47-53. [Медлайн].

  • Молнар А.О., Кока С.Г., Деверо П.Дж., Джайн А.К., Китчлу А., Луо Дж. И др. Использование статинов снижает частоту острого повреждения почек после обширных плановых операций. Дж. Ам Соц Нефрол . 2011 Май. 22 (5): 939-46. [Медлайн].[Полный текст].

  • Pan SY, Wu VC, Huang TM, Chou HC, Ko WJ, Wu KD, et al. Влияние предоперационной терапии статинами на послеоперационное острое повреждение почек у пациентов, перенесших серьезное хирургическое вмешательство: системный обзор и метаанализ. Нефрология (Карлтон) . 2014 декабря 19 (12): 750-63. [Медлайн].

  • Левицки М., Нг I, Шнайдер АГ. Ингибиторы ГМГ-КоА-редуктазы (статины) для предотвращения острого повреждения почек после хирургических вмешательств, требующих обходного сердечного пути. Кокрановская база данных Syst Rev . 2015 11 марта: CD010480. [Медлайн].

  • Kuhn EW, Slottosch I, Wahlers T, Liakopoulos OJ. Предоперационная терапия статинами для пациентов, перенесших кардиохирургические вмешательства. Кокрановская база данных Syst Rev . 2015 13 августа 8: CD008493. [Медлайн].

  • Ван Дж, Гу С., Гао М., Ю. В., Ю. Ю. Предоперационная терапия статинами и почечные исходы после кардиохирургии: мета-анализ и мета-регресс 59 771 пациента. Банка J Cardiol . 2015 31 августа (8): 1051-60. [Медлайн].

  • Галлахер М., Касс А, Белломо Р., Финфер С., Гаттас Д., Ли Дж. И др. Долгосрочная выживаемость и зависимость от диализа после острого повреждения почек в отделении интенсивной терапии: расширенное наблюдение в рандомизированном контролируемом исследовании. PLoS Med . 2014 11 февраля (2): e1001601. [Медлайн]. [Полный текст].

  • [Рекомендации] Национальный центр клинических рекомендаций (Великобритания). Острая почечная травма: профилактика, выявление и лечение вплоть до заместительной почечной терапии.2013 август [Medline]. [Полный текст].

  • Billings FT 4th, Pretorius M, Schildcrout JS, Mercaldo ND, Byrne JG, Ikizler TA, et al. Ожирение и оксидативный стресс являются предикторами ОПН после кардиохирургии. Дж. Ам Соц Нефрол . 2012 июл.23 (7): 1221-8. [Медлайн]. [Полный текст].

  • Кельц Р.Р., Рейнке С.Е., Зубизаррета Дж.Р., Ван М., Сайниш П., Эвен-Шошан О. и др. Острое повреждение почек, почечная функция и пожилой хирургический пациент с ожирением: согласованное исследование случай-контроль. Энн Сург . 2013 Август 258 (2): 359-63. [Медлайн]. [Полный текст].

  • Soto GJ, Frank AJ, Christiani DC, Gong MN. Индекс массы тела и острое повреждение почек при остром респираторном дистресс-синдроме. Crit Care Med . 2012 Сентябрь 40 (9): 2601-8. [Медлайн]. [Полный текст].

  • Данцигер Дж., Чен К.П., Ли Дж., Фэн М., Марк Р.Г., Сели Л.А. и др. Ожирение, острая травма почек и смертность при критических заболеваниях. Crit Care Med .2015 22 октября [Medline].

  • Американский колледж радиологии. Критерии соответствия ACR® почечная недостаточность. Национальный информационный центр руководящих принципов. Доступно по адресу http://guideline.gov/content.aspx?id=13685. Доступ: 24 марта 2011 г.

  • Koyner JL, Davison DL, Brasha-Mitchell E, Chalikonda DM, Arthur JM, Shaw AD, et al. Стресс-тест на фуросемид и биомаркеры для прогнозирования тяжести ОПП. Дж. Ам Соц Нефрол . 2015 26 августа (8): 2023–31.[Медлайн]. [Полный текст].

  • Chawla LS, Davison DL, Brasha-Mitchell E, Koyner JL, Arthur JM, Shaw AD, et al. Разработка и стандартизация стресс-теста на фуросемид для прогнозирования тяжести острого повреждения почек. Crit Care . 2013 20 сентября. 17 (5): R207. [Медлайн]. [Полный текст].

  • Lowes R. FDA одобряет NephroCheck для оценки риска острой почечной недостаточности. Медицинские новости Medscape . 5 сентября 2014 г. [Полный текст].

  • Tuladhar SM, Püntmann VO, Soni M, Punjabi PP, Bogle RG.Быстрое выявление острого повреждения почек липокалином, ассоциированным с желатиназой нейтрофилов плазмы и мочи, после искусственного кровообращения. J Cardiovasc Pharmacol . 2009 Март 53 (3): 261-6. [Медлайн].

  • Брейдтхард Т., Крист-Крейн М., Штольц Д. и др. Комбинированная кардиоренальная оценка для прогнозирования острого повреждения почек при инфекциях нижних дыхательных путей. Am J Med . 2012 Февраль 125 (2): 168-75. [Медлайн].

  • Холл И.Е., Кока С.Г., Перазелла М.А. и др.Риск плохих результатов с новыми и традиционными биомаркерами при клинической диагностике ОПП. Clin J Am Soc Nephrol . 2011 Декабрь 6 (12): 2740-9. [Медлайн].

  • Спахиллари А., Парих ЧР, Синт К., Койнер Дж.Л., Патель УД и др. Цистатин С в сыворотке по сравнению с определениями острого повреждения почек после кардиохирургии на основе креатинина: проспективное когортное исследование. Am J Kidney Dis . 2012 декабрь 60 (6): 922-9. [Медлайн]. [Полный текст].

  • Наингголан Л.Два антигипертензивных средства плюс НПВП повышают риск острой почечной недостаточности. Два антигипертензивных средства плюс НПВП повышают риск острой почечной недостаточности. Heartwire. 9 января 2013 г. [Полный текст].

  • Lapi F, Azoulay L, Yin H, Nessim SJ, Suissa S. Одновременное применение диуретиков, ингибиторов ангиотензинпревращающего фермента и блокаторов рецепторов ангиотензина с нестероидными противовоспалительными препаратами и риск острого повреждения почек: вложенный случай-контроль изучение. BMJ . 2013 8 января. 346: e8525. [Медлайн].[Полный текст].

  • Hammoud K, Brimacombe M, Yu A, Goodloe N, Haidar W., El Atrouni W. Ванкомицин Желудок и острая травма почек: большая ретроспектива, когортное исследование. Ам Дж. Нефрол . 2016 28 октября. 44 (6): 456-461. [Медлайн].

  • Lauschke A, Teichgräber UK, Frei U, Eckardt KU. Низкие дозы дофамина ухудшают перфузию почек у пациентов с острой почечной недостаточностью. Почки Инт . 2006 май. 69 (9): 1669-74. [Медлайн].

  • Маседо Э., Мехта Р.Л.Когда следует начинать заместительную почечную терапию при остром повреждении почек? Семин Наберите . 2011 март-апрель. 24 (2): 132-7. [Медлайн].

  • Палевски П.М., Чжан Дж. Х., О’Коннор Т.З., Чертов Г.М., Кроули С.Т., Чоудхури Д. и др. Интенсивность почечной поддержки у тяжелобольных с острым повреждением почек. N Engl J Med . 2008 г. 3 июля. 359 (1): 7-20. [Медлайн]. [Полный текст].

  • Панну Н., Маннс Б., Ли Х., Тонелли М. Систематический обзор влияния N-ацетилцистеина на контрастную нефропатию. Почки Инт . 2004 апр. 65 (4): 1366-74. [Медлайн].

  • Marenzi G, Assanelli E, Marana I, Lauri G, Campodonico J, Grazi M, et al. N-ацетилцистеин и нефропатия, индуцированная контрастом, при первичной ангиопластике. N Engl J Med . 2006, 29 июня. 354 (26): 2773-82. [Медлайн].

  • Majumdar SR, Kjellstrand CM, Tymchak WJ, Hervas-Malo M, Taylor DA, Teo KK. Принудительный эуволемический диурез с применением маннита и фуросемида для профилактики контрастно-индуцированной нефропатии у пациентов с ХБП, которым проводится коронарная ангиография: рандомизированное контролируемое исследование. Am J Kidney Dis . 2009 Октябрь 54 (4): 602-9. [Медлайн].

  • Ян Б., Сюй Дж., Сюй Ф., Цзоу З., Е С, Мэй С. и др. Внутрисосудистое введение маннита для профилактики острого повреждения почек: систематический обзор и метаанализ. PLoS One . 2014 14 января. 9 (1): e85029. [Медлайн]. [Полный текст].

  • Chorin E, Ben-Assa E, Konigstein M, Rofe MT, Hochstadt A, Galli N, et al. Профилактика постпроцедурного острого повреждения почек в лаборатории катетеризации у реальной популяции. Инт Дж. Кардиол . 2016 Октябрь 11, 226: 42-47. [Медлайн].

  • Briguori C. Система Renalguard у пациентов с высоким риском острого повреждения почек, вызванного контрастированием. Минерва Кардиоангиол . 2012 июн. 60 (3): 291-7. [Медлайн].

  • Бригуори С., Висконти Г., Фокаччо А., Аирольди Ф., Валгимигли М., Сангиорги Г.М. и др. Почечная недостаточность после введения контрастного вещества, испытание II (РЕМЕДИАЛ II): система RenalGuard у пациентов с высоким риском острого повреждения почек, вызванного контрастированием. Тираж . 2011 сентябрь 13, 124 (11): 1260-9. [Медлайн].

  • Снижение случаев нефропатии, индуцированной контрастом. RenalGuard. Доступно на http://www.renalguard.com/. Дата обращения: 23 декабря 2020 г.

  • Zarbock A, Schmidt C, Van Aken H, Wempe C, Martens S, Zahn PK и др. Влияние отдаленной ишемической предварительной подготовки на повреждение почек у пациентов из группы высокого риска, перенесших кардиохирургические операции: рандомизированное клиническое исследование. JAMA .2015, 2 июня. 313 (21): 2133-41. [Медлайн].

  • Захариас М., Мугавар М., Хербисон Г.П., Уокер Р.Дж., Оганесян К., Сивалингам П. и др. Вмешательства для защиты функции почек в периоперационном периоде. Кокрановская база данных Syst Rev . 2013 11 сентября. 9: CD003590. [Медлайн].

  • Хо К.М., Морган Диджей. Мета-анализ N-ацетилцистеина для предотвращения острой почечной недостаточности после обширного хирургического вмешательства. Am J Kidney Dis . 2009 Январь 53 (1): 33-40.[Медлайн].

  • Постпочечная недостаточность

    2, 7163005

    Определение (NCI_CTCAE) Расстройство, характеризующееся блокировкой нормального оттока содержимого мочевыводящих путей.
    Определение (NCI) Блокировка нормального оттока содержимого мочевыводящих путей.
    Концепции Заболевание или синдром
    ( T047 )

    ICD9 599,60, 599,6
    ICD10

    N13.9

    SnomedCT

    266567006, 266636004, 197

    Английский Обструкция мочевыводящих путей неуточненная, обструкция мочевыводящих путей неуточненная, обструктивная уропатия (диагноз), обструктивная уропатия, обструкция мочевыводящих путей (диагноз), обструкция мочевыводящих путей (диагноз), непроходимость мочевыводящих путей, обструкция мочевыводящих путей, обструкция мочевыводящих путей БДУ, обструктивная уропатия, непроходимость мочевыводящих путей, Обструкция мочевыводящих путей БДУ, обструктивные уропатии, непроходимость мочевыводящих путей, непроходимость мочевыводящих путей, непроходимость мочевыводящих путей, непроходимость мочевыводящих путей, непроходимость мочевыводящих путей, неуточненная непроходимость мочевыводящих путей, неуточненная непроходимость (нарушение) мочевыводящих путей, обструктивная уропатия, неуточненная, обструктивная уропатия, непроходимость мочевыводящих путей, мочевыводящие пути непроходимость (беспорядок), непроходимость; мочевой, обструктивный; уропатия мочевыводящая; непроходимость, уропатия; обструктивная, Обструктивная уропатия, БДУ, Обструкция мочевыводящих путей, БДУ, Обструктивная уропатия, Непроходимость мочевыводящих путей, неуточненная, Обструктивная уропатия БДУ, Обструкция мочевыводящих путей БДУ
    Итальянский Ostruzione delle vie urinarie, Uropatia ostruttiva, Ostruzione urinaria, неспецифическая, Ostruzione delle vie urinarie NAS
    Голландский уропатия, непроходимость мочи, NAO, непроходимость мочи, неспецифичность, непроходимость; моча, непроходимость; уропатия, моча; непроходимость, уропатия; обструкция, обструктивная уропатия, моча
    Французский Непреодолимая закупорка мочеиспускания, Обструкция мочеиспускания SAI, Обструкция мочеиспускания, обструктивная уропатия
    Немецкий Harnwegsobstruktion NNB, Harnwegsobstruktion unspezifisch, Uropathie obstruktiv, Harnwegsobstruktion, обструктивная Uropathie
    Португальский Obstrução das vias urinárias NE, Obstrução urinária NE, Uropatia obstrutiva, Obstrução das vias urinárias
    Испанский Obstrucción urinaria нет especificada, Obstrucción дель TRACTO urinario NEOM, obstrucción urinaria нет especificada, obstrucción urinaria нет especificada (trastorno), obstrucción-де-лас ВИАС urinarias, obstrucción urinaria, uropatía obstructiva (trastorno), uropatía obstructiva, Obstrucción дель TRACTO urinario, Uropatía obstructiva
    Японский 尿路 閉塞 症 、 詳細 不明, 尿路 閉塞 NOS, 尿路 閉塞, 閉塞 性 尿路 疾患, ニ ョ ウ ロ NOS, ニ ョ ウ ロ ヘ ソ ク シ ョ ウ シ ョ サ イ
    Чешский Blíže nerčená obstrukce močového ústrojí, Obstrukce močového ústrojí NOS, Obstrukční uropatie, Obstrukce močového ústrojí
    Венгерский обструктивная уропатия, húgyúti obstructio k.m.n., húgyúti obstructio, Húgyúti obstructio, nem meghatározott, Obstructiv uropathia

    Послеоперационное острое повреждение почек при несердечной хирургии у взрослых: совместный консенсусный отчет Инициативы по качеству острых заболеваний и Инициативы по обеспечению качества периоперационных заболеваний

  • 1.

    Pearse, R.M. et al. Смертность после операции в Европе: 7-дневное когортное исследование. Ланцет 380 , 1059–1065 (2012).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 2.

    Гамейро, Дж., Фонсека, Дж. А., Невес, М., Хорхе, С. и Лопес, Дж. А. Острое повреждение почек при обширной абдоминальной хирургии: частота, факторы риска, патогенез и исходы. Ann. Интенсивная терапия 8 , 22 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 3.

    Меерш, М., Шмидт, К. и Зарбок, А. Периоперационное острое повреждение почек: недостаточно изученная проблема. Anesth. Анальг. 125 , 1223–1232 (2017).

    PubMed
    Статья

    Google Scholar

  • 4.

    О’Коннор, М. Э., Кирван, К. Дж., Пирс, Р. М. и Проул, Дж. Р. Заболеваемость и ассоциации острых повреждений почек после обширных операций на брюшной полости. Intensive Care Med. 42 , 521–530 (2016).

    PubMed
    Статья

    Google Scholar

  • 5.

    Белл, С.& Prowle, J. Послеоперационная профилактика ОПП лучше лечения? J. Am. Soc. Нефрол. 30 , 4–6 (2019).

    PubMed
    Статья

    Google Scholar

  • 6.

    Bihorac, A. et al. Долгосрочный риск смерти и острого повреждения почек во время госпитализации после обширной операции. Ann. Surg. 249 , 851–858 (2009).

    PubMed
    Статья

    Google Scholar

  • 7.

    Чавла Л. С., Эггерс П. В., Стар Р. А. и Киммел П. Л. Острое повреждение почек и хроническое заболевание почек как взаимосвязанные синдромы. N. Engl. J. Med. 371 , 58–66 (2014).

    PubMed
    Статья
    CAS

    Google Scholar

  • 8.

    Надим, М. К. и др. Острое повреждение почек, связанное с сердечной и сосудистой хирургией: 20-я Международная консенсусная конференция группы ADQI (Acute Disease Quality Initiative). J Am. Сердце доц. 7 , e008834 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 9.

    Группа международного исследования хирургических результатов (ISOS). Глобальные исходы для пациентов после плановой хирургии: проспективное когортное исследование в 27 странах с низким, средним и высоким уровнем доходов. руб. J. Anaesth. 117 , 601–609 (2016).

    Артикул

    Google Scholar

  • 10.

    Келлум, Дж. А., Белломо, Р. и Ронко, К. Инициатива по качеству острого диализа (ADQI): методология. Внутр. J. Artif. Органы 31 , 90–93 (2008).

    CAS
    PubMed
    Статья

    Google Scholar

  • 11.

    Alonso-Coello, P. et al. Структуры от доказательств к решению (EtD) GRADE: систематический и прозрачный подход к принятию обоснованных решений в области здравоохранения. 1. Введение. BMJ 353 , i2016 (2016).

    PubMed
    Статья

    Google Scholar

  • 12.

    Вайкар С. и МакМахон Г. М. Расширение роли биопсии почек при остром повреждении почек. Семин. Нефрол. 38 , 12–20 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 13.

    Darmon, M. et al. Диагностическое обследование и конкретные причины острого повреждения почек. Intensive Care Med. 43 , 829–840 (2017).

    PubMed
    Статья

    Google Scholar

  • 14.

    Окуса М. Д., Рознер М. Х., Келлум Дж. А. и Ронко С. Терапевтические цели ОПП человека: гармонизация ОПП человека и животных. J. Am. Soc. Нефрол. 27 , 44–48 (2016).

    CAS
    PubMed
    Статья

    Google Scholar

  • 15.

    Бонвентре, Дж. В. и Янг, Л. Клеточная патофизиология ишемического острого повреждения почек. J. Clin. Вкладывать деньги. 121 , 4210–4221 (2011).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 16.

    Linkermann, A. et al. Регулируемая гибель клеток при ОПП. J. Am. Soc. Нефрол. 25 , 2689–2701 (2014).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 17.

    Саттон, Т. А., Фишер, К. Дж. И Молиторис, Б. А. Повреждение и дисфункция эндотелия микрососудов во время ишемической острой почечной недостаточности. Kidney Int. 62 , 1539–1549 (2002).

    CAS
    PubMed
    Статья

    Google Scholar

  • 18.

    Григорьев Д.Н. и др. Местный и системный воспалительный транскриптом после острого повреждения почек. J. Am. Soc. Нефрол. 19 , 547–558 (2008).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 19.

    Chronopoulos, A., Cruz, D. N. & Ronco, C. Острое повреждение почек, приобретенное в больнице, у пожилых людей. Нат. Преподобный Нефрол. 6 , 141–149 (2010).

    PubMed
    Статья

    Google Scholar

  • 20.

    Келлум, Дж. А. и Проул, Дж. Р. Парадигмы острого повреждения почек в условиях интенсивной терапии. Нат. Преподобный Нефрол. 14 , 217–230 (2018).

    PubMed
    Статья

    Google Scholar

  • 21.

    Hoste, E. A. J. et al. Глобальная эпидемиология и исходы острого повреждения почек. Нат. Преподобный Нефрол. 14 , 607–625 (2018).

    CAS
    PubMed
    Статья

    Google Scholar

  • 22.

    McIlroy, D. R. et al. Систематический обзор и согласованные определения для инициативы стандартизированных конечных точек в периоперационной медицине (StEP): конечные точки для почек. руб. J. Anaesth. 121 , 1013–1024 (2018).

    CAS
    PubMed
    Статья

    Google Scholar

  • 23.

    Абдулла, Х. Р. и др. Предикторы периоперационного острого повреждения почек у пациентов с ожирением, перенесших лапароскопическую бариатрическую операцию: одноцентровое ретроспективное когортное исследование. Obes. Surg. 26 , 1493–1499 (2016).

    PubMed
    Статья

    Google Scholar

  • 24.

    Белл, С., Ренни, Т., Марвик, С. А. и Дэйви, П. Влияние периоперационных нестероидных противовоспалительных препаратов на послеоперационную функцию почек у взрослых с нормальной функцией почек. Кокрановская база данных Syst. Ред. 11 , CD011274 (2018).

    PubMed

    Google Scholar

  • 25.

    Bihorac, A. et al. Национальная программа повышения качества хирургии недооценивает риск, связанный с острым послеоперационным повреждением почек легкой и средней степени тяжести. Крит. Care Med. 41 , 2570–2583 (2013).

    PubMed
    Статья

    Google Scholar

  • 26.

    Bonavia, A. et al. Блокада ангиотензиновой оси, острое повреждение почек и периоперационная заболеваемость у пациентов, перенесших колоректальную операцию: ретроспективное когортное исследование. Медицина 98 , e16872 (2019).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 27.

    Doyle, J. F. et al. Снижает ли внедрение пакета услуг по повышению качества частоту острых повреждений почек у пациентов, перенесших экстренную лапаротомию? J. Clin. Med. 8 , 1265 (2019).

    PubMed Central
    Статья
    PubMed

    Google Scholar

  • 28.

    Lands, V. W. et al. Снижение гипотонии и острого повреждения почек в популяции выборной тотальной артропластики сустава: мультидисциплинарный подход. J. Артропластика 33 , 1686–1692 (2018).

    PubMed
    Статья

    Google Scholar

  • 29.

    Long, T. E. et al. Острое повреждение почек после абдоминальной операции: частота, факторы риска и исход. Anesth. Анальг. 122 , 1912–1920 (2016).

    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 30.

    Раджан, С.и другие. Периоперационные факторы, связанные с острым повреждением почек после частичной нефрэктомии. руб. J. Anaesth. 116 , 70–76 (2016).

    CAS
    PubMed
    Статья

    Google Scholar

  • 31.

    Грамм, M. E. et al. Острое повреждение почек после серьезного хирургического вмешательства: ретроспективный анализ данных Управления здравоохранения ветеранов. Am. J. Kidney Dis. 67 , 872–880 (2016).

    PubMed
    Статья

    Google Scholar

  • 32.

    Майлс, П. С., Макилрой, Д. Р., Белломо, Р. и Уоллес, С. Важность интраоперационной олигурии во время обширной абдоминальной хирургии: результаты исследования ограничительной и либеральной жидкостной терапии в крупной абдоминальной хирургии. руб. J. Anaesth. 122 , 726–733 (2019).

    PubMed
    Статья

    Google Scholar

  • 33.

    Shiba, A., Uchino, S., Fujii, T., Takinami, M. & Uezono, S. Связь между интраоперационной олигурией и острым повреждением почек после серьезной некардиальной хирургии. Anesth. Анальг. 127 , 1229–1235 (2018).

    PubMed
    Статья

    Google Scholar

  • 34.

    Kheterpal, S. et al. Предикторы послеоперационной острой почечной недостаточности после внесердечных операций у пациентов с ранее нормальной функцией почек. Анестезиология 107 , 892–902 (2007).

    PubMed
    Статья

    Google Scholar

  • 35.

    Alpert, R.A. et al. Интраоперационный диурез не позволяет прогнозировать послеоперационную функцию почек у пациентов, перенесших реваскуляризацию брюшной аорты. Хирургия 95 , 707–711 (1984).

    CAS
    PubMed

    Google Scholar

  • 36.

    Joannidis, M. et al. Использование биомаркеров остановки клеточного цикла в сочетании с классическими маркерами острого повреждения почек. Крит. Care Med. 47 , e820 – e826 (2019).

    CAS
    PubMed
    Статья

    Google Scholar

  • 37.

    Quan, S. et al. Прогностические последствия добавления диуреза к измерениям креатинина сыворотки для определения стадии острого повреждения почек после обширного хирургического вмешательства: когортное исследование. Нефрол Циферблат. Транспл. 31 , 2049–2056 (2016).

    CAS
    Статья

    Google Scholar

  • 38.

    Келлум, Дж.A. et al. Классификация ОПП по диурезу и уровню креатинина в сыворотке. J. Am. Soc. Нефрол. 26 , 2231–2238 (2015).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 39.

    Gameiro, J. et al. Острое повреждение почек, отдаленная функция почек и смертность у пациентов, перенесших серьезную абдоминальную операцию: когортный анализ. Clin. Почки J. 9 , 192–200 (2016).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 40.

    Zarbock, A., Koyner, J. L., Hoste, E. A. J. & Kellum, J. A. Последние данные о периоперационном остром повреждении почек. Anesth. Анальг. 127 , 1236–1245 (2018).

    PubMed
    Статья

    Google Scholar

  • 41.

    Grams, M. E. et al. Эффективность и ограничения административных данных при идентификации ОПП. Clin. Варенье. Soc. Нефрол. 9 , 682–689 (2014).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 42.

    Kellum, J. A., Lameire, N. & KDIGO AKI Guideline Work Group. Диагностика, оценка и лечение острого повреждения почек: резюме KDIGO (Часть 1). Крит. Уход 17 , 204 (2013).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 43.

    Grams, M. E. et al. Возможные суррогатные конечные точки для ESRD после AKI. J. Am. Soc. Нефрол. 27 , 2851–2859 (2016).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 44.

    James, M. T. et al. Заболеваемость и прогноз острых заболеваний и расстройств почек с использованием комплексного подхода к лабораторным измерениям в универсальной системе здравоохранения. JAMA Netw. Открыть 2 , e1 (2019).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 45.

    Kheterpal, S. et al. Разработка и проверка индекса риска острого повреждения почек для пациентов, перенесших общую операцию: результаты из национального набора данных. Анестезиология 110 , 505–515 (2009).

    PubMed
    Статья

    Google Scholar

  • 46.

    Bell, S. et al.Риск послеоперационного острого повреждения почек у пациентов, перенесших ортопедические операции — разработка и подтверждение оценки риска и влияния острого повреждения почек на выживаемость: наблюдательное когортное исследование. BMJ 351 , h5639 (2015).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 47.

    Джордж, Л. К. и др. Связь предоперационной альбуминурии с послеоперационными исходами после аортокоронарного шунтирования. Sci. Отчет 5 , 16458 (2015).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 48.

    Grams, M. E. et al. Мета-анализ связи предполагаемой СКФ, альбуминурии, возраста, расы и пола с острым повреждением почек. Am. J. Kidney Dis. 66 , 591–601 (2015).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 49.

    James, M. T. et al. Метаанализ связи предполагаемой СКФ, альбуминурии, сахарного диабета и артериальной гипертензии с острым повреждением почек. Am. J. Kidney Dis. 66 , 602–612 (2015).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 50.

    Wahl, T. S. et al. Связь между предоперационной протеинурией и послеоперационным острым повреждением почек и повторной госпитализацией. JAMA Surg. 153 , e182009 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 51.

    Ли, С., Ван, С., Приянка, П. и Келлум, Дж. А. Острое повреждение почек у тяжелобольных пациентов после обширного хирургического вмешательства, не связанного с сердцем: раннее или позднее начало. Крит. Care Med. 47 , e437 – e444 (2019).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 52.

    STARSurg Collaborative.Связь между периоперационными ингибиторами ангиотензин-превращающего фермента и блокаторами рецепторов ангиотензина-2 и острым повреждением почек в основных плановых внесердечных операциях: многоцентровое проспективное когортное исследование. Анестезия 73 , 1214–1222 (2018).

    Артикул
    CAS

    Google Scholar

  • 53.

    Мур П. К., Сюй Р. К. и Лю К. Д. Ведение острого повреждения почек: основной учебный план 2018. Am.J. Kidney Dis. 72 , 136–148 (2018).

    PubMed
    Статья

    Google Scholar

  • 54.

    Kellum, J. A. et al. Заболевание почек: улучшение глобальных результатов (KDIGO) рабочая группа по острому повреждению почек. Руководство KDIGO по клинической практике при остром повреждении почек. Kidney Int. Дополнение 2 , 1–138 (2012).

    Артикул

    Google Scholar

  • 55.

    Wagener, G. et al. Липокалин, связанный с желатиназой нейтрофилов в моче, и острое повреждение почек после кардиохирургических вмешательств. Am. J. Kidney Dis. 52 , 425–433 (2008).

    CAS
    PubMed
    Статья

    Google Scholar

  • 56.

    Стаффорд-Смит, М., Патель, У. Д., Филлипс-Бьют, Б. Г., Шоу, А. Д. и Сваминатан, М. Острое повреждение почек и хроническое заболевание почек после кардиохирургии. Adv. Хроническая болезнь почек. 15 , 257–277 (2008).

    PubMed
    Статья

    Google Scholar

  • 57.

    Sutherland, L. et al. Острое повреждение почек после кардиохирургии: сравнение различных определений. Нефрология 25 , 212–218 (2019).

    PubMed
    Статья
    CAS

    Google Scholar

  • 58.

    Kashani, K. et al. Цели улучшения качества лечения острой почечной недостаточности. Clin. Варенье. Soc. Нефрол. 14 , 941–953 (2019).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 59.

    Bjornsson, T. D. Использование сывороточных концентраций креатинина для определения функции почек. Clin. Фармакокинет. 4 , 200–222 (1979).

    CAS
    PubMed
    Статья

    Google Scholar

  • 60.

    О’Коннор, М.E. et al. Острое повреждение почек и смертность через 1 год после серьезного внесердечного хирургического вмешательства. руб. J. Surg. 104 , 868–876 (2017).

    PubMed
    Статья
    CAS

    Google Scholar

  • 61.

    Chawla, L. S. et al. Острое заболевание почек и восстановление почек: согласованный отчет Рабочей группы 16 «Инициативы по качеству острых заболеваний» (ADQI). Нат. Преподобный Нефрол. 13 , 241–257 (2017).

    PubMed
    Статья

    Google Scholar

  • 62.

    Benoit, S. W. et al. Снижение нефротоксического воздействия антимикробных препаратов снижает ассоциированное острое повреждение почек у педиатрических пациентов с трансплантацией гемопоэтических стволовых клеток. Biol. Blood Marrow Transpl. 25 , 1654–1658 (2019).

    Артикул

    Google Scholar

  • 63.

    Bell, S. et al. Риск ОПН при применении гентамицина в качестве хирургической профилактики. J. Am. Soc. Нефрол. 25 , 2625–2632 (2014).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 64.

    Goldstein, S. L. et al. Программа постоянного повышения качества снижает риск острого повреждения почек, связанного с приемом нефротоксических препаратов. Kidney Int. 90 , 212–221 (2016).

    PubMed
    Статья

    Google Scholar

  • 65.

    Stoops, C. et al. Baby NINJA (Nephrotoxic Injury Negated by Just-in-Time Action): уменьшение острого повреждения почек, связанного с нефротоксическими препаратами, в отделении интенсивной терапии новорожденных. J. Pediatr. 215 , 223–228.e6 (2019).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 66.

    Collaborative, S.T. Связь между периоперационными ингибиторами ангиотензинпревращающего фермента и блокаторами рецепторов ангиотензина-2 и острым повреждением почек в основной плановой внесердечной хирургии: многоцентровое проспективное когортное исследование. Анестезия 73 , 1214–1222 (2018).

    Артикул
    CAS

    Google Scholar

  • 67.

    Миллер Т. Э., Рош А. М. и Митен М. Управление жидкостями и целенаправленная терапия в качестве дополнения к расширенному восстановлению после операции (ERAS). Банка. J. Anaesth. 62 , 158–168 (2015).

    PubMed
    Статья

    Google Scholar

  • 68.

    Myles, P. S. et al. Ограничительная терапия по сравнению с либеральной инфузионной терапией при обширных операциях на брюшной полости. N. Engl. J. Med. 378 , 2263–2274 (2018).

    PubMed
    Статья

    Google Scholar

  • 69.

    Grocott, M. P. et al. Периоперационное увеличение глобального кровотока до четко определенных целей и результатов после операции. Кокрановская база данных Syst. Ред. 11 , CD004082 (2012).

    PubMed

    Google Scholar

  • 70.

    Джильо, М., Дальфино, Л., Пунтилло, Ф. и Бриенца, Н. Гемодинамическая целенаправленная терапия и послеоперационное повреждение почек: обновленный метаанализ с последовательным анализом проб. Крит. Уход 23 , 232 (2019).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 71.

    Sun, L. Y., Wijeysundera, D. N., Tait, G. A. & Beattie, W. S. Связь интраоперационной гипотензии с острым повреждением почек после плановой некардиальной хирургии. Анестезиология 123 , 515–523 (2015).

    PubMed
    Статья

    Google Scholar

  • 72.

    Salmasi, V. et al. Взаимосвязь между интраоперационной гипотензией, определяемой либо снижением от исходного уровня, либо абсолютным порогом, и острым повреждением почек и миокарда после некардиальной хирургии: ретроспективный когортный анализ. Анестезиология 126 , 47–65 (2017).

    PubMed
    Статья

    Google Scholar

  • 73.

    Walsh, M. et al. Связь между интраоперационным средним артериальным давлением и клиническими исходами после внесердечных операций: к эмпирическому определению гипотензии. Анестезиология 119 , 507–515 (2013).

    PubMed
    Статья

    Google Scholar

  • 74.

    Calvo-Vecino, J. M. et al. Влияние целевой гемодинамической терапии на послеоперационные осложнения у хирургических пациентов с низким и средним риском: многоцентровое рандомизированное контролируемое исследование (исследование FEDORA). руб. J. Anaesth. 120 , 734–744 (2018).

    CAS
    PubMed
    Статья

    Google Scholar

  • 75.

    Asfar, P. et al. Целевое значение высокого и низкого артериального давления у пациентов с септическим шоком. N. Engl. J. Med. 370 , 1583–1593 (2014).

    CAS
    PubMed
    Статья

    Google Scholar

  • 76.

    Shaw, A. D. et al. Основные осложнения, летальность и использование ресурсов после открытой абдоминальной хирургии: 0.9% физиологический раствор по сравнению с Plasma-Lyte. Ann. Surg. 255 , 821–829 (2012).

    PubMed
    Статья

    Google Scholar

  • 77.

    Semler, M. W. et al. Сбалансированные кристаллоиды по сравнению с физиологическим раствором у взрослых в критическом состоянии. N. Engl. J. Med. 378 , 829–839 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 78.

    Self, W. H. et al. Сбалансированные кристаллоиды по сравнению с физиологическим раствором у некритически больных взрослых. N. Engl. J. Med. 378 , 819–828 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 79.

    Myburgh, J. A. et al. Гидроксиэтилкрахмал или физиологический раствор для жидкостной реанимации в отделениях интенсивной терапии. N. Engl. J. Med. 367 , 1901–1911 (2012).

    CAS
    PubMed
    Статья

    Google Scholar

  • 80.

    Perner, A. et al. Гидроксиэтилкрахмал 130 / 0,42 по сравнению с ацетатом Рингера при тяжелом сепсисе. N. Engl. J. Med. 367 , 124–134 (2012).

    CAS
    PubMed
    Статья

    Google Scholar

  • 81.

    Gillies, M. A. et al. Частота послеоперационной смерти и острого повреждения почек, связанных с в / в. Использование 6% гидроксиэтилкрахмала: систематический обзор и метаанализ. руб. J. Anaesth. 112 , 25–34 (2014).

    CAS
    PubMed
    Статья

    Google Scholar

  • 82.

    Кабон, Б., Сесслер, Д. И., Курц, А., Исследовательская группа по изучению кристаллоидов и коллоидов. Влияние интраоперационного целенаправленного сбалансированного введения кристаллоидов по сравнению с коллоидными на основную послеоперационную заболеваемость: рандомизированное исследование. Анестезиология 130 , 728–744 (2019).

    PubMed
    Статья

    Google Scholar

  • 83.

    Futier, E. et al. Эффект гидроксиэтилкрахмала по сравнению с физиологическим раствором для объемной заместительной терапии на смерть или послеоперационные осложнения среди пациентов из группы высокого риска, перенесших обширную абдоминальную операцию: рандомизированное клиническое исследование FLASH. JAMA 323 , 225–236 (2020).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 84.

    Sessler, D. I. et al. Зависимые от периода ассоциации между гипотензией во время и в течение четырех дней после некардиальной хирургии и сочетанием инфаркта миокарда и смерти: дополнительное исследование исследования POISE-2. Анестезиология 128 , 317–327 (2018).

    PubMed
    Статья

    Google Scholar

  • 85.

    Futier, E. et al. Влияние индивидуализированных и стандартных стратегий управления артериальным давлением на послеоперационную органную дисфункцию у пациентов из группы высокого риска, перенесших серьезное хирургическое вмешательство: рандомизированное клиническое исследование. JAMA 318 , 1346–1357 (2017).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 86.

    Frisch, A. et al. Распространенность и клинические исходы гипергликемии в периоперационном периоде при внесердечной хирургии. Уход за диабетом 33 , 1783–1788 (2010).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 87.

    Mudumbai, S.C. et al. Риск тридцатидневной смертности, связанный с послеоперационным отказом от приема ингибиторов ангиотензинпревращающего фермента: ретроспективное исследование системы здравоохранения по делам ветеранов. J. Hosp. Med. 9 , 289–296 (2014).

    PubMed
    Статья

    Google Scholar

  • 88.

    Ли, С. М., Такемото, С. и Уоллес, А. В. Связь между отказом от блокаторов рецепторов ангиотензина в раннем послеоперационном периоде и 30-дневной смертностью: когортное исследование системы здравоохранения по делам ветеранов. Анестезиология 123 , 288–306 (2015).

    CAS
    PubMed
    Статья

    Google Scholar

  • 89.

    Marcotte, J.H. et al. Острое повреждение почек после внедрения протокола ускоренного восстановления после операции (ERAS) в колоректальной хирургии. Внутр. J. Colorectal Dis. 33 , 1259–1267 (2018).

    PubMed
    Статья

    Google Scholar

  • 90.

    Schunk, S.J. et al. Связь между dickkopf-3 в моче, острым повреждением почек и последующей потерей функции почек у пациентов, перенесших операцию на сердце: наблюдательное когортное исследование. Ланцет 394 , 488–496 (2019).

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 91.

    Hollinger, A. et al. Проэнкефалин A 119-159 (Penkid) является ранним биомаркером острого септического повреждения почек: исследование почек при сепсисе и септическом шоке (Kid-SSS). Kidney Int. Отчет 3 , 1424–1433 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 92.

    Koyner, J. L. et al. Уровни тканевого ингибитора металлопротеиназы-2 (TIMP-2) IGF-связывающего белка-7 (IGFBP7) связаны с неблагоприятными долгосрочными исходами у пациентов с ОПП. J. Am. Soc. Нефрол. 26 , 1747–1754 (2015).

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 93.

    Kashani, K. et al. Открытие и проверка биомаркеров остановки клеточного цикла при остром повреждении почек у человека. Крит. Уход 17 , R25 (2013).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 94.

    Greenberg, J.H. et al. Биомаркеры прогрессирования ОПП после кардиохирургических вмешательств у детей. J. Am. Soc. Нефрол. 29 , 1549–1556 (2018).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 95.

    Парих, С.R. et al. Послеоперационные биомаркеры позволяют прогнозировать острое повреждение почек и неблагоприятные исходы после кардиохирургических вмешательств у взрослых. J. Am. Soc. Нефрол. 22 , 1748–1757 (2011).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 96.

    Meersch, M. et al. Профилактика ОПП, связанных с кардиохирургическими операциями, путем внедрения рекомендаций KDIGO у пациентов с высоким риском, выявленных с помощью биомаркеров: рандомизированное контролируемое исследование PrevAKI. Intensive Care Med. 43 , 1551–1561 (2017).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 97.

    Gocze, I. et al. Вмешательство на основе биомаркеров для предотвращения острого повреждения почек после обширного хирургического вмешательства: проспективное рандомизированное исследование BigpAK. Ann. Surg. 267 , 1013–1020 (2018).

    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 98.

    Hoste, E. A. et al. Критерии RIFLE для острого повреждения почек связаны с госпитальной летальностью тяжелобольных пациентов: когортный анализ. Крит. Уход 10 , R73 (2006).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 99.

    Uchino, S., Bellomo, R., Goldsmith, D., Bates, S. & Ronco, C. Оценка критериев RIFLE для острой почечной недостаточности у госпитализированных пациентов. Крит.Care Med. 34 , 1913–1917 (2006).

    PubMed
    Статья

    Google Scholar

  • 100.

    Риччи, З., Круз, Д. и Ронко, С. Критерии RIFLE и смертность при остром повреждении почек: систематический обзор. Kidney Int. 73 , 538–546 (2008).

    CAS
    PubMed
    Статья

    Google Scholar

  • 101.

    Joannidis, M. et al.Острое повреждение почек у пациентов в критическом состоянии, классифицированное по AKIN и RIFLE с использованием базы данных SAPS 3. Intensive Care Med. 35 , 1692–1702 (2009).

    PubMed
    Статья

    Google Scholar

  • 102.

    Али Т. и др. Заболеваемость и исходы при остром повреждении почек: всестороннее популяционное исследование. J. Am. Soc. Нефрол. 18 , 1292–1298 (2007).

    CAS
    PubMed
    Статья

    Google Scholar

  • 103.

    Zarbock, A. et al. Влияние раннего и отсроченного начала заместительной почечной терапии на смертность тяжелобольных пациентов с острым повреждением почек: рандомизированное клиническое исследование ELAIN. JAMA 315 , 2190–2199 (2016).

    CAS
    PubMed
    Статья

    Google Scholar

  • 104.

    Gaudry, S. et al. Стратегии начала заместительной почечной терапии в отделении интенсивной терапии. N. Engl. J. Med. 375 , 122–133 (2016).

    PubMed
    Статья

    Google Scholar

  • 105.

    Багшоу, С. М. и др. Сроки начала заместительной почечной терапии при остром повреждении почек. N. Engl. J. Med. 383 , 240–251 (2020).

    CAS
    PubMed
    Статья

    Google Scholar

  • 106.

    Хуэн С. и Парих С. ​​Р. Молекулярное фенотипирование клинического ОПП с новыми биомаркерами в моче. Am. J. Physiol. Renal Physiol. 309 , F406 – F413 (2015).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 107.

    Biteker, M. et al. Заболеваемость, факторы риска и исходы острого периоперационного повреждения почек при внесердечной и несосудистой хирургии. Am. J. Surg. 207 , 53–59 (2014).

    PubMed
    Статья

    Google Scholar

  • 108.

    Hobson, C., Lysak, N., Huber, M., Scali, S. & Bihorac, A. Эпидемиология, исходы и лечение острого повреждения почек у пациента с сосудистой хирургией. J. Vasc. Surg. 68 , 916–928 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 109.

    Kopolovic, I. et al. Факторы риска и исходы, связанные с острым повреждением почек после разрыва аневризмы брюшной аорты. BMC Nephrol. 14 , 99 (2013).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 110.

    Arora, P. et al. Влияние острого повреждения почек после реваскуляризации на развитие хронической болезни почек и смертность пациентов с хронической ишемией конечностей. J. Vasc. Surg. 61 , 720–727 (2015).

    PubMed
    Статья

    Google Scholar

  • 111.

    Дрюс, Дж. Д., Патель, Х. Дж., Уильямс, Д. М., Дасика, Н. Л. и Диб, Г. М. Влияние острой почечной недостаточности на ранние и поздние исходы после эндоваскулярной репарации грудной аорты. Ann. Грудной. Surg. 97 , 2027–2033; обсуждение 2033 (2014).

    PubMed
    Статья

    Google Scholar

  • 112.

    Ozrazgat-Baslanti, T. et al. Острые и хронические заболевания почек и смертность от сердечно-сосудистых заболеваний после обширных операций. Ann. Surg. 264 , 987–996 (2016).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 113.

    Джалалзаде, Х. и др. Долгосрочная выживаемость после острого повреждения почек после восстановления разрыва аневризмы брюшной аорты. J. Vasc. Surg. 66 , 1712–1718.e2 (2017).

    PubMed
    Статья

    Google Scholar

  • 114.

    Ko, T. et al. Влияние острого повреждения почек на ранние и отдаленные исходы у пациентов, перенесших операцию по поводу острого расслоения аорты. Am. J. Cardiol. 116 , 463–468 (2015).

    PubMed
    Статья

    Google Scholar

  • 115.

    Bravi, C.A. et al. Влияние острого повреждения почек и его продолжительность на функцию почек в отдаленном периоде после частичной нефрэктомии. Eur. Урол. 76 , 398–403 (2019).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 116.

    Romagnoli, S. et al. Послеоперационное острое повреждение почек у пациентов из группы высокого риска, перенесших обширные операции на брюшной полости. J. Crit. Уход 35 , 120–125 (2016).

    PubMed
    Статья

    Google Scholar

  • 117.

    Konda, P. et al. Выявление факторов риска, связанных с послеоперационным острым повреждением почек после эзофагэктомии по поводу рака пищевода. J. Cardiothorac. Васк. Анест. 31 , 474–481 (2017).

    PubMed
    Статья

    Google Scholar

  • 118.

    Porter, A.C. et al. Предикторы и исходы качества жизни, связанного со здоровьем, у взрослых с ХБП. Clin. Варенье. Soc. Нефрол. 11 , 1154–1162 (2016).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 119.

    Chao, C.T. et al. Острое повреждение почек, требующее диализа, увеличивает риск долгосрочного злокачественного новообразования: популяционное исследование. J. Cancer Res. Clin. Онкол. 140 , 613–621 (2014).

    CAS
    PubMed
    Статья

    Google Scholar

  • 120.

    Сильвер, С. А. и Сью, Э. Д. Последующее наблюдение при остром повреждении почек: потеряно в переходный период. Adv. Хроническая болезнь почек. 24 , 246–252 (2017).

    PubMed
    Статья

    Google Scholar

  • 121.

    Mehta, S. et al. Прогностическое значение продолжительности ОПП: систематический обзор и метаанализ. BMC Nephrol. 19 , 91 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 122.

    См. E. J. et al. Долгосрочный риск неблагоприятных исходов после острого повреждения почек: систематический обзор и метаанализ когортных исследований с использованием согласованных определений воздействия. Kidney Int. 95 , 160–172 (2019).

    PubMed
    Статья

    Google Scholar

  • 123.

    Hsu, C. Y. et al. Протеинурия после острого повреждения почек и последующее прогрессирование заболевания почек: оценка, серийная оценка и последующие последствия в исследовании острой почечной недостаточности (ASSESS-AKI). JAMA Intern. Med. 180 , 402–410 (2020).

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 124.

    Ostermann, M. et al. Лекарственное обеспечение при остром заболевании почек — отчет XVI заседания инициативы по качеству острых заболеваний. руб. J. Clin. Pharmacol. 84 , 396–403 (2018).

    PubMed
    Статья

    Google Scholar

  • 125.

    Brar, S. et al. Связь применения ингибитора ангиотензинпревращающего фермента или блокатора рецептора ангиотензина с исходами после острого повреждения почек. JAMA Intern. Med. 178 , 1681–1690 (2018).

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • Почечная активация белка остеопонтина и мРНК при острой нефротоксичности у крыс | Нефрологическая диализная трансплантация

    Аннотация

    Справочная информация. Влияние сегмент-специфичного повреждения проксимальных канальцев на пространственно-временное распределение остеопонтина (OPN) было определено на двух разных нефротоксических моделях крыс, чтобы оценить его возможное влияние на возможную роль OPN в острой почечной недостаточности (ARF).Экспрессию гена OPN дополнительно определяли в клетках проксимальных и дистальных канальцев для исследования происхождения повышенного почечного OPN.

    Методы. Почечный белок OPN и экспрессия мРНК сравнивали у крыс во время ртути-хлорида- и гентамицина-индуцированной ОПН с использованием иммуногистохимии и in situ гибридизации.

    Результаты. Хлорид ртути в первую очередь вызывал повреждение канальцев и последующую пролиферацию клеток в проксимальных прямых канальцах (PST), тогда как гентамицин преимущественно поражал проксимальные извитые канальцы (PCT).В обеих моделях распределение белка OPN было связано с повышенными уровнями мРНК OPN как в проксимальных, так и в дистальных клетках канальцев. Тем не менее, позитивная регуляция была отложена в проксимальном канальцевом сегменте, который больше всего пострадал от повреждения, то есть ПКТ в гентамицине ARF по сравнению с PST в ARF с хлоридом ртути. Иммуноокрашивание OPN на апикальной клеточной мембране из дистальных канальцев контрастировало с перинуклеарным везикулярным окрашиванием в клетках проксимальных канальцев.

    Выводы. Экспрессия гена и белка OPN индуцируется как в проксимальных, так и в дистальных канальцевых клетках во время токсической ОПН у крыс.Четкая субклеточная локализация в проксимальных клетках и дистальных канальцев указывает на различия в процессинге и / или обращении с OPN. Пространственно-временное распределение согласуется с возможной ролью в повреждении и регенерации почек.

    Введение

    Острая почечная недостаточность (ОПН), вызванная ишемическим реперфузионным повреждением или токсическим воздействием, по-прежнему имеет высокий уровень смертности, несмотря на значительные улучшения в диализном лечении и в клинической практике в целом.Обширные поражения канальцев, включая некроз и шелушение клеток, сопровождаются временным нарушением функции почек и накоплением интерстициальных лейкоцитов [1]. Пролиферация выживших канальцевых клеток знаменует начало последующей регенерации почек. Миграция, распространение и прочное прикрепление незрелых канальцевых клеток к обнаженной базальной мембране предшествуют поляризации и дифференцировке клеток [2]. В конце концов, функция почек и целостность тканей могут быть восстановлены за ограниченное время. Новые рациональные вмешательства могут ускорить этот процесс регенерации, повысить его эффективность и улучшить исход синдрома.

    Экспериментальные и структурные данные показывают, что остеопонтин (OPN) может влиять на этот процесс ремоделирования. OPN представляет собой фосфорилированный гликопротеин, первоначально выделенный из кости, но продуцируемый различными типами клеток, включая эпителий почечных канальцев [3]. Значительные количества обнаруживаются в моче, где предположительно ингибирует образование кристаллов оксалата кальция [4]. Однако обильная экспрессия OPN после повреждения почек, а также в других органах и тканях в условиях высокого клеточного обмена, таких как стенка сосудов, сердце, кожа, легкие, скелетные мышцы и кости, предполагает, что этот белок может иметь важное значение в тканях. ремоделирование [5].

    Защитная роль в почках предполагалась из-за сниженной толерантности мышей с нокаутом OPN к почечной ишемии, возможно, за счет ингибирования индуцибельной синтазы оксида азота (iNOS) [6]. Посредством своего взаимодействия с множеством интегринов последовательность аргинин-глицин-аспарагиновая кислота (RGD) OPN может способствовать прикреплению клеток, опосредовать миграцию клеток [7] и уменьшать образование канальцевых повязок [8]. Кроме того, OPN снижает апоптотическую гибель клеток и его свойства аттрактанта макрофагов, а также его стимуляцию активности TGF- β и отложения коллагена I и IV предполагают, что он обладает профиброгенными свойствами [9].

    В почках крысы повышенная экспрессия OPN была отмечена при гипертензии ангиотензина II [10], после односторонней обструкции мочеточника [11], в различных экспериментальных моделях гломерулонефрита и тубулоинтерстициального нефрита [12-15], а также после почечной ишемии [16-18]. [. Ранее мы продемонстрировали, что иммунореактивный ОПН появляется в клетках дистальных канальцев и регенерирующих клетках проксимальных канальцев во время ишемии-реперфузии почек, но не в сильно поврежденных клетках проксимальных канальцев [18]. Предполагая, что OPN участвует в процессе ремоделирования тканей после повреждения почек в целом, эта взаимосвязь также должна присутствовать в других, несвязанных моделях ARF, таких как токсическая ARF, где изменение гемодинамических параметров, по-видимому, не играет центральной роли в инициации почечной недостаточности. травма [19].Таким образом, в настоящем исследовании на двух разных моделях токсической ОПН мы исследовали, влияет ли сегмент-специфическое повреждение проксимальных канальцев на распределение ОПН в почках. Вторая важная проблема — происхождение иммунореактивного OPN в клетках проксимальных канальцев. Единственное описание мРНК OPN в клетках проксимальных канальцев крыс, позволяющее предположить, что клетки проксимальных канальцев способны продуцировать OPN [17], опровергается Мэдсеном и его коллегами [20], которые обнаружили OPN после индукции липополисахаридом (LPS) только в вакуолярно-лизосомной система клеток проксимальных канальцев крысы и пришла к выводу, что ОПН проксимальных канальцев реабсорбируется из жидкости канальцев.Чтобы определить в настоящем исследовании, является ли присутствие иммунореактивного OPN в клетках проксимальных канальцев следствием повышенной экспрессии гена OPN, а не эндоцитотического поглощения, распределение мРНК OPN сравнивали с локализацией белка OPN.

    Были выбраны две модели нефротоксических крыс с сопоставимым течением времени, но с другой мишенью проксимальных канальцев. Гентамицин вызывает острое повреждение канальцев, в частности, проксимальных извитых канальцев коры головного мозга (ПКТ), в то время как основной мишенью нефротоксичности хлорида ртути (HgCl 2 ) являются проксимальные прямые канальцы (PST) во внешней полосе наружного мозгового вещества (OSOM). ) и сердцевинные лучи.

    Объекты и методы

    Лечение животных

    Гентамицин или хлорид ртути вводили самкам крыс линии Вистар (200–220 г). Первая группа ( n = 28) получала 400 мг / кг гентамицина внутрибрюшинно (ip) (40 мг / мл в 0,9% NaCl), разделенная на три ежедневные инъекции в дни 1 и 2. Вторая группа ( n = 28). ) получил однократную подкожную (п / к) инъекцию 2,5 мг / кг хлорида ртути (1 мг / мл в 0,9% NaCl) в день 1.Контрольные крысы ( n = 7 и n = 14 для каждого лечения соответственно) получали носитель по той же схеме. В течение следующих 2 недель четыре животных, получавших гентамицин или хлорид ртути, и по крайней мере одно контрольное животное для каждой обработки были умерщвлены в разные промежутки времени. Все процедуры выполнялись в соответствии с руководящими принципами NIH по уходу и использованию лабораторных животных (85–23).

    Креатинин сыворотки

    Образцы сыворотки крови, взятой при умерщвлении, анализировали в двух экземплярах с использованием колориметрического теста Jaffé.

    Иммуногистохимическое окрашивание

    Окрашивание проводили на парафиновых срезах 4 мкм из фиксированной метакарном почечной ткани. Пролиферирующие клетки иммуноокрашивали кроличьим антимышиным моноклональным антителом (PC10 от Dako, Дания), направленным на ядерный антиген пролиферирующих клеток (PCNA). После блокирования нормальной козьей сывороткой и инкубации с первичным антителом срезы инкубировали с биотинилированной козьей антикроличьей антисывороткой в ​​присутствии нормальной крысиной сыворотки и окрашивали авидин-биотинилированным комплексом пероксидазы хрена (Vectastain от Vector Laboratories, США). с использованием 3,3′-диаминобензидина в качестве хромогена.Срезы контрастировали метиловым зеленым и реагентом Шиффа периодной кислоты (PAS). Окрашивания не наблюдалось, когда первичное антитело было исключено или заменено нерелевантным мышиным антителом того же изотипа.

    Двойное иммуноокрашивание на OPN и макрофаги проводили последовательно. После блокирования нормальной лошадиной сывороткой и инкубации с мышиным моноклональным антителом против макрофагов крысы ED-1 (Serotec, Великобритания) срезы инкубировали с биотинилированной лошадиной антимышиной антисывороткой в ​​присутствии нормальной крысиной сыворотки, а затем с авидин-биотинилированным щелочным раствором. фосфатазный комплекс (Вектастаин).Синий цвет был разработан с помощью нитросинего тетразолия (NBT) и 5-бром-4-хлор-3-индоксилфосфата (BCIP) в присутствии 1-бромтетрамизола. На следующем этапе срезы промывали и блокировали нормальной кроличьей сывороткой и инкубировали с очищенной аффинной козьей антисывороткой против OPN (OP199). Затем срезы инкубировали с биотинилированной кроличьей антикозьей антисывороткой в ​​присутствии нормальной крысиной сыворотки. Окрашивание пероксидазой проводили так же, как и для PCNA, за исключением проявления окраски, где в качестве хромогена использовали 3-амино-9-этилкарбазол.Ядра контрастировали метиловым зеленым. Окрашивания не наблюдалось, когда ED-1 или OP199 были исключены или заменены нерелевантными мышиными антителами того же изотипа или доиммунной козьей сывороткой соответственно.

    Гибридизация in situ

    Гибридизацию проводили на парафиновых срезах толщиной 4 мкм из почечной ткани, фиксированной Dubosq – Brasil. После обработки протеиназой К и постфиксации в 4% параформальдегиде срезы ткани гибридизовали либо с антисмысловым, либо с чувствительным флуоресцеин-меченым РНК-зондом (набор для окрашивания РНК, Amersham, UK), полученным путем текущей транскрипции Eco RI (антисмысловой) или Cla I (смысл) линеаризованная плазмида rOPN.Эта конструкция содержит фрагмент Eco RI – Cla I (563 п.н.) из клона кДНК крысиного OPN 2B7. Фон был уменьшен обработкой РНКазой А и промывками с высокой строгостью. Инкубацию с антителом против флуоресцеина, конъюгированным с щелочной фосфатазой, проводили в соответствии с инструкциями производителя. Темно-пурпурный цвет проявлялся во время инкубации в течение ночи в NBT и BCIP. При использовании сенсорного зонда OPN или при предварительной обработке срезов РНКазой A окрашивания не наблюдалось.

    Методы анализа

    Разрастание клеток и повреждение канальцев оценивали в одних и тех же срезах PCNA / PAS.Пролиферирующие клетки подсчитывали в 10 случайно выбранных микроскопических полях (общая площадь = 3,10 мм 2 ) в коре и OSOM, соответственно, с различием между проксимальными и дистальными тубулярными клетками. В общей сложности 100 канальцев на почечный разрез оценивали на предмет повреждения канальцев: 25 проксимальных и 25 дистальных канальцев в коре головного мозга и в OSOM соответственно. Проксимальный каналец считался поврежденным, если его щеточная кайма была нарушена или потеряна, или если он содержал вакуолизированные клетки или некротические клетки. Дистальный каналец считался поврежденным, если он содержал разрушенные, вакуолизированные или некротические клетки.Даже когда травма была серьезной, проксимальные канальцы все же можно было отличить от дистальных канальцев по крайней мере по одному из следующих критериев: топографическая локализация, периметр канальцев, плотность цитоплазмы и положение ядра, отсутствие или наличие щеточной каймы, высота клетки и внешний вид базолатерального канала. OPN-положительные канальцы и ED-1-положительные макрофаги подсчитывали одновременно в 10 случайно выбранных полях микроскопа (общая площадь 0,78 мм 2 ) в коре головного мозга и OSOM соответственно.

    Статистика

    Статистический анализ был выполнен с использованием статистического программного обеспечения SPSS.Средние значения и стандартные отклонения по меньшей мере четырех животных сравнивали с помощью однофакторного дисперсионного анализа, а различия дополнительно выделяли с помощью апостериорного критерия Стьюдента – Ньюмана – Кеулса . Процент поврежденных канальцев сравнивали с тестом хи-квадрат Пирсона.

    Результаты

    Креатинин сыворотки

    Кратковременное повышение уровня креатинина в сыворотке указывает на существенное снижение скорости клубочковой фильтрации и развитие ОПН в обеих моделях (рис. 1).

    Органы управления

    Нормальные значения креатинина сыворотки были обнаружены на протяжении всего периода наблюдения у контрольных животных обеих моделей.

    Рис. 1.

    Изменение значений креатинина сыворотки после введения гентамицина и хлорида ртути (* P <0,05 по сравнению с контрольными).

    Рис. 1.

    Изменение значений креатинина сыворотки после введения гентамицина и хлорида ртути (* P <0.05 против контрольных).

    Гентамицин ARF

    Показатели креатинина в сыворотке крови начали расти на 4-й день и были максимальными на 6-й день (5,8 ± 1,2 мг / дл), тогда как нормальные значения снова были достигнуты на 12-й день.

    Ртуть-хлорид ARF

    Показатели креатинина сыворотки повышались быстрее и достигли пика раньше, чем при гентамицине ARF. Максимальные значения были достигнуты на 2-й день (3,9 ± 1,4 мг / дл), тогда как значения снова были нормальными на 6-й день.

    Повреждение канальцев и пролиферация клеток

    Локализация повреждения канальцев и пролиферация клеток отражала сегмент-специфическую нефротоксичность гентамицина и хлорида ртути (Рисунки 2–4).

    Органы управления

    Морфология почек была нормальной у контрольных животных, в то время как пролиферирующих клеток было мало (рис. 2А и 2Е). Во всех сегментах канальцев было обнаружено менее 10 клеток с PCNA-положительными ядрами (рис. 4).

    Рис. 2.

    Повреждение проксимальных канальцев и пролиферация клеток в кортикомедуллярном соединении после введения гентамицина (левая колонка) и хлорида ртути (правая колонка). Окрашивание PAS / PCNA (увеличение 220 ×) ( A ) контрольной крысы, ( B ) крысы, обработанной гентамицином, на 4-й день, ( C ) на 8-й день и ( D ) на 12-й день.( E ) Контрольная крыса, ( F ) крыса, получавшая хлорид ртути на 2-й день, ( G ) на 6-й день и ( H ) на 14-й день. Гентамицин сильно повреждает кортикальную ПКТ (□) тогда как хлорид ртути в основном повреждает PST в OSOM и медуллярных лучах (*). Несколько PCNA-положительных клеток (стрелки) можно найти у контрольных животных и в конце наблюдений.

    Рис. 2.

    Повреждение проксимальных канальцев и пролиферация клеток кортикомедуллярного перехода после введения гентамицина (левая колонка) и хлорида ртути (правая колонка).Окрашивание PAS / PCNA (увеличение 220 ×) ( A ) контрольной крысы, ( B ) крысы, обработанной гентамицином, на 4-й день, ( C ) на 8-й день и ( D ) на 12-й день. ( E ) Контрольная крыса, ( F ) крыса, получавшая хлорид ртути на 2-й день, ( G ) на 6-й день и ( H ) на 14-й день. Гентамицин сильно повреждает кортикальную ПКТ (□) тогда как хлорид ртути в основном повреждает PST в OSOM и медуллярных лучах (*). Несколько PCNA-положительных клеток (стрелки) можно найти у контрольных животных и в конце наблюдений.

    Рис. 3.

    Развитие повреждения канальцев в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0,05 по сравнению с контролем).

    Рис. 3.

    Развитие повреждения канальцев в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0,05 по сравнению с контролем).

    Рис.4.

    Эволюция пролиферации клеток в коре головного мозга и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0.05 против контрольных).

    Рис. 4.

    Эволюция пролиферации клеток в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0,05 по сравнению с контрольной группой).

    Гентамицин ARF

    Трубочное повреждение было наиболее выраженным при ПКТ коры ( P <0,001 по сравнению с PST). Первые признаки травмы наблюдались уже через 24 часа после первого введения гентамицина (день 1) и включали лизосомальный отек, потерю щеточной каймы и вакуолизацию клеток (рис. 2С).Это сопровождалось обширным некрозом клеток и их отслоением от базальной мембраны, что часто приводило к полностью слущившимся канальцам. Почти весь ПКТ (99%) был поврежден или некротизирован на 4-й день (рис. 3). Обнаженные трубчатые базальные мембраны постепенно заселялись регенерирующими уплощенными эпителиальными клетками, большинство из которых демонстрировали заметное иммуноокрашивание PCNA (рис. 2E). Следовательно, пролиферация клеток была максимальной в кортикальном PCT на 8 день (рис. 4). Это привело к восстановлению нормальной тканевой архитектуры на 12-й день (рис. 2G).

    Хлорид ртути ARF

    В отличие от гентамицина ARF, повреждение канальцев было наиболее выражено при PST OSOM и медуллярных лучей ( P <0,001 против PCT) (рис. 2D). В соответствии с быстрым увеличением значений креатинина в сыворотке, впечатляющее количество некротических PST можно было увидеть уже в день 1, достигнув максимума 93% от всех PST на 2 день (Рисунок 3). По аналогии с гентамицином ARF, пролиферирующие клетки начали покрывать обнаженные базальные мембраны после максимального повреждения (рис. 2F).В соответствии с локализацией наиболее тяжелого повреждения канальцев, пролиферация клеток была максимальной при PST и максимальной на 4-й день (рис. 4). Архитектура нормальной ткани была восстановлена ​​на 14 день (рис. 2H), за исключением некоторых фокальных областей в медуллярных лучах, которые все еще содержали регенерирующий PST.

    ОПН иммуноокрашивание

    Иммуноокрашивание

    OPN в обеих моделях быстро увеличивалось в клетках проксимальных и дистальных канальцев, но задерживалось в проксимальном сегменте канальцев, который был наиболее серьезно поврежден (Фигуры 5 и 6).

    Органы управления

    OPN был почти исключительно локализован в мозговом веществе, где были окрашены самые тонкие конечности и папиллярный уроэпителий (рис. 6А). Только небольшое количество толстых восходящих конечностей и клеток проксимальных канальцев содержало OPN, тогда как иммуноокрашивание OPN отсутствовало в клубочках и интерстиции.

    Рис. 5.

    Эволюция иммунореактивности OPN в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0.05 против контрольных).

    Рис. 5.

    Эволюция иммунореактивности OPN в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0,05 по сравнению с контрольной группой).

    Рис. 6.

    Двойное иммуноокрашивание клеток ED-1 + (макрофаги; синий) и остеопонтин (красный). ( A ) ОПН в клетках папиллярного эпителия (стрелки) и тонком конце петли Генле (стрелки) в контрольной почке (400 ×).Клетки толстой восходящей конечности (TAL) чаще всего отрицательны (звездочки). ( B ) Сильное внутриклеточное окрашивание OPN в большинстве канальцев через 6 дней после обработки гентамицином (400 ×). Точечное окрашивание можно увидеть чуть ниже апикальной клеточной поверхности некоторых канальцев (стрелки) ( C ) Сильное иммуноокрашивание OPN через 1 день после обработки хлоридом ртути (260 ×). Некоторые канальцы имеют апикальное окрашивание, тогда как другие имеют только везикулярное внутриклеточное окрашивание. Отчетливое внутриклеточное окрашивание можно увидеть в гломерулярных париетальных эпителиальных клетках (стрелки) и в проксимальных канальцах, которые исходят из клубочков (наконечник стрелки).( D ) Обзор иммуноокрашивания OPN и накопления интерстициальных макрофагов в почечном OSOM (слева) и коре головного мозга (справа) при малом увеличении (32 ×) через 1 день после лечения хлоридом ртути. ( E ) Совместная локализация интерстициальных макрофагов и иммуноокрашивание OPN через 14 дней после лечения хлоридом ртути в очаговой области, где регенерация все еще продолжается (160 ×). ( F ) Типичный образец перинуклеарного окрашивания в клетках проксимальных канальцев (1000 ×). ( G ) Выраженное апикальное окрашивание в клетках дистальных канальцев (1000 ×).Перинуклеарное окрашивание также можно увидеть в некоторых клетках (стрелки). ( H ) Апикальное окрашивание незрелых регенерирующих клеток проксимальных канальцев (звездочки) через 6 дней после обработки хлоридом ртути (260 ×).

    Рис. 6.

    Двойное иммуноокрашивание клеток ED-1 + (макрофаги; синий) и остеопонтин (красный). ( A ) ОПН в клетках папиллярного эпителия (стрелки) и тонком конце петли Генле (стрелки) в контрольной почке (400 ×). Клетки толстой восходящей конечности (TAL) чаще всего отрицательны (звездочки).( B ) Сильное внутриклеточное окрашивание OPN в большинстве канальцев через 6 дней после обработки гентамицином (400 ×). Точечное окрашивание можно увидеть чуть ниже апикальной клеточной поверхности некоторых канальцев (стрелки) ( C ) Сильное иммуноокрашивание OPN через 1 день после обработки хлоридом ртути (260 ×). Некоторые канальцы имеют апикальное окрашивание, тогда как другие имеют только везикулярное внутриклеточное окрашивание. Отчетливое внутриклеточное окрашивание можно увидеть в гломерулярных париетальных эпителиальных клетках (стрелки) и в проксимальных канальцах, которые исходят из клубочков (наконечник стрелки).( D ) Обзор иммуноокрашивания OPN и накопления интерстициальных макрофагов в почечном OSOM (слева) и коре головного мозга (справа) при малом увеличении (32 ×) через 1 день после лечения хлоридом ртути. ( E ) Совместная локализация интерстициальных макрофагов и иммуноокрашивание OPN через 14 дней после лечения хлоридом ртути в очаговой области, где регенерация все еще продолжается (160 ×). ( F ) Типичный образец перинуклеарного окрашивания в клетках проксимальных канальцев (1000 ×). ( G ) Выраженное апикальное окрашивание в клетках дистальных канальцев (1000 ×).Перинуклеарное окрашивание также можно увидеть в некоторых клетках (стрелки). ( H ) Апикальное окрашивание незрелых регенерирующих клеток проксимальных канальцев (звездочки) через 6 дней после обработки хлоридом ртути (260 ×).

    Гентамицин ARF

    Иммуноокрашивание

    OPN быстро индуцировалось в PST (фиг. 6B), но оставалось отсутствующим в сильно поврежденном PCT в течение первых 2 дней (фиг. 5). После этого количество OPN-положительных проксимальных канальцев постепенно увеличивалось в коре и OSOM.Иммуноокрашивание OPN в дистальных канальцах также начало увеличиваться рано и было сопоставимо в коре головного мозга и OSOM.

    Хлорид ртути ARF

    Многие клетки ПКТ и гломерулярные париетальные эпителиальные клетки уже содержали ОПН в течение 24 часов после лечения (рис. 6С). По аналогии с гентамицином, иммуноокрашивание OPN отсутствовало до 2-го дня в проксимальном канальцевом сегменте, наиболее пострадавшем от повреждений, который теперь был PST в OSOM (рис. 5). Однако количество OPN-положительных ПКТ в коре постепенно увеличивалось, начиная с 1-го дня.Экспрессия OPN также индуцировалась на 1-й день в большинстве дистальных канальцев коры и OSOM (рис. 6D), постепенно снижаясь к 14-му дню. Ближе к концу периода наблюдения канальцы, все еще экспрессирующие OPN, были расположены в некоторых фокальных областях, где происходила регенерация. все еще продолжается (рис. 6E).

    Паттерн субклеточного иммуноокрашивания OPN был очень своеобразным в обеих моделях. В большинстве проксимальных канальцевых клеток OPN присутствовал только в нескольких перинуклеарных пузырьках (Рисунок 6F), но в некоторых канальцах точечный рисунок можно было увидеть чуть ниже апикальной поверхности клетки (Рисунок 6B).Напротив, клетки дистальных канальцев показали заметное иммуноокрашивание OPN на апикальной клеточной поверхности, тогда как перинуклеарное окрашивание было заметно только в нескольких клетках (рис. 6G). Иммуноокрашивание также было наиболее интенсивным на поверхности апикальных клеток незрелых регенерирующих клеток проксимальных канальцев (рис. 6H).

    OPN гибридизация in situ

    Локализация мРНК OPN (фиг. 7) точно отражала картину иммуноокрашивания OPN (фиг. 6).

    Органы управления

    МРНК

    OPN была обнаружена в большинстве тонких медуллярных конечностей Генле и в папиллярных уроэпителиальных клетках (фиг. 7A) и во всех аспектах соответствовала локализации иммунореактивного OPN.

    Рис. 7.

    In situ гибридизация мРНК OPN. ( A ) Сильный сигнал мРНК OPN в тонких конечностях Генле (стрелки) и уроэпителиальных клетках (наконечники стрелок) у контрольной крысы (350 ×). В толстых восходящих конечностях (звездочки) мРНК OPN не обнаруживается. ( B ) OSOM крысы, получавшей гентамицин, в день 1 (350 ×). Сильный сигнал мРНК OPN в дистальных канальцах и умеренная экспрессия в PST. ( C ) Кора головного мозга крысы, получавшей хлорид ртути, в день 1 (200 ×).Сильный сигнал мРНК OPN в дистальных канальцах (d) и умеренная экспрессия в PCT (p). Отчетливое окрашивание можно также увидеть в гломерулярных париетальных эпителиальных клетках (стрелки) и в проксимальных канальцах, которые исходят из клубочков (наконечник стрелки). ( D ) Обзор с малым увеличением (40 ×) локализации мРНК OPN в OSOM почек (слева) и коре головного мозга (справа) через 1 день после лечения хлоридом ртути. ( E ) мРНК OPN через 14 дней после обработки хлоридом ртути в очаговой области, где регенерация все еще продолжается (90 ×).( F ) Сигнал мРНК OPN в клетках проксимальных канальцев (350 ×) намного ниже или отсутствует при наличии щеточной каймы (стрелки). ( G ) Сильный сигнал мРНК OPN в клетках дистальных канальцев (200 ×). ( H ) Сильный сигнал мРНК OPN также можно обнаружить в незрелых регенерирующих клетках проксимальных канальцев (звездочки) (200 ×).

    Рис. 7.

    In situ гибридизация мРНК OPN. ( A ) Сильный сигнал мРНК OPN в тонких конечностях Генле (стрелки) и уроэпителиальных клетках (наконечники стрелок) у контрольной крысы (350 ×).В толстых восходящих конечностях (звездочки) мРНК OPN не обнаруживается. ( B ) OSOM крысы, получавшей гентамицин, в день 1 (350 ×). Сильный сигнал мРНК OPN в дистальных канальцах и умеренная экспрессия в PST. ( C ) Кора головного мозга крысы, получавшей хлорид ртути, в день 1 (200 ×). Сильный сигнал мРНК OPN в дистальных канальцах (d) и умеренная экспрессия в PCT (p). Отчетливое окрашивание можно также увидеть в гломерулярных париетальных эпителиальных клетках (стрелки) и в проксимальных канальцах, которые исходят из клубочков (наконечник стрелки).( D ) Обзор с малым увеличением (40 ×) локализации мРНК OPN в OSOM почек (слева) и коре головного мозга (справа) через 1 день после лечения хлоридом ртути. ( E ) мРНК OPN через 14 дней после обработки хлоридом ртути в очаговой области, где регенерация все еще продолжается (90 ×). ( F ) Сигнал мРНК OPN в клетках проксимальных канальцев (350 ×) намного ниже или отсутствует при наличии щеточной каймы (стрелки). ( G ) Сильный сигнал мРНК OPN в клетках дистальных канальцев (200 ×).( H ) Сильный сигнал мРНК OPN также можно обнаружить в незрелых регенерирующих клетках проксимальных канальцев (звездочки) (200 ×).

    Гентамицин ARF

    Экспрессия гена

    OPN сильно повышалась в дистальных канальцах коры и OSOM. МРНК OPN не была обнаружена при тяжелом поражении ПКТ в коре головного мозга, но присутствовала в PST (рис. 7B).

    Хлорид ртути ARF

    По аналогии с гентамицином ARF, экспрессия мРНК OPN отражала усиление иммуноокрашивания OPN.МРНК OPN не была обнаружена в сильно поврежденном PST, но индуцировалась в PCT, в дистальных канальцах от коры и OSOM и в париетальных клетках клубочков (рис. 7C, D). МРНК OPN также была обнаружена в очаговых областях с незрелыми клетками проксимальных канальцев, которые присутствовали ближе к концу наблюдений (рис. 7E). Отсутствие проксимальной канальцевой щеточной каймы часто было связано с присутствием мРНК OPN (рис. 7F). В целом, клетки дистальных канальцев показали более сильный сигнал, чем клетки проксимальных канальцев (рис. 7G).Кроме того, с результатами иммуноокрашивания дополнительно согласуется сильная экспрессия мРНК OPN, обнаруженная в регенерирующих клетках проксимальных канальцев (фигура 7H).

    Накопление интерстициальных макрофагов

    Макрофаги накапливались в почечном интерстиции после обеих обработок (рис. 8), но не наблюдали устойчивой связи с экспрессией OPN.

    Органы управления

    Лишь несколько макрофагов были обнаружены в почечном интерстиции контрольных крыс.

    Рис. 8.

    Эволюция количества интерстициальных макрофагов в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0,05 по сравнению с контрольной группой).

    Рис. 8.

    Эволюция количества интерстициальных макрофагов в коре почек и OSOM у крыс, получавших гентамицин или хлорид ртути (* P <0,05 по сравнению с контрольной группой).

    Гентамицин ARF

    Интерстициальные макрофаги диффузно накапливались как в коре, так и в OSOM и сохранялись до конца наблюдений (рис. 8).Четкой совместной локализации с тубулярной экспрессией OPN никогда не наблюдалось.

    Хлорид ртути ARF

    Количество интерстициальных макрофагов увеличилось до впечатляющих цифр на 4-й день в OSOM (рис. 8), тогда как в корковом интерстиции не наблюдалось значительного увеличения макрофагов. Совместная локализация с тубулярной экспрессией OPN наблюдалась только в фокусных областях в конце наблюдений, когда макрофаги окружали незрелые проксимальные канальцы с повышенной экспрессией OPN (рис. 5E).

    Обсуждение

    Мы исследовали экспрессию OPN в почках на двух моделях крыс с отчетливой локализацией острого повреждения канальцев. Мы подтвердили, что иммуноокрашивание OPN в нормальной почке крысы в ​​основном локализовано в почечном папиллярном эпителии и тонких конечностях петли Генле [11,18]. Кроме того, мы впервые продемонстрировали, что экспрессия почечного белка OPN и мРНК одновременно повышается в клетках проксимальных и дистальных канальцев во время токсической ОПН.

    Иммуноокрашивание везикулярного OPN в клетках проксимальных канальцев по сравнению с апикальное окрашивание в клетках дистальных канальцев также согласуется с нашими данными при ишемической ARF [18] и с везикулярным паттерном, ранее наблюдавшимся в регенерирующих эндотелиальных клетках сосудов [21]. Идентичность этих пузырьков в почечных клетках до сих пор неизвестна. Они могут соответствовать аппарату Гольджи, где белок гликозилируется и фосфорилируется перед секрецией. Мэдсен и его коллеги [20] обнаружили ОПН в аппарате Гольджи из клеток дистальных канальцев с помощью иммуно-электронной микроскопии.Однако в клетках проксимальных канальцев авторы обнаружили OPN только в эндосомно-лизосомной системе. В проксимальных канальцах из эмбриональной куриной почки OPN локализуется в апикальной тубуло-везикулярной системе и в некоторых полиморфных лизосомоподобных структурах [22]. Эти места предполагают, что иммунореактивный OPN накапливается в клетках проксимальных канальцев после эндоцитотической интернализации. Однако теперь мы продемонстрировали на двух разных моделях сегмент-специфического нефротоксического повреждения, что усиление иммуноокрашивания OPN сопровождалось сопутствующей активацией мРНК OPN не только в дистальных, но и в проксимальных клетках канальцев.

    Эти данные показывают, что присутствие иммунореактивного OPN в клетках проксимальных канальцев является вторичным по отношению к индукции гена OPN в этих клетках. Будучи направленным на апикальную клеточную поверхность после синтеза, OPN секретируется в просвет канальцев, но, как и в клетках дистальных канальцев, по крайней мере, его часть может также связываться с апикальной клеточной поверхностью. Также было продемонстрировано, что мембранные белки клеток проксимальных канальцев рециркулируют между плазматической мембраной и эндосомным компартментом [23].Такой механизм мог бы объяснить, почему OPN накапливается на клетках со слабо развитым эндоцитотическим механизмом, таких как клетки дистальных канальцев и регенерирующие клетки проксимальных канальцев, но становится интернализованным в более зрелых клетках проксимальных канальцев, имеющих хорошо развитый эндоцитотический механизм, и также согласовал бы наши настоящие результаты. с таковыми Мадсена и его коллег [20]. Альтернативное объяснение отсутствия OPN на апикальной клеточной поверхности зрелых проксимальных канальцевых клеток обеспечивается гетерогенным составом гликокаликса вдоль нефрона.Это также согласуется с окрашиванием апикального OPN в незрелых регенерирующих клетках проксимальных канальцев, которые демонстрируют потерю клеточной поляризации и изменения в составе клеточных мембран [2,24]. Наконец, клетки проксимальных канальцев могут продуцировать изоформы OPN с биологическими свойствами, отличными от OPN, продуцируемых клетками дистальных канальцев. И фосфорилированный, и нефосфорилированный OPN секретируются нормальными клетками почек крысы (NRK) in vitro ; фосфорилированная форма связывает фибронектин клеточной поверхности, тогда как нефосфорилированная форма связана с растворимым фибронектином [25].Для объяснения этого своеобразного паттерна субклеточного окрашивания необходимо провести дальнейшие исследования по изучению процессинга в почках и транспорта OPN.

    Ранее описанные макрофаго-аттрактантные свойства OPN не были подтверждены в настоящем исследовании [9,11]. Пространственная связь между экспрессией OPN в канальцах и накоплением интерстициальных макрофагов была обнаружена только ближе к концу наблюдений в фокальных областях с регенерирующими проксимальными канальцами. Связь может быть более очевидной в экспериментальных моделях, где повреждение является главным образом очаговым.

    Точная роль почечного OPN в ARF еще предстоит определить, но пространственно-временной паттерн активации OPN в поврежденных и регенерирующих канальцевых клетках согласуется с ролью в процессе ремоделирования ткани во время ARF. Liaw и др. . [21] предположили аналогичную роль OPN в процессе ремоделирования после сосудистого повреждения, способствуя прикреплению клеток и их распространению. Миграция и распространение регенерирующих канальцевых клеток после обработки гентамицином ранее предполагалась индукцией экспрессии виментина в клетках проксимальных канальцев крыс [26], в то время как частичная совместная локализация виментина и OPN наблюдалась при протеинурии с перегрузкой белком [14].Трубчатые клетки могут активировать OPN, чтобы уменьшить апоптотическую гибель клеток [9], ингибировать активность iNOS и уменьшить образование канальцевых повязок [6]. Следовательно, активация OPN после повреждения почек может представлять стратегию выживания как поврежденных, так и регенерирующих канальцевых клеток, причем первые вносят вклад в поддержание целостности канальцев, а вторые нацелены на репопуляцию базальной мембраны канальцев.

    В заключение, экспрессия гена и белка OPN индуцируется как в проксимальных, так и в дистальных канальцевых клетках во время токсической ОПН.Субклеточная локализация предполагает различия в процессинге и / или транспортировке OPN в проксимальных и дистальных тубулярных клетках. Картина пространственно-временного распределения согласуется с возможной ролью защитного фактора при повреждении и регенерации канальцев.

    В ходе этого исследования Верле П. Перси и Аня Верхюльст получили стипендию для аспирантов от FWO (Фонд научных исследований, Фландрия) и IWT (Фламандский институт содействия научно-технологическим исследованиям в промышленности) соответственно.Часть этой работы опубликована в абстрактной форме ( J Am Soc Nephrol 1996; 7: 2604). Авторы хотели бы выразить свою благодарность доктору Сесилии М. Джачелли за любезный подарок антисыворотки OP199 и клона кДНК 2B7. Благодарим Риту Мариниссен за ее техническую помощь, Эрика Снелдерса и Эдди Ван Хаута за их секретарскую помощь и Дирка Де Вердта за графический макет.

    Список литературы

    1

    Toback FG. Регенерация после острого некроза канальцев [клиническая конференция].

    Kidney Int

    1992

    ;

    41

    :

    226

    –2462

    Fish EM, Molitoris BA. Изменения полярности эпителия и патогенеза болезненных состояний.

    N Engl J Med

    1994

    ;

    330

    :

    1580

    –15883

    Denhardt DT, Guo X: Остеопонтин: белок с разнообразными функциями.

    FASEB J

    1993

    ;

    7

    :

    1475

    –14824

    Мин Вт, Ширага Х, Чалко С., Гольдфарб С., Кришна Г.Г., Хойер мл.Количественные исследования экскреции уропонтина с мочой.

    Kidney Int

    1998

    ;

    53

    :

    189

    –1935

    Родан Г.А. Обзор остеопонтина.

    Ann N Y Acad Sci

    1995

    ;

    760

    :

    1

    –56

    Нуари Э., Дикман К., Миллер Ф. и др. . Снижение толерантности к острой ишемии почек у мышей с целевым нарушением гена остеопонтина.

    Kidney Int

    1999

    ;

    56

    :

    74

    –827

    Лиав Л., Скиннер М.П., ​​Рейнс Э.В. и др. .Адгезивные и миграционные эффекты остеопонтина опосредуются отдельными интегринами клеточной поверхности. Роль альфа по сравнению с бета 3 в миграции гладкомышечных клеток к остеопонтину in vitro .

    Дж. Клин Инвест

    1995

    ;

    95

    :

    713

    –7248

    Голигорский М.С., Нури Э., Кесслер Х., Романов В. Терапевтический потенциал пептидов RGD при остром повреждении почек.

    Kidney Int

    1997

    ;

    51

    :

    1487

    –14929

    Офашароенсук В., Джачелли С.М., Гордон К. и др. .Обструктивная уропатия у мышей: роль остеопонтина в интерстициальном фиброзе и апоптозе.

    Kidney Int

    1999

    ;

    56

    :

    571

    –58010

    Джачелли С.М., Пихлер Р., Ломбарди Д. и др. . Экспрессия остеопонтина при тубулоинтерстициальном нефрите, индуцированном ангиотензином II.

    Kidney Int

    1994

    ;

    45

    :

    515

    –52411

    Diamond JR, Kees ‐ Folts D, Ricardo SD, Pruznak A, Eufemio M. Ранняя и стойкая повышенная экспрессия почечного кортикального остеопонтина при экспериментальном гидронефрозе.

    Am J Pathol

    1995

    ;

    146

    :

    1455

    –146612

    Pichler R, Giachelli CM, Lombardi D et al . Тубулоинтерстициальное заболевание при гломерулонефрите. Возможная роль остеопонтина (уропонтина).

    Am J Pathol

    1994

    ;

    144

    :

    915

    Couser WG, Johnson RJ. Механизмы прогрессирования почечной недостаточности при гломерулонефрите.

    Am J Kidney Dis

    1994

    ;

    23

    :

    193

    –19814

    Эдди А.А., Джачелли С.М.Почечная экспрессия генов, которые способствуют интерстициальному воспалению и фиброзу у крыс с протеинурией, вызванной перегрузкой белков.

    Kidney Int

    1995

    ;

    47

    :

    1546

    –155715

    Янг Б.А., Бурдманн Э.А., Джонсон Р.Дж. и др. . Клеточная пролиферация и приток макрофагов предшествуют интерстициальному фиброзу при нефротоксичности циклоспорина.

    Kidney Int

    1995

    ;

    48

    :

    439

    –44816

    Клейнман Дж. Г., Вустер Е. М., Бешенский А. М., Шеридан А. М., Бонвентре СП, Браун Д.Повышение экспрессии остеопонтина при ишемии в почках крыс.

    Ann N Y Acad Sci

    1995

    ;

    760

    :

    321

    –32317

    Паданилам Б.Дж., Мартин Д.Р., Хаммерман MR. Инсулиноподобный фактор роста I усиливает экспрессию остеопонтина в почках после острого ишемического повреждения у крыс.

    Эндокринология

    1996

    ;

    137

    :

    2133

    –214018

    Persy VP, Verstrepen WA, Ysebaert DK, De Greef KE, De Broe ME. Различия в активации остеопонтина между проксимальными и дистальными канальцами после ишемии / реперфузии почек.

    Kidney Int

    1999

    ;

    56

    :

    601

    –61119

    Ван Холдер Р., Прет М., Паттин П., Вакет Л., Рингуар С., Ламейр Н. Роль ранней вазоконстрикции в патофизиологии острой почечной недостаточности, вызванной хлоридом ртути. В: Элиаху Х.Э., изд.

    Экспериментальная острая почечная недостаточность

    . John Libbey, Лондон,

    1982

    ;

    206

    –20920

    Мадсен К.М., Чжан Л., Абу Шамат АР, Зигфрид С., Ча Дж. Х. Ультраструктурная локализация остеопонтина в почках: индукция липополисахаридом.

    J Am Soc Nephrol

    1997

    ;

    8

    :

    1043

    –105321

    Лиав Л., Линднер В., Шварц С.М., Чемберс А.Ф., Джачелли С.М. Остеопонтин и бета 3 интегрин координированно экспрессируются в регенерирующем эндотелии in vivo и стимулируют Arg-Gly-Asp-зависимую миграцию эндотелия in vitro .

    Circ Res

    1995

    ;

    77

    :

    665

    –67222

    Герстенфельд Л.С., Упорова Т., Ашкар С. и др. .Регуляция пре- и посттранскрипционной экспрессии остеопонтина птиц в скелетных тканях.

    Ann N Y Acad Sci

    1995

    ;

    760

    :

    67

    –8223

    Коричневый D, Stow JL. Транспорт и полярность белков в эпителии почек: от клеточной биологии к физиологии.

    Physiol Rev

    1996

    ;

    76

    :

    245

    –29724

    Walker PD. Изменения компонентов внеклеточного матрикса почечных канальцев после ишемического реперфузионного повреждения почки.

    Lab Invest

    1994

    ;

    70

    :

    339

    –34525

    Сингх К., ДеВуж М.В., Мукерджи ББ. Физиологические свойства и дифференциальное гликозилирование фосфорилированных и нефосфорилированных форм остеопонтина, секретируемого нормальными клетками почек крысы.

    J Biol Chem

    1990

    ;

    265

    :

    18696

    –1870126

    Ноувен Э.Дж., Верстрепен, Вашингтон, Байссенс Н, Чжу М.К., Де Бро, Мэн. Гиперплазия, гипертрофия и фенотипические изменения в дистальном отделе нефрона после острого повреждения проксимальных канальцев у крысы.

    Lab Invest

    1994

    ;

    70

    :

    479

    –493

    Европейская почечная ассоциация — Европейская ассоциация диализа и трансплантологии

    до-, интра- и послеоперационных факторов повреждения почек у пациентов, перенесших кардиохирургическое вмешательство: ретроспективное когортное исследование

    Резюме

    Предпосылки

    Повреждение почек часто встречается у пациентов, перенесших кардиохирургическое вмешательство, и имеет высокую заболеваемость и смертность.Целью исследования было выявить до-, интра- и послеоперационные факторы риска, ответственные за повреждение почек у пациентов, перенесших кардиохирургические операции.

    Материал / методы

    Пациенты (n = 1468), перенесшие кардиохирургические операции, были разделены на пациентов с повреждением почек (n = 488) и пациентов без повреждения почек (n = 980) с использованием KDIGO (Заболевание почек: улучшение глобальных результатов) ) критерии. Были собраны и проанализированы данные о переменных до, во время и после операции.

    Результаты

    Острое повреждение почек произошло у 33,2% исследуемых пациентов. Пациенты с послеоперационным острым повреждением почек имели более пожилой возраст, сопутствующие заболевания, более высокий уровень креатинина в сыворотке до операции, аортокоронарное шунтирование, более длительное время операции, высокое сердечно-легочное шунтирование и время пережатия, низкое центральное венозное давление и более длительную искусственную вентиляцию легких по сравнению с пациентами. без повреждения почек ( P <0,05 для всех). Возраст> 65 лет (OR 1,4), предоперационная гипертензия (OR 2.0), предоперационная анемия (OR 2.3), предоперационная низкая фракция выброса (OR 3.7), индекс коморбидности Чарлсона> 2 (OR 2.5), более длительное время искусственного кровообращения (OR 4.0), переливание крови (OR 2.1), послеоперационная гипотензия (OR 5.2 ) и низкое центральное венозное давление (OR 8.1) были ответственны за повреждение почек. Смертность пациентов с повреждением почек была значительно выше, чем у пациентов без острого повреждения почек (52 против 1, P <0,001).

    Выводы

    Надлежащий и эффективный контроль пред-, интра- и послеоперационных переменных может снизить риск развития повреждения почек у пациентов, перенесших операции на сердце.

    MeSH Ключевые слова: Острая почечная недостаточность, анемия, кардиохирургические процедуры, коронарное шунтирование, гипертония, инсультный объем

    Общие сведения

    Острое повреждение почек (ОПП) у госпитализированных пациентов вызывает серьезные осложнения, раннюю и позднюю смертность и увеличивает расходы на больницу [1]. ОПП после кардиохирургии (CSA-AKI) обычно встречается у взрослого населения и ассоциируется с высокими показателями заболеваемости и смертности. CSA-AKI — второй по распространенности тип AKI после септического AKI в отделениях интенсивной терапии [2].Несколько связанных факторов во время кардиохирургии, включая пережатие аорты, искусственное кровообращение (CPB), скорость и количество переливаний крови, а также высокие дозы вазопрессоров, которые изменяют перфузию почек, могут вызывать циклы ишемии и реперфузии, увеличивать окислительное повреждение и усиливают почечное и системное воспаление. Все эти механизмы в дальнейшем участвуют в развитии AKI [3]. Многие фармакологические и немедикаментозные методы лечения не смогли снизить CSA-AKI в клинических испытаниях.С другой стороны, периоперационные высокие дозы аторвастатина и отдаленное ишемическое прекондиционирование предоставили минимальные доказательства снижения CSA-AKI [4]. Таким образом, ранняя диагностика и оценка риска ОПП играют ключевую роль при лечении CSA-AKI.

    Недавно 2 метаанализа показали, что частота возникновения CSA-AKI составляет 22%, при этом у большинства пациентов имеется легкая AKI [5,6]. Пациенты с CSA-AKI также предвещают более высокие показатели краткосрочной и долгосрочной смертности по сравнению с пациентами, перенесшими кардиохирургическое вмешательство без AKI.После внесения поправок на другие ковариаты, которые могли бы объяснить смертность, существует пропорционально повышенный риск смерти в зависимости от степени тяжести ОПП [7]. Помимо увеличения заболеваемости и смертности, CSA-AKI ассоциируется с увеличением затрат и использования ресурсов, на что указывает более длительное пребывание в больнице, что в дальнейшем пропорционально тяжести AKI [8]. Понимание индивидуальных факторов риска может помочь в профилактике ОПП, что в дальнейшем может привести к снижению заболеваемости, смертности и стоимости лечения.Это особенно полезно в условиях больницы, где предрасположенность пациента можно оценить до операции или введения потенциально нефротоксичных агентов [9]. Точное прогнозирование ОПП дает возможность клиницистам оптимизировать ведение пациентов с высоким риском, усилить мониторинг, включить пациентов в клинические испытания и начать профилактическое и терапевтическое лечение [10]. Хотя многие исследования выявили факторы риска CSA-AKI [5,11–16], данные о клинических факторах риска все еще ограничены [10], особенно в китайском населении.Существует очень мало исследований, оценивающих факторы риска CSA-AKI в популяции Китая [5,13–16]. Более того, большинство ранее проведенных исследований стратифицировали ОПП с использованием системы классификации AKNI (сеть острых травм почек) и системы классификации RIFLE (риск, травма, отказ, потеря функции, терминальная стадия почечной недостаточности). В то время как в нескольких исследованиях использовались проверенные критерии KDIGO (Заболевание почек: улучшение глобальных результатов) [17,18] в условиях кардиохирургии.

    В рамках вышеупомянутого контекста, анализ нашего исследования был направлен на оценку пред-, интра- и послеоперационных факторов риска ОПП среди китайского населения, подвергающегося кардиохирургии, с использованием критериев KDIGO.

    Материалы и методы

    Этические соображения и согласие на участие

    Протокол (CB / CR / ERBA / CHS-15/45781, от 1 января 2014 г.) исследования был одобрен комиссией по этике Центральной больницы г. Шанхайский район Цзядин. Исследование соответствовало закону Китая, заявлению STROBE (усиление отчетности наблюдательных исследований в эпидемиологии) и Хельсинкской декларации. Поскольку это исследование представляло собой ретроспективный обзор медицинских записей, требование об информированном согласии и регистрации в китайском реестре клинических испытаний было отменено.Все процедуры исследования были выполнены в соответствии с институциональными принципами, и личность участников исследования была анонимной перед анализом.

    Критерии включения

    Были проанализированы истории болезни пациентов, перенесших какие-либо хирургические вмешательства на сердце. Типы кардиохирургической процедуры были определены как аортокоронарное шунтирование (АКШ), хирургия клапана, комбинированная АКШ и клапанные процедуры, восстановление врожденных пороков сердца и аневризма аорты.

    Критерии исключения

    Критерии исключения включали: возраст пациентов моложе 18 лет и старше 90 лет, пациентов, получающих диализ перед операцией, пациентов с терминальной стадией почечной недостаточности (ТПН) и пациентов с отсутствующими клиническими данными в медицинских картах институт.

    Определение AKI

    Классификация KDIGO использовалась для стратификации AKI среди кардиохирургических пациентов, где AKI определялся как: креатинин сыворотки (SCr) ≥0,3 мг / дл (≥26,5 мкМ / л) в течение 48 часов или увеличение SCr ≥1,5 раза от исходного значения, которое было известно или предположительно имело место в течение предшествующих 7 дней [19]. KDIGO также рекомендовал систему стадирования ОПП: на стадии 1 SCr ≥0,3 мг / дл (≥26,5 мкМ / л) в течение 48 часов или увеличение SCr ≥1,5 раза от исходного значения, на стадии 2 было увеличение SCr ≥ 2.0–2,9 раза от исходного значения), а на стадии 3 SCr увеличивался в ≥3 раза от исходного значения [17]. В настоящем анализе критерий мочи не использовался. Последнее значение SCr во время госпитализации и до операции было названо исходным SCr. Исходные значения SCr были жестко определены экспертным заключением нефрологов (минимум 3 года опыта) нашего института.

    Сбор данных

    Все пре-, внутри-. и послеоперационные данные были собраны в заранее определенной форме.Предоперационные переменные включали антропометрические и социальные характеристики, наличие сопутствующих заболеваний, уровень белка в моче, уровень SCr, расчетную скорость клубочковой фильтрации (eGFR), фракцию выброса левого желудочка (LVEF), индекс коморбидности Чарлсона (CCI) и появление хирургия. Интраоперационными переменными были тип хирургической процедуры, продолжительность операции, время искусственного кровообращения (CPB), время перекрестного зажима аорты (AXC) и необходимость переливания крови. Послеоперационными переменными были артериальное давление, центральное венозное давление (ЦВД), объем мочи, повторное обследование, необходимость и время искусственной вентиляции легких, использование ингибитора ангиотензинпревращающего фермента (ИАПФ) / блокатора рецепторов ангиотензина (БРА) и замещение почек. терапия.

    Пациенты, перенесшие операцию на сердце, были разделены на 2 группы: пациенты с ОПН и пациенты без ОПН. Все вышеупомянутые переменные сравнивались, чтобы определить значимые факторы риска ОПП. СКФ рассчитывали с использованием креатининового уравнения для эпидемиологии хронических заболеваний почек [20]. Отмечалась продолжительность пребывания в больнице и в отделении интенсивной терапии. Уровень белка более 15 мг / дл в точечных образцах мочи считался протеинурией.Уровень сывороточной мочевой кислоты более 6,6 мг / дл у женщин и более 7,0 мг / дл у мужчин считался гиперурикемией. Послеоперационное систолическое артериальное давление менее 90 мм рт. Ст. До постановки диагноза ОПП считалось гипотонией. Если общая продолжительность искусственной вентиляции легких составляла 48 часов или более в отделении интенсивной терапии интенсивной терапии, это считалось длительной механической вентиляцией легких. Если пациенту в таком состоянии было выполнено более 1 хирургического вмешательства, при анализе учитывались данные первого хирургического вмешательства.Диурез менее 400 мл / день считался олигурией.

    Статистический анализ

    Все данные были проанализированы с помощью SPSS версии 20.0. Непрерывные переменные были представлены как среднее значение со стандартным отклонением или медиана с 25–75% процентилями, тогда как категориальные переменные были выражены как частота (n) и пропорция (%). U-критерий Манна-Уитни использовался для сравнения непрерывных переменных, тогда как категориальные переменные сравнивались с точным критерием Фишера. Переменные, которые были статистически связаны с AKI или биологически правдоподобны с развитием AKI, независимо от статистической значимости, подвергались логистической регрессии.Переменные в одномерном анализе со значениями P <0,25 были включены в многомерный анализ, где переменные со значениями P <0,05 в многомерном анализе считались независимыми факторами риска ОПП [21,22]. Прогностическая точность окончательной модели CSA-AKI оценивалась по площади под кривой (AUC) анализа рабочих характеристик приемника (ROC).

    Результаты

    История болезни

    В общей сложности 1761 пациент перенес кардиохирургическую операцию с 5 января 2014 г. по 31 декабря 2016 г. в Центральной больнице Шанхая, Китай.Из них у 214 пациентов отсутствовали клинические данные, 24 пациента были моложе 18 лет, 46 пациентов были старше 90 лет и у 9 пациентов была ТПН. Поэтому эти пациенты были исключены из окончательного анализа. В окончательный анализ были включены данные 1468 пациентов. Согласно определению KDIGO, популяция исследования была разделена на 2 когорты. Пациенты с ОПП были включены в когорту ОПП (n = 448), а пациенты, у которых не было ОПП, были включены в когорту без ОПП (n = 980).

    Средний возраст участников исследования составил 57,8 ± 14,3 года с преобладанием мужчин (62,1%). Около 32% пациентов страдали гипертонией и 23,5% пациентов страдали анемией. Наиболее частым типом хирургического вмешательства была АКШ (39,9%), а вторым по частоте хирургическим вмешательством была операция на клапане (38,4%). Среднее время операции составило 3,4 ± 1,7 часа, время CPB — 116,2 ± 6,8 минут. Частота ОПП составила 33,2%: 1 стадия — 348 пациентов (23,7%), 2 стадия — 95 пациентов (6,5%) и 3 стадия — 45 пациентов (3.1%). Из 585 операций АКШ CSA-AKI произошла в 42,9%, в то время как это произошло в 26,1% всех операций на клапанах. Значительно большее количество пациентов в возрасте ( P <0,001), мужчин ( P = 0,041) и страдающих ожирением ( P = 0,01) было зарегистрировано в когорте пациентов с ОПП, чем в когорте без ОПП.

    Клинико-лабораторные характеристики

    Предоперационные переменные, которые различались между когортами с ОПП и без ОПП, были SCr ( P <0,001), рСКФ ( P <0,001), гипертензия ( P <0.001), сахарный диабет ( P = 0,002), анемия ( P <0,001), ФВЛЖ <45% ( P = 0,002), протеинурия ( P = 0,047), гиперурикемия ( P = 0,011. ) и CCI ( P <0,001). Другие предоперационные клинико-лабораторные характеристики включенных пациентов были одинаковыми в обеих когортах ().

    Таблица 1

    Антропометрические, социальные параметры и предоперационные клинико-лабораторные характеристики включенных пациентов.

    926 926 926

    Городской 52)

    35 90,1 ± 6,2 *

    5) 30 (6)

    2726 141 (29)

    (20)

    1

    Переменные Всего Когорта Сравнение между когортами
    AKI Не-AKI
    Числа пациентов, прошедших оценку 1,468 488 980 980 9809 980 980 9605
    Возраст (лет) 57,8 ± 14,3 59,6 ± 11,6 * 55,1 ± 17,8 <0,001
    Пол Мужской 66) * 590 (60) 0.041
    Женский 557 (38) 167 (34) 390 (40)
    Индекс массы тела (кг / м 2 ) 24,1 ± 3,2 25,1 ± 4,5

    25,1 ± 4,5

    * 23,8 ± 2,6 0,010
    Район проживания Сельский 701 (48) 224 (46) 405 (41) 0,105
    264 (54) 575 (59)
    Креатинин сыворотки (мкМ / л) 79.4 ± 7,5 81,7 ± 5,7 * 75,5 ± 8,2 <0,001
    Расчетная скорость клубочковой фильтрации (мл / мин) 81,4 ± 4,1 80,2 ± 3,8 <0,001
    Сопутствующие заболевания Гипертония # 466 (32) 211 (43) * 255 (26) 4 255 (26) 4

    4 926 926 926 926 926 940 9409 # 232 (16) 104 (23) * 128 (13) 0.002
    Хроническое обструктивное заболевание легких 19 (1) 6 (1) 13 (1) 0,168
    Острый инфаркт миокарда 61 (425) 40 (4) 0,672
    Хроническая болезнь почек 11 (1) 5 (1) 6 (1) 0,190
    Цереброваскулярное заболевание 11 78 (

    48 (5) 0.078
    Анемия ### 345 (24) 170 (35) * 175 (18) <0,001
    Коронарная ангиография 401 925 2726254 260 (27) 0,389
    Срочная операция 21 (1) 10 (2) 11 (1) 0,159
    Введение статинов 376 (11

    ) 26) 132 (27) 244 (25) 0.063
    Фракция выброса левого желудочка <45% 167 (11) 120 (25) * 47 (5) 0,002
    Протеинурия и

    36

    110 (23) * 179 (18) 0,047
    Гиперурикемия && 311 (21) 122 (25) * 189 0,025 0,025
    Контрастная среда 154 (11) 54 (11) 100 (10) 0.142
    Индекс коморбидности Чарлсона> 2 167 (11) 98 (20) * 69 (7) <0,001

    Больше пациентов, перенесших АКШ 0,004 ) и аортальные ( P = 0,029) операции в когорте AKI, чем в когорте без AKI. Пациенты с ОПП имели значительно более продолжительное время операции ( P <0,001), время CPB ( P <0,001) и время AXC ( P <0.001) по сравнению с пациентами без AKI. Кроме того, количество и частота переливания крови ( P = 0,003) были выше среди когорт пациентов с ОПП, чем среди пациентов без ОПП ().

    Таблица 2

    Интраоперационная клинико-лабораторная характеристика включенных пациентов.

    926

    16,2 ± 626,8 ± 5,3 *

    Переменные Всего Когорта Сравнение когорт
    AKI Non-AKI
    Данные о пациентах, прошедших оценку 1,468 488 980 p. Значения
    Тип операции на сердце Аортокоронарное шунтирование 585 (40) 251 (51) * 334 (34) <0.001
    Клапан 563 (38) 147 (30) 416 (42) ** 0,041
    Шунтирование коронарной артерии + клапан 4 151 (15) * 80 (8) 0,001
    Ишемическая болезнь сердца 138 (9) 17 (4) 121 (12) ** 0,002
    Аорта 31 (4) 17 (4) * 14 (1) 0.029
    Время работы (ч) 3,4 ± 1,7 4,8 ± 1,3 * 3,2 ± 1,1 <0,001
    Время искусственного кровообращения (мин) 107,4 ± 4,1 <0,001
    Время пережатия аорты (мин) 66,3 ± 2,9 74,3 ± 1,3 * 60,6 ± 2,5 60,6 ± 2,5
    Переливание крови (> 400 мл) 298 (20) 134 (28) * 164 (17) 0.003
    Перелиты эритроцитов 502 (34) 212 (43) * 290 (30) 0,002

    Послеоперационная гипотензия <0,001 P, P 6 см вод. часто встречается у пациентов, у которых развился ОПП, по сравнению с теми, у кого этого не было.Пациенты с ОПП также сообщили о плохих исходах с точки зрения увеличения продолжительности пребывания в стационаре ( P <0,001), пребывания в отделении интенсивной терапии ( P = 0,003) и потребности в диализе ( P <0,001). Летальность была выше среди пациентов с ОПП, чем без ОПП. Пациенты, соответствующие определению ОПП, которые умерли во время пребывания в больнице, были в 104 раза выше, чем пациенты без ОПП (). В течение периода наблюдения умерло сравнительно большее количество пациентов с ОПП 3 стадии (30 пациентов), чем со 2 стадией ОПП (17 пациентов) и 1 стадией (5 пациентов) ().Также было увеличено количество госпитализаций в связи с прогрессированием ОПП.

    Летальность больных в зависимости от стадии острой почечной недостаточности в период наблюдения.

    Таблица 3

    Послеоперационная клинико-лабораторная характеристика включенных пациентов.

    Значения

    (2) )

    Переменные Всего Когорта Сравнение когорт
    AKI Non-AKI
    Число проанализированных данных пациентов 1,468 488 1,468 488
    Гипотония # 167 (11) 121 (25) * 46 (5) <0.001
    Центральное венозное давление <6 cmH 2 O 272 (19) 232 (48) * 40 (4) <0,001
    Выход мочи мл / день) 98 (7) 87 (18) * 11 (1) <0,001
    Длительная механическая вентиляция ## 148 (10) 121 ( 25) * 27 (3) <0.001
    Использование ИАПФ / БРА 302 (21) 132 (27) * 170 (17) 0,003
    Использование нестероидных противовоспалительных препаратов

    51111 (35) 174 (36) 337 (34) 0,811
    Пребывание в больнице (≥9 дней) 250 (17) 176 (36) * 100 (10) <0,001
    Пребывание в хирургическом отделении интенсивной терапии (≥1 дней) 44 (3) 20 (4) * 24 (2) 0.003
    Диализ 66 (5) 66 (14) * 0 (0) <0,001
    Смертность 53 (4) 35 * 11 1 (0,1) <0,001
    Боль в костях 42 (3) 34 (7) * 8 (1) <0,001
    Необычная боль 22 (1) 19 (2) * 3 (0.3) <0,001
    Онемение или покалывание 47 (3) 40 (4) * 7 (1) <0,001
    Снижение умственной остроты 30 (18) * 1 (0,1) <0,001
    Плохое самочувствие 62 (4) 42 (4) * 20 (2) 0,001
    Расчетная скорость клубочковой фильтрации (мл / мин) 80.48 ± 3,12 70,21 ± 4,78 89,12 ± 5,92 ** <0,001

    Оценка факторов риска

    Предоперационные, интра- и послеоперационные факторы клинической значимости при ОПП подвергались воздействию логистический регрессионный анализ. Независимые факторы риска CSA-AKI оценивались с помощью серии логистической регрессии. В текущем исследовании было идентифицировано в общей сложности 11 значимых детерминант CSA-AKI, включая пожилой возраст, предоперационную гипертензию, предоперационную анемию, LVEF <45%, CCI> 2, время CPB ≥110 минут, перелитые эритроциты, послеоперационная гипотензия, CVP <6 cmH 2 O, ИВЛ ≥9 часов и использование ИАПФ / БРА.Послеоперационное ЦВД <6 см вод. Ст. 2 O и гипотензия были самыми сильными предикторами CSA-AKI.

    Анализ кривой ROC окончательной прогностической модели дал AUC 0,911 со стандартной ошибкой 0,013 и P -значение <0,001. Кроме того, анализ подгрупп показал, что АКШ [OR = 3,2 (2,2–4,8), P <0,001] и смешанная хирургия [OR = 1,8 (1,3–5,8), P = 0,037] были связаны с развитием ОПП у пациенты после кардиохирургии ().

    Таблица 4

    Оценка независимых факторов риска острого повреждения почек с помощью логистического регрессионного анализа.

    лет *

    1,540

    2,0–4,6

    ,73

    час

  • красных кровяных клеток *
  • 93–119 93–197

    Переменные Одномерный анализ Многомерный анализ
    OR 95% CI p Значения OR 95% CI p Значения
    1,9 1,2–3,2 <0,001 1,4 1,1–2,8 0,031
    Мужской 1,5 1,1–2.8 0,033 1,8 0,09–2,1 0,510
    Гипертензия до операции * 2,7 1,8–4,6 <0,001 <0,001 Сахарный диабет 1,4 0,98–2,7 0,051 1,7 0,81–2,6 0,641
    Анемия * 3,7 3.0–6,2 <0,001 2,3 1,9–4,7 0,001
    Фракция выброса левого желудочка <45% * 5,2 3,8–8,4

    <0,00197 2,81 904 –5,5 <0,001
    Индекс коморбидности Чарлсона> 2 * 3,7 2,9–6,0 <0,001 2,5 1,9–4,8 0,003 1,9–4,8 0,003 1.9 0,81–4,6 0,311
    Время коронарного легочного обхода ≥110 мин * 4,3 2,1–6,7 907 4,019 –5,8 <0,001
    Время пережатия аорты> 60 мин 1,7 1,02–2,8 0,031 1,1 0,72–2,2 0,712 2.1 1,4–3,6 0,002 1,5 1,4–4,1 0,003
    Послеоперационная гипотензия * 7,8 3,6–9,1 <0,001
    Центральное венозное давление <6 см вод. Ст. 2 O * 8,4 4,3–12,5 <0,001 8,1 6,4–12,5 <0.001
    Механическая вентиляция ≥9 ч * 2,5 1,8–4,8 <0,001 1,8 1,4–3,9 0,016
    ARBs 9184 * 3,1 2,2–6,4 <0,001 1,9 1,1–2,8 0,005

    Обсуждение

    При анализе 1468 пациентов, перенесших кардиохирургическое вмешательство, послеоперационные ОПП возникли у 33.2% случаев, когда у большинства пациентов была 1 стадия по критериям KDIGO. Частота ОПП в анализе соответствовала результатам других исследований, проведенных на азиатских популяциях [15,23]. Однако частота, о которой сообщалось в текущих результатах, была выше, чем в других исследованиях, проведенных с использованием критериев AKIN [24] и критериев RIFLE [25]. Разница в зарегистрированной заболеваемости может быть связана с несколькими причинами, включая различные определения, используемые для классификации ОПП, время оценки ОПП, диурез по сравнению с критериями SCr и популяционные характеристики.Использование нескольких критериев для стратификации ОПН приводит к большему расхождению в заболеваемости, а также к эпидемиологии ОПН [21]. Более того, в настоящем анализе большинство участников принадлежат к когорте старшего возраста с нарушенной функцией почек. Однако частота ОПП в настоящем исследовании была тесно связана с предыдущими исследованиями, проведенными в китайской популяции [15,23]. Тем не менее, наиболее важным аспектом текущего открытия было значительное количество пациентов, перенесших ОПП после различных видов кардиохирургических вмешательств.Следует использовать единообразные и согласованные определения для обобщения и сравнения результатов, полученных в опубликованной литературе.

    Наиболее частыми операциями в настоящем исследовании были АКШ и клапанные процедуры, но распространенность ОПП была выше у пациентов, перенесших АКШ, по сравнению с теми, кто перенес клапанные и другие операции. Эти результаты согласуются с результатами ретроспективного анализа [7,14,26,27], но в отличие от результатов исследования, в котором распространенность CSA-AKI была значительно выше при хирургии клапанов [5], но это было мета -анализ и имел косвенные доказательства.В настоящем анализе пациенты, перенесшие АКШ, были старше, имели больше нарушений функции почек и сопутствующих заболеваний по сравнению с пациентами, перенесшими клапанные и другие операции. Это могло быть возможной причиной того, что распространенность ОПН была выше при АКШ по сравнению с другими операциями. ОПП у пациентов, перенесших операцию на клапане, отличается от таковой у пациентов, перенесших операцию АКШ.

    Большинство случаев ОПН в настоящем анализе были легкими (стадия 1), однако исследование выявило случаи летальности в группе 1 стадии ОПП.Кроме того, результаты нашего исследования показали, что легкая ОПП также вызвала плохие исходы и смертность по сравнению со случаями без ОПП. Критерии KDIGO для AKI включают легкие случаи с преходящим повышением SCr [19]. Следовательно, выявление и лечение даже легкой ОПП является первоочередной задачей для снижения послеоперационной смертности у пациентов, перенесших операцию на сердце.

    Пациенты с ОПН имели значительно более высокий уровень смертности по сравнению с пациентами без ОПН. Уровень смертности в нашем текущем исследовании (4%) соответствовал результатам ретроспективного анализа, в котором общий коэффициент госпитальной летальности составил 4.1% [14]. Более того, пациенты с CSA-AKI, нуждающиеся в диализе, показали более высокий уровень смертности; аналогичные результаты были представлены в ретроспективном исследовании [23]. Кроме того, в нашем исследовании пациенты с ОПП имели значительно более длительное пребывание в стационаре и в ОИТ, чем пациенты, которые не соответствовали критериям ОПП. Эти результаты согласуются с результатами других исследований, проведенных на китайской популяции [12,15,23]. В совокупности, настоящее исследование показало, что послеоперационная ОПП была частым осложнением после кардиохирургии и сопровождалась плохими исходами и высокой смертностью.

    Наше исследование показало, что у большего числа умерших пациентов была стадия 3 ОПП, за которой следовала стадия 2 ОПП, а затем стадия 1 ОПП. Результаты нашего исследования соответствовали ретроспективным исследованиям [14,17,23,28] . Классификация KDIGO дает более точное представление о уровне смертности и повышает чувствительность диагностики ОПП [29]. Результаты нашего исследования подтвердили рекомендацию оценить факторы риска развития ОПН до операций на сердце.

    Логистический регрессионный анализ показал, что ЦВД <6 см вод.Самым сильным фактором риска было ЦВД <6 см вод. Этот вывод согласуется с результатами предыдущих исследований в китайской популяции и подчеркивает важность послеоперационного замещения жидкости как эффективной меры профилактики ОПП [15]. Гипотония, определяемая систолическим артериальным давлением <90 мм рт.ст. после операции, но до развития ОПН, была еще одним сильным предиктором ОПН. Использование ИАПФ / БРА было связано с риском снижения СКФ [30].Наше исследование пришло к выводу, что пациенты, принимавшие гипотензивные препараты, имели в 2 раза больший риск развития ОПП.

    Наш анализ показал, что мужской пол имел в 1,5 раза более высокую склонность к развитию ОПН по сравнению с женщинами, но пол не выявил какой-либо связи с CSA-AKI в нашем многомерном анализе. Влияние пола на оценку риска ОПП все еще обсуждается. Ретроспективные исследования показали, что мужчины подвержены высокому риску развития ОПН [14,20,23,26]. Другие ретроспективные исследования показали, что женщины подвержены высокому риску развития ОПП [18,27].Несколько исследований показали, что пол не является предиктором CSA-AKI [1,16]. Существует необходимость в дальнейших исследованиях влияния гендера на развитие CSA-AKI.

    Дооперационная анемия была определена как один из важных изменяемых факторов риска в настоящем анализе. Анемия вызывает снижение доставки кислорода почками и нарушает гемостаз. CPB также вызывает нарушение гемостаза, что в дальнейшем приводит к увеличению риска кровотечения. В совокупности, дисфункция тромбоцитов, вызванная анемией, вызывает чрезмерное кровотечение во время операции на сердце, что требует более частого переливания крови, что еще больше увеличивает риск ОПП [11].Наше исследование подтвердило результаты предыдущей литературы [11,12]. Предоперационная анемия влияет на развитие ОПН.

    Текущий анализ показал, что предоперационная гипертензия и сахарный диабет в значительной степени связаны с ОПП, но только гипертензия продемонстрировала независимую связь с ОПП в нашем многомерном анализе. Результаты анализа были аналогичны результатам другого когортного исследования [1]. Сопутствующие заболевания влияют на развитие ОПП.

    Другими модифицируемыми во время операции параметрами риска распространенности ОПП в текущем анализе были операция, CPB и время AXC, которые ранее были описаны в литературе [12,14,23]. Еще одним важным интраоперационным фактором риска, выявленным в настоящем исследовании, было переливание крови. Опубликованные данные показали, что переливание крови во время CPB само по себе может способствовать риску AKI, усугубляя синдром системного воспалительного ответа, инициированного CPB, вторым воспалительным ответом, что дополнительно способствует ишемическому реперфузионному повреждению почек [12].Более того, хорошо задокументировано, что даже небольшое постепенное увеличение SCr может вызвать худшие краткосрочные и долгосрочные результаты, связанные со смертностью и заболеванием почек de-novo [20]. Результаты настоящего исследования подчеркивают внимание лечащих врачей к изменяемым во время операции факторам риска, способствующим развитию ОПН. Эти факторы следует тщательно контролировать и, если их невозможно избежать, следует учитывать при планировании наблюдения за пациентами после кардиохирургических операций.

    Следует учитывать несколько ограничений текущего анализа. Поскольку настоящее исследование носило ретроспективный характер, нельзя игнорировать риск систематических ошибок при интерпретации результатов. Более того, анализ не давал точной предоперационной оценки СКФ, и возможно, что у некоторых пациентов на момент включения в исследование уже были почечные дисфункции. И последнее, но не менее важное: классификация ОПП в настоящем исследовании основывалась на SCr, а не на диурезе.Однако классификация ОПП на основе диуреза менее практична из-за удаления мочевых катетеров через 2 дня после операции. В будущем необходимы крупные популяционные исследования, чтобы подтвердить результаты текущего исследования и разработать модифицируемую шкалу риска, особенно среди китайского населения.

    Блокада остеопонтина ослабляет повреждение почек после реперфузии ишемии путем ингибирования инфильтрации NK-клеток

    Abstract

    Ишемия-реперфузия почек (RIR) — обычное явление после обширных операций и шока, приводящее к острому повреждению почек (AKI).Остеопонтин (OPN) — это секретируемый гликопротеин, который действует как провоспалительный цитокин и активатор Т-лимфоцитов. Мы предположили, что блокада OPN снижает тяжесть воспаления и травмы в RIR. Ишемию почек индуцировали у взрослых мышей C57BL / 6 посредством двустороннего пережатия почечных ножек в течение 35 минут с последующей реперфузией в течение 24 часов. Антитело против OPN (Ab), неиммунизированный изотип IgG или физиологический раствор вводили внутривенно во время реперфузии. На анализ брали кровь и почки.Через 24 часа после RIR уровни мРНК и белка OPN были значительно увеличены в почечной ткани по сравнению с фиктивными мышами. В сыворотке у мышей, получавших анти-OPN Ab, повышенные уровни BUN и креатинина были снижены по сравнению с носителем. У мышей, получавших анти-OPN Ab, также были снижены уровни мРНК маркеров повреждения, липокалина, ассоциированного с нейтрофильной желатиназой, (NGAL) и молекулы повреждения почек-1 (KIM-1) по сравнению с носителем. Гистологическая архитектура и апоптоз почечной ткани были улучшены у мышей, получавших антитела против OPN.В почечной ткани уровни воспалительных цитокинов IL-6 и TNF-α были снижены у мышей, получавших Ab. Инфильтрация NK-клеток уменьшалась после лечения анти-OPN Ab, как и инфильтрация нейтрофилов, о чем свидетельствует снижение экспрессии хемокинов и почечное иммуногистохимическое окрашивание Gr1. Эти данные демонстрируют положительную роль блокады OPN в RIR, связанной с опосредованным NK-клетками подавлением воспалительных цитокинов и хемокинов. Следовательно, введение анти-OPN Ab может служить иммуномодулирующим дополнением при лечении RIR-индуцированной AKI.

    Ключевые слова: Острое повреждение почек, воспаление, апоптоз, нейтрофилы, NK-клетки

    ВВЕДЕНИЕ

    Почечная ишемия-реперфузия (RIR) часто возникает после серьезного хирургического вмешательства, такого как трансплантация почки, или после гиповолемического или септического шока. RIR может привести к острому повреждению почек (AKI) и связан с высокой заболеваемостью и смертностью. У тяжелобольных пациентов с ОПП оценочная смертность составляет 30–70%, что выше, когда они связаны со стадией 2 или 3 ОПП (1–5).Эти пациенты также в два раза чаще будут переведены в учреждение краткосрочной или долгосрочной медицинской помощи, а не на дому, что значительно увеличивает расходы на здравоохранение (1, 3). После первоначального инсульта у многих пациентов развивается хроническая болезнь почек и, в конечном итоге, терминальная стадия почечной недостаточности. Поскольку окончательного лечения ОПН не существует, варианты лечения сосредоточены исключительно на профилактике и поддерживающей терапии. Тем не менее, продолжающиеся исследования продолжают продвигать наше понимание патофизиологии ишемической ОПП, приводя к новым подходам к лечению.

    При ишемии лишение кислорода и доставки питательных веществ к клеткам приводит к накоплению в ткани отходов метаболизма, что приводит к гибели клеток (1, 6). В почках повреждение аноксических клеток развивается в эпителиальных клетках почечных канальцев (ТЭК) (1). Врожденные иммунные клетки, такие как естественные клетки-киллеры (NK), нейтрофилы и макрофаги, активируются и мигрируют в ткань, что вызывает дальнейшее клеточное повреждение ТЭК за счет высвобождения цитокинов и активных форм кислорода (7, 8).Из клеток врожденного иммунитета NK-клетки представляют собой цитотоксические лимфоциты, которые играют решающую роль в повреждении RIR (9–11). Эти клетки содержат перфорин и гранзимы, и при высвобождении в непосредственной близости от клеток-мишеней перфорин образует поры в клеточной мембране, через которые могут проникать гранзимы, вызывая апоптоз или осмотический лизис клеток (12). Также известно, что NK-клетки обеспечивают иммунитет против патогенов и опухолей благодаря своей способности секретировать цитокины (7). Эти клетки конститутивно экспрессируют рецепторы цитокинов и хемокинов, обеспечивая быстрый ответ провоспалительных молекул, которые усиливают накопление полиморфно-ядерных гранулоцитов, вызывая повреждение тканей (7).

    Некоторые молекулы / факторы были идентифицированы как регуляторы активации и инфильтрации NK-клеток во время RIR. Остеопонтин (OPN) представляет собой секретируемый гликопротеин, который первоначально был идентифицирован как молекула костного матрикса, но позже было обнаружено, что он повсеместно экспрессируется в широком диапазоне тканей с множеством функций, включая миграцию клеток, адгезию и активацию лимфоцитов (13). После повреждения почек экспрессия OPN значительно повышается во всех сегментах канальцев и клубочках (13).Использование мышей с нокаутом OPN (KO) продемонстрировало роль OPN в стимулировании индуцированного NK-клетками почечного повреждения во время RIR, и что в условиях in vitro OPN может приводить к миграции и активации NK-клеток, вызывая гибель TEC (10). С другой стороны, у мышей OPN KO также было продемонстрировано повышенное повреждение после RIR, что свидетельствует о ренопротекторной роли OPN (14). Это несоответствие может быть связано с различиями в генетическом происхождении этих линий мышей KO. Кроме того, использование мышей KO не отражает нормальной физиологии.Чтобы устранить несоответствие между этими двумя исследованиями роли OPN во время RIR и выяснить, является ли OPN подходящей мишенью для терапевтического вмешательства, мы оценили эффект блокирования активности OPN на повреждение RIR у животных дикого типа (WT) с нормальной экспрессией OPN. .

    В этом исследовании, используя модель RIR на мышах, мы показали, что уровни мРНК и белка OPN значительно повышаются в почечной ткани после ишемического повреждения. Повреждение почек, воспаление и апоптоз ослаблялись, когда анти-OPN антитело (Ab) вводили мышам RIR по сравнению с животными, которым вводили носитель.Этот улучшенный прогноз был связан со снижением инфильтрации NK-клеток в почках во время RIR. Эти данные подтверждают нашу гипотезу о том, что нейтрализация OPN может снизить тяжесть повреждения почек за счет уменьшения инфильтрации NK-клеток в RIR.

    МАТЕРИАЛЫ И МЕТОДЫ

    Животная модель RIR

    Взрослых самцов мышей C57BL / 6 (возраст 8–10 недель, 20–25 г; Charles River Laboratories; Уилмингтон, Массачусетс) индуцировали 2,5% ингаляционным изофлураном, а затем готовили. промывание живота 10% повидон-йодом.Был сделан разрез по средней линии, и кишечник был смещен, чтобы выявить двусторонние почечные хилы. Микроваскулярные зажимы накладывали на каждую почечную ножку на 35 мин; после удаления брюшная полость закрывалась непрерывным нейлоновым швом 6-0 и подкожно вводился болюс 500 мкл физиологического раствора. Реперфузия разрешена на 24 ч; Затем животных собирали на кровь и почечную ткань. Имитационным животным была выполнена лапаротомия без ишемии почек. Все эксперименты проводились в соответствии с руководящими принципами использования экспериментальных животных Национальными институтами здравоохранения (Bethesda, MD) и были одобрены Комитетом по уходу и использованию институциональных животных (IACUC) Института медицинских исследований Файнштейна.

    Введение нейтрализующего антитела OPN

    Во время реперфузии мышам инъецировали одно из следующего: (1) очищенные сродством мыши поликлональные Ab, антитела против OPN (R&D Systems; Миннеаполис, Миннесота; Каталожный номер: AF808 ), (2) нормальный (неиммунизированный) козий иммуноглобулин G (IgG) (R&D Systems; каталожный номер: AB-108-C) или (3) PBS (носитель). Антитела вводили в дозе 1,5 мг / кг в объеме 100 мкл PBS. Инъекции производили в хвостовую вену у основания хвоста с использованием инсулинового шприца U-100 29G × 1/2 дюйма (Terumo Medical Corporation; Элктон, Мэриленд).Перед инъекцией кожа была обработана 70% -ным изопропиловым спиртом, а после этого на место было оказано давление, чтобы предотвратить кровотечение и способствовать гемостазу.

    Анализ сывороточных маркеров почечной функции

    Образцы крови центрифугировали при 2000 g в течение 15 минут для сбора сыворотки, а затем либо немедленно анализировали на параметры повреждения, либо хранили при -80 ° C. Азот мочевины крови (АМК) и креатинин измеряли с использованием коммерческих наборов для анализа в соответствии с инструкциями производителя (Pointe Scientific; Lincoln Park, MI).

    Количественный анализ ПЦР в реальном времени

    Суммарную РНК экстрагировали из почечной ткани и гомогенизировали с использованием ультразвукового дисмембратора в TRIzol (Invitrogen; Карлсбад, Калифорния). Затем РНК подвергали обратной транскрипции в кДНК с использованием обратной транскриптазы вируса лейкемии мышей (Applied Biosystems; Foster City, CA). Реакцию ПЦР проводили в 20 мкл конечного объема, содержащего 1,25 пмоль прямого и обратного праймера, ~ 350 нг кДНК и 10 мкл основной смеси для ПЦР SYBR Green (Applied Biosystems). Температурный профиль, используемый машиной для ПЦР в реальном времени Applied Biosystems 7300, составлял: 50 ° C в течение 2 минут, 95 ° C в течение 10 минут, 45 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 1 минуты.Для нормализации использовали β-актин мыши. Относительная экспрессия мРНК была представлена ​​как кратное изменение по сравнению с фиктивной группой. Последовательности праймеров были разработаны с использованием программного обеспечения Primer 3 (15), которое включает: OPN ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «NM_001204201», «term_id»: «323668332). «,» term_text «:» NM_001204201 «}} NM_001204201) Вперед: TCTGATGAGACCGTCACTGC, Назад: AGGTCCTCATCTGTGGCATCOPN; NGAL ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «NM_005564.4», «term_id»: «7465″, «term_text»: «NM_005564.4 «}} NM_005564.4): Вперед: CTCAGAACTTGATCCCTGCC, Обратное: TCCTTGAGGCCCAGAGACTT; KIM-1 ({» type «:» entrez-нуклеотид «,» attrs «: {» text «:» NM_134248.2 «,» term_id » : «262231820», «term_text»: «NM_134248.2»}} NM_134248.2): TGCTGCTACTGCTCCTTGTG, Reverse: GGGCCACTGGTACTCATTCT; KC ({«type»: «entrez-nucleotide», «attrs»: {«text»: » NM_008176 «,» term_id «:» 229577225 «,» term_text «:» NM_008176 «}} NM_008176): Вперед: GCTGGATTCACCTCAAGAA, Обратное: ACAGGTGCCATCAGAGCAGT; β-actin ({» type «:» entders «, entrez- {«text»: «NM_007393», «term_id»: «

    5786″, «term_text»: «NM_007393»}} NM_007393): Вперед: CGTGAAAAGATGACCCAGATCA, Назад: TGGTACGACCAGAGGCATACAG.

    Измерение провоспалительных цитокинов и OPN

    Провоспалительные цитокины, интерлейкин 6 (IL-6) и фактор некроза опухоли (TNF) -α в почечной ткани были определены количественно с использованием наборов для иммуноферментного анализа мыши (ELISA) (BD Biosciences). , Франклин Лейкс, Нью-Джерси). ОПН в почечной ткани измеряли с использованием набора ELISA для мышей (R&D Systems).

    Гистологическая оценка повреждения почек и иммуногистохимия

    Ткань почек фиксировали в 10% формалине и заливали парафином.Ткань разрезали на срезы 5 мкм и окрашивали гематоксилином и эозином (H&E). С помощью световой микроскопии степень повреждения оценивалась слепым методом по следующим категориям: повреждение канальцевых клеток, отслоение канальцевых клеток, потеря границы кисти, тубулярное упрощение и формирование гипсовой повязки. Гистологические изменения оценивали слепым методом в соответствии с модифицированной системой баллов, основанной на степени повреждения ткани (16). Вкратце, оценка 0 соответствует 0% травм, 1 (<10%), 2 (10-25%), 3 (25-50%), 4 (50-75%) и 5 ​​(> 75%), для максимального результата 25.Баллы были усреднены для каждой выборки по 10 случайно выбранным полям.

    Для иммуногистохимии Gr-1 залитые в парафин почечные ткани депарафинизировали в ксилоле и регидратировали в последовательных промывках этанолом. Срезы нагревали в 0,92% -ном буфере лимонной кислоты (Vector Laboratories; Burlingame, CA) при 95 ° C в течение 30 минут. После охлаждения слайды инкубировали с 2% H 2 O 2 /60% метанола и блокировали нормальной кроличьей сывороткой / трис-буферным физиологическим раствором. Наносили анти-Gr-1 Ab (Abcam; Cambridge, MA) и инкубировали в течение ночи при 4 ° C.Реагент Vectastain ABC и набор DAB (Vector Laboratories) использовали для обнаружения иммуногистохимической реакции. Срезы контрастировали гематоксилином и исследовали под фазово-контрастным световым микроскопом Eclipse Ti-S (Nikon; Мелвилл, Нью-Йорк). Программное обеспечение для визуализации NIS-Elements BR (Nikon) использовали для количественного определения окрашенных в коричневый цвет клеток Gr-1 + .

    Терминальная дезоксинуклеотидилтрансфераза, dUTP, анализ ник-конца (TUNEL)

    Присутствие апоптотических клеток измеряли с помощью in situ мечения фрагментации ДНК с использованием анализа TUNEL.Использовали набор для обнаружения клеточной смерти in situ (Roche Diagnostics; Индианаполис, Индиана). Слайды контрастировали с 4 ‘, 6-диамидино-2’-фенилиндол дигидрохлоридом (DAPI). Анализ проводился с использованием светового микроскопа Eclipse Ti-S (Nikon), а программное обеспечение для визуализации NIS-Elements BR (Nikon) использовалось для количественной оценки флуоресцентных клеток.

    Измерение активности каспазы-3

    Ткань почек гомогенизировали в буфере для лизиса (10 мМ HEPES, pH 7,4; 5 мМ MgCl 2 ; 1 мМ DTT; 1% Triton X-100; 2 мМ EGTA; 2 мМ EDTA. ), содержащий ингибитор протеазы (Roche Diagnostics; Indianapolis, IN).Концентрации белка определяли с помощью реагента для анализа белков Bio-Rad (Bio-Rad Laboratories; Hercules, CA). Пептид субстрата каспазы-3 (DEVD-AMC) добавляли к аналитическому буферу (20 мМ HEPES, pH 7,4; 5 мМ DTT, 2 мМ EDTA, 0,1% CHAPS). После 60–90 мин инкубации при 37 ° C в темноте флюорометрический ридер использовался для измерения возбуждения (365–380 нм) и эмиссии (430–460 нм). Результаты были разделены на концентрацию белка и выражены как кратное изменение.

    Оценка NK-клеток с помощью проточной цитометрии

    NK-клетки были очищены из почек мыши через 24 часа после RIR или фиктивной лапаротомии.Клетки выделяли с помощью панкреатина (Sigma-Aldrich; Сент-Луис, Миссури) и расщепления коллагеназой (Уортингтон; Лейквуд, Нью-Джерси), как описано ранее (17). Вкратце, почечные гидролизаты инкубировали при 37 ° C в течение 10 минут, а затем пропускали через фильтр с размером ячеек 70 мкм. Клетки окрашивали флуоресцентными антителами APC-CD3, PE-CD49b и PE-изотипом контроля (Biolegend, Сан-Диего, Калифорния) в буфере для проточной цитометрии (PBS, 2% фетальной телячьей сыворотки, 0,1% азида натрия). Для каждого эксперимента по проточной цитометрии для обнаружения антигенов клеточной поверхности с использованием многоцветных флуоресцентных антител мы использовали неокрашенные контроли с одноцветной компенсацией, чтобы избавиться от любого возможного побочного эффекта индивидуальной флуоресценции.Данные были получены с использованием проточного цитометра BD LSRFortessa (BD Biosciences; Сан-Хосе, Калифорния) и проанализированы с помощью программного обеспечения FlowJo 7.6.5 (FlowJo LLC; Ashland, OR).

    Статистический анализ

    Данные выражены как среднее ± стандартная ошибка среднего (SEM) и сравниваются с помощью одностороннего дисперсионного анализа (ANOVA) и теста Стьюдента-Ньюмана-Кеулса (SNK) для множественных сравнений групп. Значимость считалась, если p <0,05 между экспериментальными группами.

    РЕЗУЛЬТАТЫ

    RIR увеличивает экспрессию OPN в почках

    Сначала мы определили, увеличилась ли экспрессия OPN в почках после RIR.Экспрессия OPN на уровне его мРНК была увеличена в 13 раз в почках RIR по сравнению с ложнооперированными животными (). Точно так же было обнаружено, что уровни белка OPN увеличиваются в 3 раза в почках RIR по сравнению с фиктивными мышами ().

    Повышение экспрессии OPN в почках после RIR

    Почечную ткань мышей, обработанных ложным, носителем, контрольным IgG и анти-OPN Ab, собирали через 24 часа после RIR. Уровни мРНК OPN (A) и белка (B) определяли с помощью qRT-PCR и ELISA, соответственно.Данные выражены как среднее значение ± стандартная ошибка среднего (n = 6–10 мышей / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK. * p <0,05 по сравнению с фиктивным. RIR - ишемия-реперфузия почек; ОПН, остеопонтин; ИФА, иммуноферментный анализ.

    Нейтрализация OPN улучшает функцию почек после RIR

    Мы исследовали функцию почек, анализируя сывороточные уровни BUN и креатинина. И BUN, и креатинин были значительно увеличены в носителе после RIR по сравнению с фиктивными мышами. Мыши, обработанные неиммунизированным контрольным антителом IgG, не показали значительных различий по сравнению с мышами, обработанными носителем.У мышей, получавших анти-OPN Ab, хотя уровни BUN и креатинина все еще были значительно выше, чем у животных, подвергшихся ложной операции, мы заметили значительное снижение уровней BUN и креатинина на 25% и 22%, соответственно, по сравнению с мышами, получавшими носитель. ().

    Нейтрализация OPN улучшает почечную функцию

    Образцы сыворотки из групп имитации, носителя, контроля IgG и анти-OPN Ab были собраны для измерения (A) BUN и (B) креатинина. Данные выражены как среднее значение ± SEM (n = 7–9 мышей / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK.* p <0,05 по сравнению с фиктивным; # p <0,05 по сравнению с носителем; ψ p <0,05 по сравнению с IgG. АМК - азот мочевины крови; ОПН, остеопонтин.

    Нейтрализация OPN снижает уровни маркеров повреждения почек после RIR

    Чтобы определить повреждение почек, мы проанализировали дополнительные маркеры, которые были выделены в недавно опубликованных исследованиях (18, 19). Во-первых, мы изучили липокалин, связанный с желатиназой нейтрофилов (NGAL), который служит ранним биомаркером ОПП (18).Он является частью липокалинового суперсемейства секретируемых белков, значительно активированных в стимулированных эпителиальных клетках (18). Уровень мРНК NGAL был снижен на 41% у мышей, получавших анти-OPN Ab, по сравнению с мышами, получавшими носитель (). Затем мы изучили экспрессию молекулы-1 повреждения почек (KIM-1), которая представляет собой трансмембранный белок, экспрессирующийся на низком уровне в нормальной почке, но резко повышенный в постишемической почке (19). Уровень мРНК KIM-1 был значительно снижен на 49% в почках мышей, получавших анти-OPN Ab, по сравнению с мышами, получавшими носитель ().

    Нейтрализация OPN снижает новые маркеры почечного повреждения

    Почечную ткань мышей, обработанных ложным, носителем, контрольным IgG и анти-OPN Ab, собирали для измерения мРНК (A) NGAL и (B) KIM-1 с помощью qRT-PCR. Уровни их экспрессии были нормализованы по β-актину, и для сравнения фиктивность была обозначена как 1. Данные выражены как среднее значение ± стандартная ошибка среднего (n = 6-8 мышей / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK. * p <0,05 по сравнению с фиктивным; # p <0.05 по сравнению с автомобилем; ψ p <0,05 по сравнению с IgG. ОПН, остеопонтин; NGAL, липокалин, связанный с желатиназой нейтрофилов; КИМ-1 почечная травма молекула-1.

    Нейтрализация OPN защищает от повреждения почечной ткани после RIR

    Чтобы определить, приводит ли ингибирование активности OPN с помощью Ab к уменьшению повреждения почек, мы оценили гистологию ткани с помощью окрашивания гематоксилином и эозином (H&E). Через 24 часа после RIR наблюдалась заметная разница в степени повреждения клеток канальцев и образования гипсов у животных, получавших анти-OPN Ab, по сравнению с контрольными мышами, получавшими носитель и IgG ().Используя полуколичественную гистологическую оценку, была рассчитана оценка травмы на основе критериев, описанных в разделе «Материалы и методы». Улучшение на 37% было отмечено у мышей, получавших анти-OPN Ab, по сравнению с группой носителя (). Помимо этого, при кратком исследовании срезов нашей почечной ткани после RIR мы наблюдали некоторые качественные различия в уровнях повреждения клубочков и подоцитов, при этом лечение анти-OPN Ab показало уменьшение повреждений (данные не показаны).

    Нейтрализация OPN снижает гистологическое повреждение почек.

    Срезы почечной ткани мышей, обработанных имитацией, носителем, контрольным IgG и анти-OPN Ab, собирали после RIR и окрашивали H&E. (A) Репрезентативные срезы показаны при 200-кратном увеличении. (B) Оценка гистологического повреждения, как описано в разделе «Материалы и методы». Оценка представляет собой процент морфологических изменений следующим образом: 1, <10%; 2, 10–25%; 3, 26–50%; 4, 51–75%; 5+,> 75%. Данные выражены как среднее значение ± стандартная ошибка среднего (n = 10 микроскопических полей на группу) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK. * p <0,05 по сравнению с фиктивным; # p <0,05 по сравнению с носителем; ψ p <0.05 против IgG. H&E, гематоксилин и эозин; ОПН, остеопонтин.

    Нейтрализация OPN подавляет почечный апоптоз после RIR

    Клеточный апоптоз является отличительной чертой повреждения тканей во время RIR. Анализ TUNEL проводили на срезах почечной ткани, и он показал значительное увеличение TUNEL-положительного окрашивания в группе носителя и контрольной группе IgG по сравнению с фиктивными животными (). Напротив, у мышей RIR, получавших анти-OPN Ab, наблюдалось снижение TUNEL-положительного окрашивания на 79% по сравнению с мышами-носителем ().Каспаза-3 служит важным медиатором клеточного апоптоза, вызывая повреждение тканей во время воспаления (20). Мы провели анализ ферментативной активности каспазы-3, который показал значительное повышение регуляции в почечных тканях во время индукции RIR; однако его активность была значительно снижена в группе, получавшей анти-OPN Ab, на 59% по сравнению с животными-носителями ().

    Нейтрализация OPN снижает почечный апоптоз

    Срезы почечной ткани мышей, обработанных имитацией, носителем, контрольным IgG и анти-OPN Ab, собирали через 24 часа после RIR. (A) Репрезентативные микрофотографии показывают TUNEL-позитивное (зеленый) и DAPI (синий) ядерное контрастное окрашивание. (B) TUNEL-положительных клеток на 200 × поле. (C) Анализ активности фермента каспазы-3 проводили с тканью почек. Данные выражены как среднее значение ± стандартная ошибка среднего (анализ TUNEL, n = 20 микроскопических полей / группа; анализ Caspase n = 6–9 мышей / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK. * p <0,05 по сравнению с фиктивным; # p <0,05 по сравнению с носителем; ψ p <0.05 против IgG. ОПН, остеопонтин; TUNEL, мечение ник-концов терминальной дезоксинуклеотидилтрансферазы dUTP; DAPI, 4 ', 6-диамидино-2'-фенилиндол дигидрохлорид.

    Нейтрализация OPN снижает провоспалительные цитокины в почках после RIR

    Воспаление — еще один важный путь, вызывающий повреждение после RIR. Мы измерили уровни провоспалительных цитокинов IL-6 и TNF-α в почечной ткани. С помощью ELISA было обнаружено, что уровень IL-6 значительно увеличился у мышей с носителем и контрольным IgG, но значительно снизился на 30%, когда мышей RIR лечили антителами против OPN по сравнению с мышами с носителем ().Было также обнаружено, что TNF-α значительно увеличивался у мышей с носителем и контрольным IgG, но снижался на 51% в группе, получавшей анти-OPN Ab, по сравнению с мышами с носителем (). Таким образом, воспаление почек значительно уменьшается, когда OPN эффективно нацелен на его нейтрализующие Ab.

    Нейтрализация OPN снижает воспаление почек

    Почечную ткань мышей, обработанных имитацией, носителем, контрольным IgG и анти-OPN Ab, собирали для измерения уровней цитокинов (A) IL-6 и (B) TNF- α с помощью ELISA.Данные выражены как среднее значение ± стандартная ошибка среднего (n = 6–9 мышей / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK. * p <0,05 по сравнению с фиктивным; # p <0,05 по сравнению с носителем; ψ p <0,05 по сравнению с IgG. ОПН, остеопонтин; ИЛ, интерлейкин; TNF, фактор некроза опухоли; ИФА, иммуноферментный анализ.

    Нейтрализация OPN снижает инфильтрацию NK-клеток в почках после RIR

    NK-клетки вносят важный вклад в повреждение почек после RIR (9).Используя флуоресцентно меченые антитела для маркеров, специфичных для NK-клеток, проточную цитометрию использовали для идентификации популяции NK-клеток из суспензии цельных клеток почек. CD3 CD49b + NK-клетки отбирали через серию ворот; сначала регистрировали лейкоциты в общей популяции клеток почек, затем клетки CD3 и, наконец, клетки CD49b + (). Было обнаружено, что популяция NK-клеток увеличивалась у мышей-носителей в 7 раз по сравнению с фиктивными мышами. С другой стороны, частота NK-клеток в почках мышей RIR, получавших анти-OPN Ab, была значительно снижена на 31% по сравнению с мышами, получавшими носитель ().

    Нейтрализация OPN снижает инфильтрацию NK-клеток

    Почечную ткань мышей, обработанных ложным, носителем, контрольным IgG и анти-OPN Ab, собирали через 24 часа после RIR. Клетки выделяли и окрашивали на CD3 CD49b + NK-клеток. (A) Показаны типичные изображения потоков со стратегиями стробирования. (B) Частоты NK-клеток, выраженные в процентах от CD3 лейкоцитов. Данные выражены в виде среднего значения ± SEM (n = 8–10 животных / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK.* p <0,05 по сравнению с фиктивным; # p <0,05 по сравнению с носителем; ψ p <0,05 по сравнению с IgG. Н.К., естественный убийца; ОПН, остеопонтин.

    Нейтрализация OPN снижает инфильтрацию нейтрофилов в почках после того, как было показано, что NK-клетки RIR

    способствуют инфильтрации нейтрофилов в ткани при воспалении (21). Для оценки нейтрофилов на срезах почечной ткани проводили иммуногистохимию для Gr-1, антител, специфичных для нейтрофилов. Было обнаружено, что Gr-1 увеличивался в почках мышей контрольной группы носителя и IgG, но уменьшался на 85% у мышей, получавших анти-OPN Ab ().Также известно, что NK-клетки экспрессируют провоспалительные хемокины во время воспаления (12). Чтобы определить рекрутирование нейтрофилов, мы выполнили количественную ПЦР для хемокинового (мотив C-X-C) лиганда-1 (CXCL-1), также известного как хемоаттрактант кератиноцитов (KC). Уровни мРНК хемокина KC увеличились в 13 и 15 раз у мышей, использующих носитель, и контрольных мышей IgG, соответственно; однако мыши RIR, получавшие анти-OPN Ab, снижали уровень KC на 39% по сравнению с животными, получавшими носитель ().

    Нейтрализация OPN снижает инфильтрацию нейтрофилов

    Срезы почечной ткани мышей, обработанных имитацией, носителем, контрольным IgG и анти-OPN Ab, собирали через 24 часа после RIR. (A) Репрезентативные иммуногистохимические изображения срезов почек показаны при 200 × с 400 × вставками. Коричневые точки указывают на положительное окрашивание Gr1, тогда как ядра контрастируют с синим цветом. (B) Определяют Gr1-положительных клеток на 200-кратное поле. (C) Почечную ткань мышей, обработанных ложным, носителем, контрольным IgG и антителом против OPN Ab, собирали для измерения мРНК KC с помощью кПЦР. Уровни их экспрессии были нормализованы по β-актину, и для сравнения фиктивность была обозначена как 1.Данные выражены как среднее значение ± стандартная ошибка среднего (IHC n = 20 полей / группа; qRT-PCR n = 7-10 мышей / группа) и сравниваются с помощью однофакторного дисперсионного анализа ANOVA методом SNK. * p <0,05 по сравнению с фиктивным; # p <0,05 по сравнению с носителем; ψ p <0,05 по сравнению с IgG. ИГХ, иммуногистохимия; ОПН, остеопонтин; KC, хемоаттрактант кератиноцитов.

    ОБСУЖДЕНИЕ

    ОПП, вызванная травмой RIR, является дорогостоящим и обременительным событием, осложняющим болезнь для многих пациентов. Здесь мы провели исследование с использованием антител против OPN для смягчения опосредованного RIR AKI.Мы обнаружили, что ингибирование OPN его нейтрализующим Ab способно улучшить функцию почек на мышиной модели RIR. Почки мышей проявляли защиту от повреждений, как показал гистологический анализ, и снижали апоптоз, как видно из тестов TUNEL и каспазы-3. Блокада OPN также привела к уменьшению воспаления почечной ткани. Проточная цитометрия NK-клеток в почках показала уменьшение популяции мышей, получавших лечение анти-OPN Ab. Кроме того, снижение экспрессии хемокинов KC и уменьшение инфильтрации нейтрофилов Gr-1 по данным иммуногистохимии подтверждают гипотезу о том, что ингибирование инфильтрации NK-клеток было механизмом, с помощью которого было обнаружено, что блокада OPN эффективна при RIR.

    Блокада ОПН привела к сохранению функции почек и уменьшению их повреждения. Это было продемонстрировано снижением уровней азота мочевины, креатинина, NGAL и KIM-1 у мышей, получавших анти-OPN Ab, что коррелировало с гистологическими данными. АМК и креатинин являются наиболее широко оцениваемыми диагностическими и прогностическими маркерами почечных заболеваний, но новые маркеры повреждений, такие как NGAL и KIM-1, стали многообещающими биомаркерами следующего поколения в клинической нефрологии (18, 19). NGAL был впервые очищен от нейтрофилов человека из-за его ассоциации с желатиназой, и он сильно повышен в почках мышей с ранней постишемией (22).KIM-1 представляет собой трансмембранный гликопротеин, который способствует обструкции просвета канальцев, что характеризует ОПП (23). В клинических исследованиях и NGAL, и KIM-1 являются биомаркерами, которые показали способность прогнозировать ОПП за несколько дней до повышения уровня креатинина в сыворотке (24). В нашем исследовании нацеливание на OPN привело к значительному снижению как NGAL, так и KIM-1, что подчеркивает значение блокады OPN в уменьшении травм RIR.

    Апоптоз — основная патофизиологическая причина повреждения тканей во время RIR. Наш анализ TUNEL выявил значительно меньше TUNEL-положительных клеток в почках, обработанных антителами против OPN, а также меньшую ферментативную активность каспазы-3 по сравнению с почками-носителем и контрольными IgG.Многообещающая область исследований RIR, в частности, включает антиапоптотическое лечение. Стратегия с использованием короткой шпилечной РНК (shRNA), которая нацелена на Fas и каспазу-8 и подавляет их, оказалась защитной в RIR (25). В более позднем исследовании было показано, что ингибитор апоптоза макрофагального белка (AIM) способствует восстановлению после AKI (26). В другой степени, защищая целостность митохондрий, основная органелла участвовала в индукции апоптоза с помощью 5-аминоимидазол-4-карбоксамид рибонуклеозида (AICAR) и карнитина, который также улучшал функцию почек после RIR (27).В соответствии с этими исследованиями, ослабление апоптоза с помощью лечения анти-OPN Ab также приводит к улучшению результатов после RIR.

    Острое воспаление, вызванное RIR, считается еще одним важным путем повреждения. Мы обнаружили усиление экспрессии OPN после RIR в почках, а также в кровообращении (данные не показаны). Сообщалось об индукции экспрессии OPN во время острых и хронических воспалительных заболеваний, как и других провоспалительных цитокинов и хемокинов (28, 29). OPN действует как хемотаксический агент, который способствует миграции воспалительных клеток к месту повреждения, и действует как адгезивный белок, удерживающий клетки (29, 30).В этом исследовании нейтрализация анти-OPN Ab значительно подавляла экспрессию провоспалительных цитокинов IL-6 и TNF-α в почках по сравнению с носителем. В сыворотке также было показано, что уровни TNF-α и IL-1β снижаются при лечении анти-OPN Ab у животных с RIR (данные не показаны). Аналогичным образом Hirano et al. использовал анти-OPN Ab в мышиной модели сепсиса для подавления воспаления, что привело к положительным результатам (28). Нацелив OPN с помощью нейтрализующего Ab, мы смогли снизить чрезмерную продукцию цитокинов и уменьшить повреждение TEC, что привело к общему улучшению после RIR.

    Ранее было показано, что NK-клетки важны для повреждения RIR (9–11). NK-клетки производят токсичные молекулы, такие как перфорин и гранзимы, которые вызывают гибель клеток (12). Мы обнаружили, что инфильтрация NK-клеток уменьшилась после лечения анти-OPN Ab в почках после RIR. Zhang et al. впервые описал взаимодействия между ТЕС и NK-клетками, которые приводят к апоптотической гибели ТЕС (9). Кроме того, используя мышей OPN KO, они обнаружили, что мыши KO имели меньшую инфильтрацию NK-клеток и меньшее повреждение тканей во время RIR по сравнению с мышами WT (10).Мы также показали, что инфильтрация нейтрофилов была ослаблена у мышей, получавших анти-OPN Ab, что коррелировало со сниженной экспрессией хемокина KC. Ранее Kim et al. показали, что передача сигналов через костимулирующий лиганд CD137L в TECs важна для опосредованного NK-клетками рекрутирования нейтрофилов (21). Обратная передача сигналов через CD137L привела к продукции хемокинов CXCL1 / KC и CXCL2 (21). Помимо опосредованной NK-клетками инфильтрации нейтрофилов, нельзя исключить прямую роль OPN в индукции инфильтрации нейтрофилов, основываясь на предыдущем отчете, показывающем, что OPN служил хемоаттрактантом для миграции нейтрофилов in vitro (31).Тем не менее, NK-клетки являются важной частью патогенеза OPN-опосредованного повреждения посредством рекрутирования нейтрофилов после RIR.

    Хотя OPN был исследован другими группами в контексте травмы RIR (10), его результаты в литературе противоречивы. Как упоминалось ранее, Zhang et al. обнаружили, что у мышей OPN KO улучшилась функция почек с меньшим повреждением тканей после RIR по сравнению с мышами WT. Другое исследование с использованием мышей OPN KO обнаружило ухудшение функции почек, связанное с более сильным структурным повреждением, чем у мышей WT, после RIR (14).Поскольку OPN выполняет множество важных функций, связанных с формированием / ремоделированием кости (13), его отсутствие может привести к затруднениям в нормальном формировании кости и к развитию заболеваний, связанных с костной тканью. В почках OPN также продуцируется эпителием просвета нефронов в гомеостатических условиях (13). Он секретируется в жидкость канальцев, но его функция точно не известна (13). В этом исследовании мы разработали терапевтический подход с использованием анти-OPN Ab для лечения RIR-животных, который более точно отражает нормальную физиологию, сохраняя базальные гомеостатические функции OPN нетронутыми.

    Сохранение функции трансплантата почек имеет решающее значение для эффективной трансплантации. Современные экспериментальные стратегии с участием белков, которые подавляют воспаление, окислительный стресс и апоптоз, улучшают выживаемость и функцию трансплантата на животных моделях трансплантации (32). Хотя нет такой литературы, демонстрирующей роль OPN в сохранении трансплантата почки, недавнее исследование было сосредоточено на роли OPN в повреждении аллотрансплантата почки (33). Отторжение трансплантата — это процесс, при котором иммунная система реципиента трансплантата атакует пересаженный орган или ткань, рассматривая их как чужеродное вещество.Недавние исследования показали, что естественные клетки-киллеры (NK) цитотоксичны по отношению к эпителиальным клеткам канальцев и способствуют острому ишемическому реперфузионному повреждению почек (9, 10). Было показано, что OPN, который может активировать NK-клетки для опосредования гибели эпителиальных клеток канальцев, сильно экспрессируется в трансплантатах почек (33). Почечные трансплантаты, не содержащие OPN, имели меньшее повреждение после трансплантации мышам, что указывает на то, что OPN играет пагубную роль в повреждении почечного аллотрансплантата (33). Поскольку наше текущее исследование продемонстрировало положительный результат после лечения анти-OPN Ab с точки зрения ослабления повреждения и воспаления почечной ткани за счет ингибирования инфильтрации NK-клеток в почке, дальнейшие исследования с использованием анти-OPN Ab могут предоставить дополнительную информацию для защиты от повреждения аллотрансплантата почки во время трансплантации. .

    В нашем исследовании мы получили умеренный эффект на функциональные маркеры почек при лечении анти-OPN Ab у мышей с повреждениями, вызванными RIR. Здесь мы приняли модель RIR, которая фокусировалась только на острой фазе, собирая образцы после 24 часов реперфузии. Однако мы предполагаем, что эксперименты, проведенные в более поздние периоды времени, дадут ценную информацию о степени эффективности лечения анти-OPN Ab для значительного снижения параметров заболевания. Дальнейшие исследования по более длительным временным точкам RIR, отличным от 24 часов, будут представлять большой интерес.Одна из ловушек нашего исследования заключается в том, что мы не смогли установить сильную экспериментальную связь между лечением анти-OPN у мышей RIR и модуляцией инфильтрации NK-клеток. Тем не менее, на основании текущих литературных данных мы делаем вывод об их причинно-следственной связи, поскольку Zhang et al и Victorino et al показали, что патология AKI напрямую связана с NK-клетками (9, 11), а OPN напрямую связана с NK-клетки (10).

    Таким образом, мы продемонстрировали, что нейтрализация OPN может уменьшить почечную дисфункцию, вызванную чрезмерным воспалением, повреждением клеток, апоптозом и инфильтрацией нейтрофилов после RIR.Эти эффекты, вероятно, связаны с уменьшением набора NK-клеток в почки. Хотя роль OPN широко изучалась в области RIR, выводы сильно разошлись. Наша цель исследовать OPN посредством нейтрализации антител дает дополнительные доказательства того, что OPN является вредным агентом при ишемии почек. Следовательно, нацеливание на OPN после RIR может быть многообещающим терапевтическим вариантом для пациентов с высоким риском ишемического повреждения почек.

    Экспрессия, роли, рецепторы и регуляция остеопонтина в почках

    Экспрессия, роли, рецепторы и регуляция остеопонтина в почках. Остеопонтин (OPN) представляет собой секретируемый гликопротеин как в фосфорилированной, так и в нефосфорилированной формах. Он содержит последовательность связывания клеток Arg-Gly-Asp и сайт расщепления тромбином. ОПН в основном присутствует в петле Генле и дистальных отделах нефронов нормальных почек у животных и человека. После повреждения почек экспрессия OPN может значительно повышаться во всех сегментах канальцев и клубочках. Исследования с использованием мышей с дефицитом гена OPN, животных, получавших антисмысловую или анти-OPN, продемонстрировали, что OPN способствует накоплению макрофагов и может играть роль в опосредованном макрофагами повреждении почек, но эффект может быть слабым и непродолжительным. .С другой стороны, OPN обладает некоторым ренопротекторным действием при повреждении почек, например, повышает толерантность к острой ишемии, ингибирует индуцибельную синтазу оксида азота и подавляет синтез оксида азота, снижает уровень перекиси в клетках и способствует выживанию клеток, подвергшихся гипоксии, уменьшая апоптоз клеток. и участие в регенерации клеток. Кроме того, OPN связан с почечными камнями, но вопрос о том, действует ли он в качестве промотора или ингибитора образования камней, является спорным. Было продемонстрировано, что рецепторы OPN включают два семейства: интегрин и CD44.Рецепторы интегрина OPN включают α v β 3 , α v β 1 , α v 5 и α 9 β 1 и α 4 β 1 . В нормальных почках человека стандартный CD44 экспрессируется наиболее доминирующим образом. Различные функции OPN опосредуются разными рецепторами. Гормон паращитовидной железы, витамин D 3 , кальций, фосфат и некоторые цитокины увеличивают экспрессию OPN in vitro или in vivo, тогда как женские половые гормоны и ингибиторы ангиотензинпревращающего фермента или антагонисты рецепторов ангиотензина II снижают экспрессию OPN при некоторых состояниях повреждения почек.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *